Fluorescent hybridization chain reaction biosensor based on granzyme B existence condition and application thereof

Abstract

The invention discloses a fluorescent hybridization chain reaction biosensor based on the existence condition of granzyme B and application of the fluorescent hybridization chain reaction biosensor. The fluorescent hybridization chain reaction biosensor based on the existence condition of active granzyme B is established, and real-time detection of T cell effector molecules is achieved. The method has the characteristics of short amplification time, simplicity in operation, high amplification efficiency, simple reaction system and high economic benefit. Peptide nucleic acid is introduced into a hybridization chain reaction system, cutting of granzyme B on a substrate is successfully used as a starting recognition event of the hybridization chain reaction, after the granzyme B cuts the peptide substrate in the peptide nucleic acid, a standing point is exposed, and a chain displacement reaction is mediated, so that a fluorescence signal is recovered after amplification; the invention provides a new strategy for detecting the active cytokines by using the hybridization chain reaction. According to the strategy, the hybridization chain reaction with fluorescence as a signal output mode can be used for active protein detection, the reaction system is simple, the operation steps are few, and the detection cost is low.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technologies, and particularly relates to a fluorescence hybridization chain reaction biosensor based on the presence of granzyme B and its applications. Background Art

[0002] There are various nucleic acid amplification methods. Classified by enzyme requirements, they can be divided into enzyme-free amplification and enzyme-based amplification; classified by heating methods, they can be divided into thermal cycling amplification and isothermal amplification. Isothermal enzyme-free amplification technology can achieve faster and more efficient amplification without using a thermal cycler. Among them, hybridization chain reaction belongs to a kind of isothermal enzyme-free amplification technology, which has the advantages of being enzyme-free, isothermal process, high sensitivity, and easy programming. Currently, it has become a powerful molecular diagnostic tool and is widely used in the field of biological detection. At the same time, optical detection analysis methods provide effective tools for the qualitative / quantitative analysis of analytes. The generation and output of fluorescence signals are widely used, which can not only be used for the sensitive detection of analytes in vitro, but also be applied to the detection of analytes in vivo and biological imaging.

[0003] There are various detection methods based on hybridization chain reaction, but most of the detection targets of hybridization chain reaction are specific nucleic acid sequences or specific membrane proteins. For example, the patent application with the publication number CN111175506A discloses a sensor based on hybridization chain reaction and ribozyme and a carcinoembryonic antigen detection method. The sensor based on hybridization chain reaction and ribozyme includes an aptamer probe and a hairpin probe. The aptamer probe includes an aptamer sequence, a primer strand sequence, and a complementary sequence. The hairpin probe includes a first hairpin probe and a second hairpin probe. The first hairpin probe and the second hairpin probe include G-quadruplex ribozyme base sequences. The aptamer probe specifically recognizes carcinoembryonic antigen, and the conformation of the aptamer probe is converted, so that the first hairpin probe and the second hairpin probe form double-stranded DNA. At the same time, in the presence of hemin, the first hairpin probe and the second hairpin probe self-assemble to form hemin / G-quadruplex ribozyme, and the hemin / G-quadruplex ribozyme catalyzes the oxidation of thiamine mediated by hydrogen peroxide and emits fluorescence, which can quantitatively detect the carcinoembryonic antigen. The patent application with the publication number CN119410753A discloses a fluorescence aptamer sensor based on hybridization chain reaction and its applications. The fluorescence aptamer sensor includes an aptamer probe, a complementary strand probe, and a hairpin probe. The hairpin probe includes a first hairpin probe and a second hairpin probe. The present invention utilizes the high specificity of aptamers and the signal amplification of hybridization chain reaction to improve the selectivity and sensitivity of AFM1 detection, and has the advantages of isothermal amplification, strong specificity, high sensitivity, and low cost, and can achieve simple, rapid, highly sensitive, and highly specific detection of AFM1.

[0004] However, few people have applied the hybridization chain reaction to the detection of cytokine release levels. Granzyme B, as an effector molecule released after the activation of tumor-specific T cells, plays a crucial role in the killing of tumor cells mediated by tumor-specific T cells. Therefore, it is necessary to develop a fluorescence hybridization chain reaction system that can detect the release level of granzyme B in real time to sensitively detect the effector molecules of tumor-specific T cells in a simpler, lower-cost, and faster manner. Summary of the Invention

[0005] The object of the present invention is to develop a fluorescence hybridization chain reaction system that can detect the release level of granzyme B.

[0006] To achieve the object of the present invention, the ordinary hybridization chain reaction is redesigned and modified. Several T bases are added as a spacer sequence at the 5' end of the trigger sequence, and cholesterol modification is introduced at the 5' end. A peptide nucleic acid complementary pairing part is added to the 3' end of hairpin sequence 1 for complementary pairing with the peptide nucleic acid sequence. At the same time, a fluorescent group and a quenching group are modified inside hairpin sequence 1. When the hairpin sequence is in the hairpin state, the fluorescence of the fluorescent group is quenched; once there is a certain level of active granzyme B in the fluorescence hybridization chain reaction environment, the presence of granzyme B can cleave the granzyme B substrate modified on the peptide nucleic acid sequence, and the complementary small peptide nucleic acid fragment spontaneously drops off, exposing the foothold sequence again. The hybridization chain reaction is triggered by the trigger sequence to form a long double-stranded product, and the fluorescence of the fluorescent group is restored, ultimately achieving real-time detection of the release level of granzyme B.

[0007] On the one hand, the present invention provides a fluorescence hybridization chain reaction based on the presence of granzyme B, which only includes a fluorescence hybridization chain reaction system.

[0008] The fluorescence hybridization chain reaction system includes a trigger sequence, a peptide nucleic acid sequence, and two hairpin sequences (hairpin sequence 1 and hairpin sequence 2).

[0009] A T base spacer sequence is added to the 5' end of the trigger sequence and a cell membrane surface modification for embedding on the cell membrane surface is introduced;

[0010] Preferably, the T base spacer sequence added to the 5' end of the trigger sequence is 10-20 T bases. Most preferably, 15 T bases are added to the 5' end;

[0011] The cell surface modification techniques include lipid modification, protein modification, electrostatic interaction modification, hydrophobic interaction modification, chemical coupling modification, or biotin-avidin system modification. In the embodiments of the present invention, cholesterol modification is taken as an example;

[0012] The peptide nucleic acid sequence contains a granzyme B substrate fragment;

[0013] The hairpin sequence 1 is modified with a fluorescent group near its 5'-end chain j and a quenching group on the basis of the T base near the 5'-end. The hairpin end is an OMe-modified base pair.

[0014] The hairpin sequence 2 has an OMe-modified base pair at the hairpin end.

[0015] The fluorescent group is a molecule that can generate a strong fluorescent signal under the excitation of excitation light.

[0016] Preferably, the fluorescent group is a substance that can emit fluorescence under the excitation of an excitation wavelength of 620 nm.

[0017] Preferably, the fluorescent group is a Cy5 fluorescent group.

[0018] The quenching group can quench the fluorescence of the fluorescent group in the hairpin structure.

[0019] Preferably, the quenching group is a BHQ2 quenching group.

[0020] The OMe modification can enhance the nuclease tolerance of the nucleic acid sequence.

[0021] The granzyme B substrate contained in the peptide nucleic acid sequence can be cleaved by granzyme B.

[0022] After the hairpin sequence 1 is cleaved by granzyme B to expose the foothold, the trigger sequence can initiate the hybridization chain reaction of the two hairpins through the foothold-mediated strand displacement reaction.

[0023] On the other hand, the present invention provides the reaction conditions for the above fluorescent hybridization chain reaction:

[0024] The concentration of the trigger sequence is 50-100 nM; preferably, it is 80 nM.

[0025] The concentration of the hairpin sequence 1-peptide nucleic acid assembly is 100-200 nM; preferably, it is 150 nM.

[0026] The concentration of the hairpin sequence 2 is 50-150 nM; preferably, it is 100 nM.

[0027] The complementary pairing of the hairpin sequence 1 and the peptide nucleic acid sequence is achieved through the following steps:

[0028] Mix the hairpin sequence 1 and the peptide nucleic acid sequence at an equivalent ratio of 1:1.2-2.4, and incubate in the dark at 30-45 °C for 15-30 min; specifically, the reaction process includes incubating in the dark at 42 °C for 15 min, and then leaving it overnight at 4 °C for standby.

[0029] Fluorescent hybridization chain reaction process; incubate at 25 - 37°C in the dark for 2 - 5 h; specifically, the reaction process includes; incubate at 37°C in the dark for 4 h.

[0030] On the other hand, the present invention provides the reaction sequence of the above fluorescent hybridization chain reaction:

[0031] Trigger sequence:

[0032] 5’-cholesterol-TTTTTTTTTTTTTTTACAACAGCCTCAAGATCATC-3’

[0033] (SEQ ID NO.1);

[0034] Peptide nucleic acid sequence: 5’-GCCGCCGCCTT-KIEPDK-ACAACA-3’ (SEQ ID NO.2);

[0035] Hairpin sequence 1:

[0036] 5’-OMeG / OMeC / OMeC / TCAAG / Cy5 / ATCATCGTGCTGGATGA / BHQ2 / TCTTGAGGCTGTTGTGCAAGGCGGC / OMeG / OMeG / OMeC / -3’ (SEQ ID NO.3);

[0037] Hairpin sequence 2:

[0038] 5’-OMeC / OMeA / OMeG / CACGATGATCTTGAGGCACAACAGCCTCAAGAT / OMeC / 0MeA / T / OMeC / -3’ (SEQ ID NO.4);

[0039] Among them, Cy5 is a fluorescent group modified inside the nucleic acid sequence, and BHQ2 is a quenching group modified on the T base. Specifically, for the sequence shown in SEQ ID NO.3, a fluorescent group is modified on the 8 - 12th base sequence strand near the 5’ end, and a quenching group is modified at the 25 - 30th T base position near the 5’ end.

[0040] On the other hand, the present invention also provides a fluorescent hybridization chain reaction biosensor based on the presence of granzyme B.

[0041] It includes a fluorescent hybridization chain reaction system;

[0042] The fluorescent hybridization chain reaction system includes a trigger sequence and two hairpin sequences;

[0043] Preferably, the hairpin sequence 1 needs to be complementary paired with the peptide nucleic acid sequence at an equivalent ratio of 1:1.2 to 2.4 before detection; preferably, it is complementary paired at an equivalent ratio of 1:2.4.

[0044] Preferably, a fluorescent group is labeled on strand j near the 5'-end of the hairpin sequence 1; preferably, the fluorescent group is labeled between the 8th and 9th bases.

[0045] Preferably, a quenching group is labeled on the T base near the 5'-end of the hairpin sequence 1; preferably, the quenching group is labeled on the 26th T base.

[0046] Preferably, the end of the hairpin sequence 1 is an OMe-modified base pair; preferably, the end of the hairpin sequence 2 is an OMe-modified base pair.

[0047] Preferably, the granzyme B peptide substrate in the peptide nucleic acid sequence can be cleaved by granzyme B; preferably, the granzyme B tetrapeptide substrate is IEPD.

[0048] Preferably, the trigger sequence can initiate the hybridization chain reaction between the two hairpin sequences through a toehold-mediated strand displacement reaction after the hairpin sequence - peptide nucleic acid assembly is cleaved by granzyme B.

[0049] More preferably, the trigger sequence is as shown in SEQ ID NO.1; preferably, the peptide nucleic acid sequence is as shown in SEQ ID NO.2; preferably, the hairpin sequence 1 is as shown in SEQ ID NO.3; preferably, the hairpin sequence 2 is as shown in SEQ ID NO.4.

[0050] The analysis principle of this biosensor: Design a peptide nucleic acid sequence that is complementary paired with the toehold part of the hairpin sequence 1, and the peptide nucleic acid sequence is modified with a granzyme B substrate sequence. The peptide nucleic acid sequence is pre-complementary paired with the hairpin sequence 1 to shield the toehold part of the hairpin sequence 1. At the same time, a fluorescent group and a quenching group are respectively modified on strand j and the T base near the 5'-end of the hairpin sequence 1. When the sequence forms a hairpin structure, the fluorescence is quenched. The 5'-end of the trigger sequence is modified with a cholesterol molecule to facilitate the embedding of the trigger sequence on the cell membrane surface; when active granzyme B appears in the system and reaches a certain level, active granzyme B cleaves the peptide substrate fragment on the peptide nucleic acid - hairpin sequence 1. After cleavage, some peptide nucleic acid fragments freely fall off at 37°C, exposing the toehold sequence; subsequently, the trigger sequence initiates a fluorescent hybridization chain reaction through a toehold-mediated strand displacement reaction to form a long double-stranded product. At this time, the fluorescence signal is no longer quenched, and the fluorescence signal is significantly enhanced.

[0051] The specific reaction method is as follows:

[0052] The hairpin sequence 1 with a concentration of 10 μM was mixed with the peptide nucleic acid sequence with a concentration of 100 μM at an equivalent ratio of 1:2.4 in a hybridization buffer, incubated in the dark at 42 °C for 15 min, and then incubated overnight at 4 °C for standby.

[0053] The formula of the hybridization buffer is as follows: 25 mM HEPES, 120 mM NaCl, 5 mM MgCl2, pH 7.4.

[0054] The trigger sequence with a concentration of 80 nM was co-incubated with the hairpin sequence 1 with a concentration of 150 nM and the hairpin sequence 2 with a concentration of 100 nM in the medium after T cell activation, and incubated in the dark at 37 °C for 4 h.

[0055] The present invention also provides the application of the described biosensor in detecting the level of granzyme B released after T cell activation, wherein the T cells are activated by the CD3×NYESO-1 bispecific antibody.

[0056] The present invention also provides the application of the described biosensor in detecting the level of granzyme B released when the bispecific antibody kills tumor cells, wherein the ratio of effector cells to target cells is 2:1, the killing time is 36 hours, and the fluorescence signal reflects the release level of granzyme B.

[0057] The present invention also provides a method for detecting granzyme B not for the purpose of disease diagnosis or treatment, using the described fluorescence hybridization chain reaction system, including the following steps:

[0058] Pre-assemble the hairpin sequence 1 and the peptide nucleic acid sequence;

[0059] Add the sample to be tested and incubate to trigger the hybridization chain reaction;

[0060] Quantify the concentration of granzyme B through the change in fluorescence intensity.

[0061] The sample to be tested is the medium after T cell activation or the cell culture solution in the tumor killing model mediated by the bispecific antibody;

[0062] The detection wavelength of the fluorescence signal is excited at 620 nm and the emission wavelength is 670 nm.

[0063] By means of the above technical solutions, the present invention has at least the following advantages and beneficial effects:

[0064] The present invention realizes the real-time detection of T cell effector molecules by establishing a fluorescence hybridization chain reaction biosensor based on the presence of active granzyme B; it has the characteristics of short amplification time, simple operation, high amplification efficiency, simple reaction system and high economic benefit. By introducing peptide nucleic acid into the hybridization chain reaction system, the cleavage of the substrate by granzyme B is successfully used as the starting recognition event for the hybridization chain reaction. After granzyme B cleaves the peptide substrate in the peptide nucleic acid, a foothold is exposed, mediating strand displacement reaction, so that after amplification, the fluorescence signal is restored, providing a new strategy for using the hybridization chain reaction to detect active cytokines. This strategy enables the hybridization chain reaction with fluorescence as the signal output mode to be used for the detection of active proteins, with a simple reaction system, few operation steps and low detection cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] Figure 1 It is the principle of the fluorescence hybridization chain reaction based on the presence of granzyme B.

[0066] Figure 2 It is the feasibility of the fluorescence hybridization chain reaction based on the presence of granzyme B; among them, A is the 10% nucleic acid Native page electrophoresis result map after sequence amplification and the 10% nucleic acid Native page electrophoresis result map after introducing the peptide nucleic acid sequence for blocking; B is the characterization map of the fluorescence intensity change after sequence amplification and introducing the peptide nucleic acid; among them, P-H1 represents peptide nucleic acid-hairpin sequence 1.

[0067] Figure 3 It is the flow cytometry result map of the embedding of the cholesterol-modified trigger sequence on CD3 + T cells.

[0068] Figure 4 It is CD3 + Feasibility verification of the fluorescence hybridization chain reaction on the CD3

[0069] Figure 5 It is the flow cytometry result of granzyme B on activated CD3 + T cells and the comparison chart with the detection result of the flow cytometry antibody method.

[0070] Figure 6 It is the flow cytometry result of the detection of granzyme B released when the fluorescence hybridization chain reaction is used for bispecific antibody-mediated T cell killing of tumor cells and the comparison chart with the detection result of the flow cytometry antibody method.

[0071] Figure 7 It is the specific verification result map of the fluorescence hybridization chain reaction. DETAILED DESCRIPTION OF THE INVENTION

[0072] The following examples are used to illustrate the present invention, but not to limit the scope of its use. Unless otherwise specified, the technical means used in the examples are conventional means well-known to those skilled in the art, and the raw materials used are all commercially available products.

[0073] In the present invention, the complementary pairing buffer formulation is: 25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), 120 mM sodium chloride (NaCl), 5 mM magnesium chloride (MgCl2), pH 7.4; the amplification buffer is: RPMI-1640 medium (without phenol red), 1% fetal bovine serum, 1% penicillin-streptomycin mixed solution.

[0074] Example 1 Establishment of a fluorescence hybridization chain reaction biosensor for detecting the release level of granzyme B

[0075] 1. Experimental materials

[0076] 25 mM HEPES, 120 mM NaCl, 5 mM MgCl2, hydrochloric acid (HCl), RPMI-1640 medium (without phenol red), fetal bovine serum, penicillin-streptomycin mixed solution, CD3×NYESO-1 bispecific antibody, etc.

[0077] The nucleic acid sequences used in the experiment are shown in Table 1.

[0078] Table 1

[0079]

[0080] Note: Cy5 is a labeled fluorescent group, and BHQ2 is a labeled quenching group.

[0081] 2. Design principle of fluorescence hybridization chain reaction

[0082] Design a peptide nucleic acid sequence that is partially complementary to the toehold of the hairpin sequence 1, and the peptide nucleic acid sequence is modified with a granzyme B substrate sequence. Pre-complementary pair the peptide nucleic acid sequence with the hairpin sequence 1 (hairpinl) to mask the toehold of the hairpin sequence 1. At the same time, a fluorescent group and a quenching group are respectively modified on the j and T bases of the strand near the 5'-end of the hairpin sequence 1. When the hairpin sequence 1 forms a hairpin structure, the fluorescence is in a quenched state. A cholesterol molecule is modified at the 5'-end of the trigger sequence to facilitate the embedding of the trigger sequence on the cell membrane surface; when active granzyme B appears in the system and reaches a certain level, active granzyme B cleaves the peptide substrate fragment on the peptide nucleic acid-hairpin sequence 1 (P-H1). After cleavage, a small part of the fragment in the peptide nucleic acid freely detaches at 37°C, exposing the toehold sequence; subsequently, the trigger sequence that has been embedded on the cell membrane surface initiates a fluorescence hybridization chain reaction through toehold-mediated strand displacement reaction to form a long double-stranded product. At this time, the fluorescence signal is no longer quenched and the fluorescence signal is significantly enhanced( Figure 1 ).

[0083] 3. Feasibility verification of fluorescence hybridization chain reaction (nucleic acid Native page)

[0084] First, dissolve the trigger sequence, hairpin sequence 1, and hairpin sequence 2 (hairpin2) in 1×HBS buffer to form a 10 μM solution, and dissolve the peptide nucleic acid in 1×HBS buffer to form a 100 μM solution. Take appropriate amounts of the trigger sequence, hairpin sequence 1, hairpin sequence 2, and peptide nucleic acid sequence and heat them at 95°C for 5 min, then quickly cool to 4°C and incubate at this temperature for 1 h; Mix 10 μM hairpin sequence 1 with 100 μM peptide nucleic acid sequence in a ratio of 1:2.4 equivalents, heat at 42°C for 15 min, and then incubate at 4°C overnight.

[0085] For the hybridization chain reaction without using peptide nucleic acid to block the toehold sequence, the groups are hairpin sequence 1 (1 μM), hairpin sequence 2 (1 μM), hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM), trigger sequence (100 nM) + hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM), trigger sequence (200 nM) + hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM), trigger sequence (500 nM) + hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM), trigger sequence (1 μM) + hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM);

[0086] For the hybridization chain reaction using peptide nucleic acid to block the foothold sequence, the reaction groups were hairpin sequence 1 (1 μM), hairpin sequence 2 (1 μM), peptide nucleic acid-hairpin sequence 1 (1 μM), peptide nucleic acid-hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM), trigger sequence (100 nM) + peptide nucleic acid-hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM), trigger sequence (500 nM) + peptide nucleic acid-hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM), trigger sequence (1 μM) + peptide nucleic acid-hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM), trigger sequence (1 μM) + hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM);

[0087] The above reaction groups were incubated at 37 °C for 4 h. After the reaction ended, 1 μM of the reaction solution was taken for nucleic acid Native page verification ( Figure 2 A). As shown in Figure 2 A, in the absence of the trigger sequence, the hybridization chain reaction amplification of hairpin sequence 1 + hairpin sequence 2 did not occur. In the presence of the trigger sequence, as the concentration of the trigger sequence increased, the bands of hairpin sequence 1 + hairpin sequence 2 gradually faded, and the hybridization chain reaction products of longer double-stranded fragments with larger molecular weights began to appear. After using the peptide nucleic acid sequence to block the foothold part of hairpin sequence 1, the hybridization chain reaction was significantly weakened ( Figure 2 A).

[0088] Note: The sequences used in nucleic acid Native page do not contain fluorescence group and quenching group modifications, nor cholesterol modifications.

[0089] 4. Feasibility verification of fluorescence hybridization chain reaction (fluorescence characterization)

[0090] First, dissolve the trigger sequence, hairpin sequence 1, and hairpin sequence 2 in 1×HBS buffer to a 10 μM solution, and dissolve the peptide nucleic acid in 1×HBS buffer to a 100 μM solution. Take appropriate amounts of the trigger sequence, hairpin sequence 1, hairpin sequence 2, and peptide nucleic acid sequence, heat them at 95 °C for 5 min, quickly cool to 4 °C, and incubate at this temperature for 1 h; mix 10 μM of hairpin sequence 1 and 100 μM of the peptide nucleic acid sequence in a 1:2.4 equivalent ratio, heat at 42 °C for 15 min, and then incubate at 4 °C overnight.

[0091] The reaction groups were hairpin sequence 1 (100 nM) + hairpin sequence 2 (100 nM), peptide nucleic acid-hairpin sequence 1 (100 nM) + hairpin sequence 2 (100 nM), trigger sequence (40 nM) + peptide nucleic acid-hairpin sequence 1 (100 nM) + hairpin sequence 2 (100 nM). Incubate at 37 °C for 4 h in the dark, and detect the fluorescence intensity with a microplate reader. The microplate reader was set to excite at 620 nm and emit at 670 nmFigure 2 B). As can be seen from Figure 2 B, in the absence of the trigger subsequence, the hybridization chain reaction amplification of hairpin sequence 1 + hairpin sequence 2 did not occur, and the fluorescence intensity was low. In the presence of the trigger subsequence, the fluorescence intensity increased significantly, indicating that the hybridization chain reaction occurred. After using the peptide nucleic acid sequence to block the foothold part of hairpin sequence 1, it was found that the fluorescence intensity decreased significantly, indicating that the hybridization chain reaction was significantly inhibited. The characterization results were consistent with nucleic acid Native page.

[0092] 5. Verification of the feasibility of embedding the trigger subsequence on the PBMC cell membrane

[0093] The trigger subsequence was designed with 5’cholesterol modification and 3’FAM modification; the modified trigger subsequence was dissolved in 1×HBS to a 10 μM solution. An appropriate amount of the trigger subsequence was heated at 95 °C for 5 min, then quickly cooled to 4 °C and allowed to stand for 1 h. PBMC cells were taken and aliquoted into 1.5 ml EP tubes (1×10 6 cells / tube), and the trigger subsequence (0 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 100 nM) 200 μL was added and incubated at room temperature for 30 min. After washing 3 times with 1×PBS, rabbit anti-human CD3-PE antibody (0.5 μL / tube, 0.5 mg / m1) was added and incubated at 4 °C for 30 min. After washing 3 times with 1×PBS, detection was performed using a flow cytometer. The results ( Figure 3 ) showed that as the incubation concentration of the trigger subsequence increased, the average fluorescence intensity on the cell surface also increased.

[0094] 6. Verification of the feasibility of the hybridization chain reaction on the T cell membrane

[0095] First, the magnetically sorted T cells (1.5×10 6 / tube) were taken, and the trigger subsequence modified at the 5’ end with cholesterol (20 nM, 40 nM, 80 nM), hairpin sequence 1 (150 nM), and hairpin sequence 2 (100 nM) were added to a final volume of 300 μL. After incubating in the dark at 37 °C for 4 h, washing 3 times with 1×PBS, rabbit anti-human CD3-FITC antibody (0.5 μL / tube, 0.5 mg / ml) was added and incubated at 4 °C for 30 min. After washing 3 times with 1×PBS, detection was performed using a flow cytometer. The results ( Figure 4 ) showed that the fluorescence hybridization chain reaction could occur on the T cell membrane surface, and as the incubation concentration of the trigger subsequence increased, the average fluorescence intensity of the cells gradually increased.

[0096] Example 2. Detection of the release level of granzyme B in activated T cells using fluorescence hybridization chain reaction

[0097] The T cells after magnetic bead sorting were plated in 6-well plates (3×10 6 / ml), and 2 μL of cell stimulation mixture (500×) (Catalog No. 00-4970-93, eBioscience TM ) was added to each well and incubated overnight at 37°C. After activation, 350 μL of cell culture medium was taken from each tube and added with peptide nucleic acid-hairpin sequence 1 (150 nM), hairpin sequence 2 (100 nM), and trigger sequences (20 nM, 40 nM, 80 nM), and incubated in the dark at 37°C for 4 h. After washing 3 times with 1×PBS, rabbit anti-human CD3-FITC antibody (0.5 μL / tube, 0.5 mg / ml) was added and incubated at 4°C for 30 min. After washing 3 times with 1×PBS, detection was performed using a flow cytometer. The results ( Figure 5 ) showed that compared with the detection result of granzyme B flow antibody method, the fluorescence hybridization chain reaction detection had better discrimination, and with the increase of the incubation concentration of the trigger sequence, the average fluorescence intensity of the cells increased.

[0098] Example 3: Detection of the release level of granzyme B in the process of tumor killing mediated by bispecific antibody using fluorescence hybridization chain reaction

[0099] The T cell adapter-type bispecific antibody can mediate the specific killing of tumor cells by T cells. It can bypass the TCR-MHC recognition mechanism and show great promise in tumor immunotherapy. A375 cells, T cells after magnetic bead sorting, and CD3×NYESO-1 bispecific antibody (see the patent with patent application number 2023116435708) were taken, and the plating effector-to-target ratio was controlled as effector cells: target cells = 2:1; the plating groups were bispecific antibody concentrations (0 pM, 0.1 pM, 1 pM, 10 pM, 1000 pM), with 3 replicates. After killing at 37°C for 36 h, the cell culture plate was pipetted, 350 μL of cell culture medium was taken, and protein transport inhibitor mixture (500×) (Catalog No. 00-4980-03, eBioscience TM ), trigger sequence (80 nM), peptide nucleic acid-hairpin sequence 1 (150 nM), and hairpin sequence 2 (100 nM) were added, and incubated in the dark at 37°C for 4 h. After washing 3 times with 1×PBS, rabbit anti-human CD3-FITC antibody (0.5 μL / tube, 0.5 mg / ml) was added and incubated at 4°C for 30 min. After washing 3 times with 1×PBS, detection was performed using a flow cytometer. The results ( Figure 6 ) showed that compared with the detection result of granzyme B flow antibody method, the fluorescence hybridization chain reaction detection had better discrimination, and with the increase of the incubation concentration of the bispecific antibody, the average fluorescence intensity of T cells gradually increased.

[0100] Example 4 Verification of the substrate specificity of fluorescence hybridization chain reaction for granzyme B

[0101] A375 cells and T cells sorted by magnetic beads were used, with the ratio of effector cells to target cells being 2:1. CD3×NYESO-1 bispecific antibody was taken and plated in groups according to the bispecific antibody concentration (0 pM, 0.1 pM, 1 pM, 10 pM, 1000 pM), with 3 replicate wells set. After 36 hours of killing at 37°C, the cell culture plate was pipetted, 350 μL of cell culture medium was taken, and a protein transport inhibitor mixture (500×) (product number 00-4980-03, eBioscience TM ), granzyme B inhibitor (product number HY-P10149, MCE) (100 nM, 1 nM) were added. After incubation in the dark at 37°C for 4 hours, a trigger sequence (80 nM), peptide nucleic acid-hairpin sequence 1 (150 nM), and hairpin sequence 2 (100 nM) were added, and incubation was continued in the dark at 37°C for 4 hours. After washing 3 times with 1×PBS, rabbit anti-human CD3-FITC antibody (0.5 μL / tube, 0.5 mg / mL) was added and incubated at 4°C for 30 minutes. After washing 3 times with 1×PBS, detection was performed using a flow cytometer. The results showed ( Figure 7 ) that the addition of granzyme B inhibitor could significantly reduce the mean fluorescence intensity of the cells, and the higher the incubation concentration of the granzyme B inhibitor, the more significant the reduction in the mean fluorescence intensity of the cells.

Claims

1. A fluorescence hybridization chain reaction system for detecting the release level of granzyme B, characterized in that, Comprising the following components: The trigger subsequence, with several T-base spacer sequences at the 5'-end and cholesterol modification introduced, is used to embed on the cell membrane surface; The hairpin sequence 1, with a foothold sequence complementary to the peptide nucleic acid sequence at the 3'-end, internally modified with a fluorescent group and a quenching group, and the end is an OMe-modified base pair; the hairpin sequence 1 inhibits the fluorescence signal through the quenching group when not triggered; The hairpin sequence 2, with the end being an OMe-modified base pair; The peptide nucleic acid sequence, containing a substrate fragment specifically cleaved by granzyme B, and the peptide nucleic acid sequence is complementary paired with the foothold of the hairpin sequence 1 to mask the trigger site; Wherein, when granzyme B cleaves the substrate fragment in the peptide nucleic acid sequence, the foothold of the hairpin sequence 1 is exposed, and the trigger subsequence initiates the hybridization chain reaction between the hairpin sequence 1 and the hairpin sequence 2 through strand displacement reaction, releasing a fluorescence signal.

2. The fluorescence hybridization chain reaction system according to claim 1, wherein The concentration of the trigger subsequence is 50 - 100 nM, the concentration of the hairpin sequence 1 is 100 - 200 nM, and the concentration of the hairpin sequence 2 is 50 - 150 nM.

3. The fluorescence hybridization chain reaction system according to claim 1, wherein The complementary pairing between the hairpin sequence 1 and the peptide nucleic acid sequence is achieved through the following steps: Mix the hairpin sequence 1 and the peptide nucleic acid sequence at an equivalent ratio of 1:1.2 - 2.4, and incubate in the dark at a temperature of 30 - 45 °C for 15 - 30 min.

4. The fluorescence hybridization chain reaction system according to claim 1, wherein The detection reaction temperature of the fluorescence hybridization chain reaction is 25 - 37 °C, and incubate in the dark for 2 - 5 h.

5. The fluorescence hybridization chain reaction system according to claim 1, wherein The T-base spacer sequence added to the 5'-end of the trigger subsequence is 10 - 20 T bases.

6. The fluorescence hybridization chain reaction system according to claim 1, wherein The sequences of the components are: the trigger subsequence is as shown in SEQ ID NO.1, the peptide nucleic acid sequence is as shown in SEQ ID NO.2, the hairpin sequence 1 is as shown in SEQ ID NO.3, and the hairpin sequence 2 is as shown in SEQ ID NO.4; Among them, the sequence shown in SEQ ID NO.3 is modified with a fluorescent group at the 8 - 12th base sequence strand j near the 5'-end, and a quenching group is modified at the 25 - 30th T base position near the 5'-end.

7. A biosensor based on the fluorescence hybridization chain reaction system according to any one of claims 1-6, characterized in that, For real-time detecting the release level of active granzyme B, the biosensor realizes signal detection through the following steps: Granzyme B cleaves the peptide nucleic acid substrate, releasing the foothold of the hairpin sequence 1; The trigger subsequence initiates the hybridization chain reaction, forming a long double-stranded product; The fluorescence signal recovers and is positively correlated with the concentration of granzyme B.

8. Use of the biosensor according to claim 7 in detecting the level of granzyme B released after T cell activation.

9. Use of the biosensor according to claim 7 in detecting the level of granzyme B released when bispecific antibody kills tumor cells.

10. A method for detecting granzyme B not for the purpose of disease diagnosis or treatment, characterized in that, Using the fluorescence hybridization chain reaction system according to any one of claims 1 - 6, comprising the following steps: Pre-assemble the hairpin sequence 1 and the peptide nucleic acid sequence; Add the sample to be tested and incubate to trigger the hybridization chain reaction; Quantify the concentration of granzyme B through the change in fluorescence intensity.

Images