Mother obesity related offspring kidney disease marker and treatment target

Abstract

The invention provides a maternal obesity-related offspring kidney disease marker and a treatment target. The molecular mechanism of 20-HETE in regulating occurrence and development of maternal obesity-related offspring kidney diseases is deeply explored. Compared with an existing kidney disease diagnosis method and a non-specific drug treatment mode, a novel non-invasive diagnosis and prognosis biomarker is found by exploring specific unsaturated fatty acid metabolites, and a novel target spot is provided for treatment. The diagnosis and treatment scheme based on specific metabolites may improve the compliance and treatment effect of patients, and has good application prospects.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to a biomarker and a therapeutic target for kidney diseases in offspring related to maternal obesity. Background Art

[0002] Chronic kidney disease (CKD) generally refers to irreversible loss of renal function lasting for more than 3 months. With its characteristics of high prevalence and low awareness rate, this disease poses great challenges to the early prevention and treatment of CKD.

[0003] Under the influence of high-calorie diets, processed foods, and sedentary lifestyles, the prevalence of obesity among women of childbearing age has been continuously increasing, which not only has an adverse impact on obstetric health but also increases the long-term health risks of offspring. According to a recent meta-analysis, these risks include overweight and obesity in offspring, early puberty, attention deficit hyperactivity disorder, cerebral palsy, congenital heart disease, spina bifida, and a higher body fat percentage. Experimental studies have shown that maternal obesity may have a causal impact on phenotypes such as cognitive impairment and glucose intolerance in offspring through changes in DNA methylation, histone reprogramming, or the gut microbiome. Notably, there has been relatively little attention in the existing literature to maternal obesity as a risk factor for CKD. Although some clinical studies have shown that maternal gestational diabetes and overweight / obesity are significantly associated with an increased risk of CKD in offspring during childhood or adulthood.

[0004] In recent years, it has been found that the transformation of macrophages into myofibroblasts is an important driving factor for fibrosis in various tissues and organs including the kidney. After the kidney is damaged and enters the repair stage, CD206-positive macrophages can simultaneously express myofibroblast cell markers under the action of TGFβ, promoting the development of renal fibrosis. In addition, blocking the transformation of macrophages into myofibroblasts through drugs or other means can significantly improve renal fibrosis.

[0005] 20-Hydroxyeicosatetraenoic acid (20-HETE) is an eicosanoid produced from arachidonic acid by the metabolism of the P450 CYP4A subfamily in the kidney. The study by Afshinnia et al. found that patients with end-stage renal disease had higher levels of 20-HETE in their sera compared with those in the control group. Zhou et al. found in a mouse model of angiotensin II-induced kidney injury that the level of 20-HETE in the kidneys of kidney-injured mice was increased compared with that in the control mice, and inhibition of 20-HETE could improve the progression of renal fibrosis. These evidences indicate that 20-HETE is associated with the occurrence and development of chronic kidney disease. However, its specific molecular mechanism remains to be further elucidated.

[0006] Currently, the gold standard for the diagnosis of kidney diseases is still renal biopsy, lacking new biology-based non-invasive diagnostic and prognostic biomarkers; for most patients after progression to renal failure, the only treatment options are renal dialysis or renal transplantation. A major reason for the progression of most CKD patients to renal failure eventually is the late detection of CKD. Most current studies ignore maternal obesity as a risk factor for kidney diseases in offspring, resulting in late detection of kidney diseases. Although evidences indicate that 20-HETE is associated with the occurrence and development of chronic kidney disease, its molecular mechanism underlying maternal obesity-related kidney diseases in offspring has not been fully explored. Summary of the Invention

[0007] The main object of the present invention is to provide a biomarker and a therapeutic target for maternal obesity-related kidney diseases in offspring, and it is expected to provide a research and development idea based on 20-HETE as a biomarker and a therapeutic target to effectively alleviate the progression of maternal obesity-related kidney diseases in offspring.

[0008] On the one hand, the present invention provides a biomarker for maternal obesity-related kidney diseases in offspring, and the biomarker is 20-HETE. The 20-HETE promotes the progression of maternal obesity-related kidney diseases in offspring by promoting the transformation of macrophages into myofibroblasts.

[0009] On the other hand, the present invention provides a detection product comprising the biomarker described above.

[0010] Further, the detection product comprises a kit, a test strip or a chip.

[0011] Further, the detection steps of the detection product include:

[0012] Collect serum;

[0013] Determine the expression level of 20-HETE in the serum by a reagent for detecting 20-HETE;

[0014] The expression level of the serum is compared with that of the control group to determine whether the individual from whom the serum is derived has maternal obesity-related offspring kidney disease.

[0015] On the other hand, the present invention provides a detection system including the marker described above, including a detection device and a comparison device; wherein, the detection device is used to detect the expression level of 20-HETE in the serum; the comparison device is used to compare the expression level of 20-HETE in the serum with the expression level of 20-HETE in the control group to determine whether the individual from whom the serum is derived has maternal obesity-related offspring kidney disease.

[0016] On the other hand, the present invention provides a therapeutic target for maternal obesity-related offspring kidney disease, and the therapeutic target is 20-HETE. The 20-HETE promotes the progression of maternal obesity-related offspring kidney disease by promoting the transformation of macrophages into myofibroblasts.

[0017] On the other hand, the present invention provides an application of the therapeutic target described above in the preparation of drugs for maternal obesity-related offspring kidney disease.

[0018] Furthermore, the drug reduces or eliminates 20-HETE in offspring related to maternal obesity.

[0019] Furthermore, the drug also contains a pharmaceutically acceptable carrier and / or excipient.

[0020] Furthermore, the pharmaceutically acceptable carrier and / or excipient includes at least one of a diluent, a binder, a surfactant, a humectant, an adsorption carrier, a lubricant, a filler, and a disintegrant.

[0021] The present invention explores the mechanism of action of 20-HETE in maternal obesity-related offspring kidney disease, providing a basis for developing treatment methods based on maternal obesity-related offspring kidney disease. By constructing a mouse model of maternal obesity through a high-fat diet, metabolomic studies were conducted on the sera and kidneys of offspring mice of obese mothers and offspring mice of normal mothers, and it was found that the level of 20-HETE in the sera and kidneys of offspring mice of obese mothers was significantly increased. In a mouse model of renal ischemia-reperfusion, 20-HETE led to more severe renal fibrosis characteristics in offspring mice related to maternal obesity by promoting the transformation of macrophages into myofibroblasts. Therefore, 20-HETE can be used as a key biomarker and therapeutic target in the diagnosis, treatment, prognosis assessment, and drug screening of maternal obesity-related offspring kidney disease.

[0022] Beneficial effects

[0023] The present invention deeply explores the molecular mechanism of 20-HETE in regulating the occurrence and development of kidney diseases in offspring related to maternal obesity. Compared with the existing kidney disease diagnosis methods and non-specific drug treatment methods, by exploring specific unsaturated fatty acid metabolites, the present invention discovers new non-invasive diagnostic and prognostic biomarkers, and also provides new targets for treatment. This diagnostic and treatment scheme based on specific metabolites may improve the compliance and treatment effect of patients, and has good application prospects. Brief Description of the Drawings

[0024] The drawings constituting a part of this application are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0025] Figure 1 : (a) Experimental flowchart for constructing a kidney injury model by injecting folic acid (FA) into offspring of mothers on a normal diet (mCD-F1) and offspring of mothers on a high-fat diet (mHFD-F1); (b) Serum urea nitrogen (BUN) and serum cystatin C (CysC) levels in mice of different groups (n = 4); (c) Experimental flowchart for oxidative lipid sequencing of mouse kidneys; (d) Oxidative lipid enrichment analysis of mouse kidneys (n = 4); (e) Arachidonic acid content in kidneys of mice in different groups; (f) 20-HETE content in kidneys of mice in different groups (n = 4); (g) 20-HETE content in sera of mice in different groups (n = 4).

[0026] Figure 2 : (a) Experimental flowchart for constructing a kidney injury model by injecting folic acid (FA) into offspring of mothers on a normal diet (mCD-F1) and simultaneously injecting 20-HETE; (b) mRNA levels of kidney fibrosis-related markers (Acta2, Vimentin, Col3a1, and Fibronectin) in mice of different groups (n = 3); (c) Representative immunofluorescence images of kidney fibrosis markers (ACTA2, Vimentin, and Fibronectin) in mice of different groups (scale bar 50 μm).

[0027] Figure 3: (a) Schematic diagram of the experimental procedure for constructing a kidney injury model by injecting folic acid (FA) into the offspring of mothers on a normal diet (mCD-F1) and the offspring of mothers on a high-fat diet (mHFD-F1), and simultaneously injecting the 20-HETE inhibitor HET0016; (b) mRNA levels of kidney fibrosis-related markers (Acta2, Vimentin, Col3a1, and Fibronectin) in mice of different groups (n = 3); (c) Representative images and quantitative analysis of hematoxylin-eosin staining (H&E) (scale bar: 50 μm) and Sirius Red staining (scale bar: 50 μm) of the kidneys of mice in different groups.

[0028] Figure 4 : (a) Representative images and quantitative statistics of immunofluorescence co-localization of CD68 and ACTA2 double-positive cells in the kidneys of mice in different groups (scale bar: 50 μm); (b) Schematic diagram of the experimental procedure for isolating bone marrow-derived macrophages (BMDMs) from the offspring of mothers on a normal diet (mCD-F1) and the offspring of mothers on a high-fat diet (mHFD-F1) and inducing the transformation of macrophages into myofibroblasts; (c) mRNA levels of fibrosis markers (Vimentin, Col3a1, and Fibronectin) in BMDM cells of mice in different groups after the transformation of macrophages into myofibroblasts (n = 4); (d) Schematic diagram of the experimental procedure for isolating BMDM cells from wild-type (WT) mice and inducing the transformation of macrophages into myofibroblasts in the presence of 20-HETE; (e) mRNA levels of fibrosis markers (Acta2, Vimentin, and Col3a1) in BMDM cells of mice in different groups after the transformation of macrophages into myofibroblasts. Detailed implementation manners

[0029] It should be noted that, without conflict, the embodiments in the present application and the features in the embodiments may be combined with each other. The present invention will be described in detail below with reference to the accompanying drawings and embodiments.

[0030] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0031] It should be noted that the terms "first", "second", etc. in the description, claims and above-mentioned drawings of the present invention are used to distinguish similar objects, and do not necessarily have to be used to describe a specific order or sequence. It should be understood that the data used in this way can be interchanged under appropriate circumstances, so that the embodiments of the present invention described here can be implemented in an order other than those illustrated or described here. In addition, the terms "comprising" and "having" and any variations thereof are intended to cover non-exclusive inclusion.

[0032] Example 1

[0033] Eight-week-old C57BL / 6 mice were selected, and obese mice were constructed using a high-fat diet, and then mated with male mice on a normal diet to obtain offspring mice with obese mothers. Serum and kidney tissues were obtained from the offspring of normal-diet mothers and the offspring of high-fat-diet mothers, and oxidative lipid sequencing of kidney tissues was performed to detect the content of 20-HETE in serum and kidney tissues.

[0034] Offspring mice of normal-diet mothers at 8 weeks of age were selected, and a kidney injury model was constructed by injecting folic acid, and 20-HETE was introduced into them:

[0035] (1) The expression levels of genes related to kidney fibrosis in mice (Acta2, Vimentin, and Fibronectin) at the protein level were measured to explore the effects of 20-HETE on kidney injury and kidney fibrosis;

[0036] (2) Mouse kidney tissues were collected and sectioned, and the expression levels of genes related to kidney fibrosis in mice (Acta2, Vimentin, Col3a1, and Fibronectin) at the mRNA level were measured using immunofluorescence staining to evaluate the effects of 20-HETE on the structure and fibrosis of mouse kidneys.

[0037] Offspring mice of normal-diet mothers and offspring of high-fat-diet mothers at 8 weeks of age were selected, and a kidney injury model was constructed by injecting folic acid, and the 20-HETE inhibitor HET0016 was introduced into them:

[0038] (1) Mouse kidney tissues were collected and sectioned, and hematoxylin-eosin staining and Sirius red staining were used to evaluate the effects of the 20-HETE inhibitor HET0016 on the structure and fibrosis of mouse kidneys;

[0039] (2) The expression levels of genes related to fibrosis in mouse kidneys (Acta2, Vimentin, Col3a1, and Fibronectin) at the mRNA level were measured to explore the effects of the 20-HETE inhibitor HET0016 on kidney injury and kidney fibrosis;

[0040] (3)Measure the protein expression levels of related genes (CD68 and ACTA2) of myofibroblasts in the kidneys of mice, and explore the effect of maternal obesity on the transformation of macrophages into myofibroblasts in offspring mice.

[0041] Isolate BMDM cells from the offspring of mothers on a normal diet and the offspring of mothers on a high-fat diet, and induce the transformation of macrophages into myofibroblasts. Further verify the mechanism of action of 20-HETE in in vitro experiments. It is found that 20-HETE promotes the transformation of macrophages into myofibroblasts, leading to collagen accumulation in the kidneys, thereby promoting the development of kidney fibrosis.

[0042] To make the present invention more concise and easy to understand, the research methods are described in detail with the accompanying drawings as follows:

[0043] 1. Materials and Methods

[0044] 1.1 Construction of Animal Models

[0045] Select 8-week-old female C57BL / 6J mice. Randomly divide the mice into 2 groups: The control group (n = 6) of mice is fed a standard diet, and the high-fat diet group (n = 6) of mice is fed a high-fat diet. After 12 weeks of feeding, they are mated with male mice on a normal diet to obtain offspring mice. Randomly divide the 8-week-old offspring mice of the control group into 3 groups: (1) Control group (n = 3): The mice are injected with a control solvent; Kidney injury group (n = 3): The mice are injected with a folic acid solution; Kidney injury + 20-HETE group (n = 3): The mice are injected with a folic acid and 20-HETE solution. Record the offspring mice of the control group and the offspring mice of the mothers on a high-fat diet, and randomly divide them into 6 groups: (1) Offspring group of mothers on a normal diet (n = 3): The offspring mice of mothers on a normal diet are injected with a control solvent; (2) Offspring group of mothers on a high-fat diet (n = 3): The offspring mice of mothers on a high-fat diet are injected with a control solvent; (3) Kidney injury group of offspring of mothers on a normal diet (n = 3): The offspring mice of mothers on a normal diet are injected with a folic acid solution; (4) Kidney injury group of offspring of mothers on a high-fat diet (n = 3): The offspring mice of mothers on a high-fat diet are injected with a folic acid solution; (5) Kidney injury and 20-HETE inhibition group of offspring of mothers on a normal diet (n = 3): The offspring mice of mothers on a normal diet are injected with a folic acid and HET0016 solution; (6) Kidney injury group of offspring of mothers on a high-fat diet (n = 3): The offspring mice of mothers on a high-fat diet are injected with a folic acid and HET0016 solution. Seven days after injecting folic acid, all mice are euthanized, and blood and liver tissues are collected for analysis.

[0046] The mice were placed in a specific pathogen-free (SPF) environment (temperature 22-26 °C, humidity 65%, light-dark cycle 12 hours). The animal experiments were approved by the Experimental Animal Welfare and Ethics Committee of East China Normal University.

[0047] 1.2 Serum and kidney 20-HETE detection

[0048] The blood samples obtained from the mice were left standing at room temperature for 30 minutes and then centrifuged at 6000 rpm for 15 min to obtain serum. After extracting the lipid metabolites in the serum with ethyl acetate, the content of 20-HETE was detected by LC-MS / MS. The content of 20-HETE in the kidneys of mice was determined using a commercially available 20-HETE ELISA detection kit (Abcam).

[0049] 1.3 Biochemical analysis

[0050] The content of blood urea nitrogen in the serum of mice was detected using an automatic biochemical analyzer. The content of cystatin C in the serum of mice was detected using an ELISA kit.

[0051] 1.4 Histological analysis

[0052] The kidneys of mice were fixed with formalin solution, embedded in paraffin, sectioned, and stained with hematoxylin and eosin (H&E) and Sirius red to evaluate the structural changes and fibrosis degree of the kidneys.

[0053] 1.5 Real-time quantitative PCR

[0054] Total RNA was extracted from the kidney tissues of mice using Trizol (Takara) reagent. RNA was transcribed into cDNA using the reverse transcription kit HiScript III RT SuperMix (Nanjing Novizan Biotech Co., Ltd.). Real-time quantitative PCR analysis was performed on a LightCycler® 480 II (Roche) device using the QPCR reagent ChamQ Universal SYBR qPCR Master Mix (Nanjing Novizan Biotech Co., Ltd.). The primer sequences used are summarized in Table 1. Beta-actin was used as an internal reference gene.

[0055] Table 1 Quantitative PCR primer sequences

[0056] Species Gene Forward primer (5’-3’) Reverse primer (5’-3’) Mouse Acta2 GTGAAGAGGAAGACAGCACAG GCCCATTCCAACCATTACTCC Mouse Vimentin GGAGGCCACGAACTTCACTCT GGGATGCAACACCTATTGTCAGT Mouse Col3a1 ACAGCTGGTGAACCTGGAAG ACCAGGAGATCCATCTCGAC Mouse Fibronectin ACAAGGTTCGGGAAGAGGTT CCGTGTAAGGGTCAAAGCAT

[0057] 1.6 Immunofluorescence analysis

[0058] After dewaxing the mouse paraffin sections with xylene and rehydrating them with gradient ethanol, antigen retrieval was performed using a citric acid solution. The sections were incubated overnight at 4°C with CD68 (28058-1-AP, proteintech) and ACTA2 (A5228, sigma) antibodies. The next day, after incubating with the secondary antibody corresponding to the primary antibody at room temperature for 1 hour, photographs were taken using a fluorescence microscope.

[0059] 1.7 Metabolomics analysis

[0060] Weigh 25 mg of the sample, add 600 μL of extraction solution (0.5 M ammonium acetate, pH 5.5, pre-cooled at 4°C, containing an isotope-labeled internal standard mixture and BHT), and vortex for 30 s; homogenize in a homogenizer (35 Hz, 240 s), then transfer to an ice-water bath and sonicate for 5 min; repeat the homogenization and sonication steps 2 times; add 750 μL of extraction reagent (n-hexane / ethyl acetate = 2 / 3) to the sample, shake for 5 min, centrifuge at 4°C, 3500 rpm for 5 min, and take the upper clear liquid; dry with nitrogen, add 100 μL of 30% acetonitrile for reconstitution; centrifuge at 4°C, 12000 rpm for 15 min, and take the supernatant for UHPLC-MS-MS analysis.

[0061] 1.8 Isolation, culture and treatment of mouse BMDM cells

[0062] Take 6-8-week-old mice. After euthanasia, take their bilateral femurs and tibias and remove the excess muscle on the bones. Immerse them in 75% alcohol and then transfer to PBS. Blow out the bone marrow from the femurs and tibias with 5 ml of PBS. After centrifuging at 1500 rpm, 4°C for 5 min, resuspend the cells in 10 ml of BMDM medium containing M-csf (20 ng / ml) and place them in an incubator for induction for 7 days. After the induction is completed, continue to induce with a medium containing IL4 (20 ng / ml) and IL13 (20 ng / ml) for 48 hours. Finally, induce with a medium containing TGFβ (5 ng / ml) and 20-HETE (1 μM) for 5 days.

[0063] 1.9 Statistical analysis

[0064] Statistical analysis was performed using GraphPad Prism version 9.0 (GraphPad Software, San Diego, CA). All data are expressed as Mean±SEM (except as otherwise stated). For statistical comparison, Student's t-test or one-way ANOVA was used. P < 0.05 was considered statistically significant.

[0065] 2. Results

[0066] 2.1Figure 1 b shows that the levels of serum urea nitrogen and serum cystatin C in the mHFD-F1 group of mice were significantly increased, indicating more severe kidney damage in the mHFD-F1 group of mice. Figure 1 d shows that compared with the mCD-F1 group, the differential metabolites in the mHFD-F1 group were enriched in the arachidonic acid metabolism pathway. Figure 1 e shows that the arachidonic acid content in the mHFD-F1 group was lower. Figure 1 f shows that the 20-HETE content in the kidneys of the mHFD-F1 group was higher. Figure 1 g shows that the 20-HETE content in the serum of the mHFD-F1 group was higher. Therefore, compared with the offspring mice of normal mothers, the kidneys and serum of the offspring mice of obese mothers had higher 20-HETE levels.

[0067] 2.2 Figure 2 b shows that the expression levels of renal fibrosis markers in the mCD-F1 group of mice co-injected with folic acid and 20-HETE (mCD-F1+FA+20-HETE) were higher, indicating that 20-HETE enhanced the degree of renal fibrosis. Figure 2 c shows that the protein levels of renal fibrosis markers in the mCD-F1 group of mice co-injected with folic acid and 20-HETE (mCD-F1+FA+20-HETE) were higher, indicating that 20-HETE enhanced the degree of renal fibrosis. Therefore, 20-HETE aggravated renal fibrosis in the offspring mice of normal mothers: compared with the control group and the folic acid group, the expression levels of genes related to renal fibrosis in the folic acid plus 20-HETE group of mice were higher.

[0068] 2.3 Figure 3 b shows that compared with the mHFD-F1 group of mice injected only with folic acid (mHFD-F1+FA), the expression levels of renal fibrosis markers in the mHFD-F1 group of mice co-injected with folic acid and HET0016 (mHFD-F1+FA+HET0016) decreased, indicating that renal fibrosis was alleviated after inhibiting 20-HETE with HET0016. Figure 3 c shows that compared with the mHFD-F1 group of mice injected only with folic acid, the degree of renal fibrosis in the mHFD-F1 group of mice co-injected with folic acid and HET0016 decreased. Therefore, 20-HETE aggravated renal fibrosis in the offspring mice of obese mothers: compared with the offspring mice of obese mothers injected only with folic acid, the expression levels of genes related to renal fibrosis in the offspring mice of obese mothers co-injected with folic acid and 20-HETE inhibitor decreased, and collagen accumulation decreased.

[0069] 2.4 Figure 4 a shows that the mHFD-F1 group of mice had more CD68 and ACTA2 double-positive cells. Figure 4c showed that the expression levels of fibrotic markers in macrophages of the mHFD-F1 group were higher, indicating that macrophages in the mHFD-F1 group were more likely to transform into myofibroblasts. Figure 4 e showed that compared with the TGFβ treatment group, the expression levels of fibrotic markers in macrophages treated with 20-HETE were higher, indicating that macrophages were more likely to transform into myofibroblasts under 20-HETE stimulation. Therefore, 20-HETE could promote the transformation of macrophages into myofibroblasts in vitro.

[0070] 3. Conclusion

[0071] 20-HETE is a key metabolite that promotes the progression of kidney diseases related to offspring of obese mothers. 20-HETE is highly expressed in the serum and kidneys of offspring mice of obese mothers. On the one hand, 20-HETE can exacerbate the degree of renal fibrosis in offspring mice of normal mothers; on the other hand, inhibiting 20-HETE can relieve kidney injury and the process of renal fibrosis in offspring mice of obese mothers. 20-HETE mainly acts on macrophages to promote their transformation into myofibroblasts, exacerbating renal fibrosis in offspring mice of obese mothers.

[0072] The preferred specific embodiments of the present invention have been described in detail above. It should be understood that those of ordinary skill in the art can make many modifications and variations based on the concept of the present invention without creative work. Therefore, all technical solutions that can be obtained by those skilled in the art in the technical field according to the concept of the present invention through logical analysis, reasoning, or limited experiments on the basis of the prior art should be within the protection scope determined by the claims.

Claims

1. A maternal obesity-related offspring kidney disease marker, characterized in that, The biomarker is 20-HETE.

2. A detection product comprising the biomarker as described in claim 1.

3. The detection product according to claim 2, wherein, The detection product includes a kit, a test strip or a chip.

4. The detection product according to claim 2, wherein The detection steps of the detection product include: Collecting serum; Determining the expression level of 20-HETE in the serum by a reagent for detecting 20-HETE; Comparing the expression level of the serum with that of a control group to determine whether the individual from whom the serum is derived has maternal obesity-related offspring kidney disease.

5. A detection system comprising the marker as described in claim 1, characterized in that, It includes a detection device and a comparison device; wherein, the detection device is used for detecting the expression level of 20-HETE in the serum; the comparison device is used for comparing the expression level of 20-HETE in the serum with the expression level of 20-HETE in the control group to determine whether the individual from whom the serum is derived has maternal obesity-related offspring kidney disease.

6. A treatment target for kidney diseases in offspring related to maternal obesity, characterized in that, The therapeutic target is 20-HETE.

7. Use of the therapeutic target as described in claim 6 in the preparation of a drug for maternal obesity-related offspring kidney disease.

8. The application according to claim 7, wherein The drug reduces or eliminates 20-HETE in maternal obesity-related offspring.

9. The application according to claim 7, characterized in that: The drug also contains a pharmaceutically acceptable carrier and / or excipient.

10. The application according to claim 7, wherein: The pharmaceutically acceptable carrier and / or excipient includes at least one of a diluent, a binder, a surfactant, a wetting agent, an adsorption carrier, a lubricant, a filler, and a disintegrant.

Images