Primer probe composition, nucleic acid detection method and application

Abstract

The invention provides a primer probe composition, a nucleic acid detection method and application, and relates to the technical field of molecular biology. The 5 '-3'direction of the first primer comprises a first target sequence binding area, the 5'-3 'direction of the second primer comprises a primer signal detection area, a second target sequence binding area and a third target sequence binding area, and the probe comprises a probe signal detection area. The complementary sequence of the primer signal detection area is specifically combined with the probe signal detection area. When the primer probe composition is used for nucleic acid detection, the problem of false positive caused by dimers formed among the primers can be effectively avoided, and the specificity and the accuracy of multiple nucleic acid detection are remarkably improved.

Description

Primer probe composition, nucleic acid detection method and application Technical Field

[0001] The present application relates to the technical field of molecular biology, and specifically to primer-probe compositions, nucleic acid detection methods, and applications.

[0002] Priority information

[0003] This application claims priority to Chinese patent application CN202311295503.1 filed on October 8, 2023, the entire contents of which are incorporated herein by reference in their entirety. Background Art

[0004] The polymerase chain reaction (PCR) is a molecular biology technique that uses enzymes to replicate DNA without using living organisms. PCR is commonly used in medical and biological research laboratories for a variety of tasks, such as diagnosing infectious diseases, gene cloning, phenotyping experimental animals, transcriptome studies, detecting genetic diseases, identifying genetic fingerprints, and paternity testing. Due to its unparalleled replication and precision, PCR is considered by molecular biologists to be the method of choice for nucleic acid detection. In the late 1990s, the introduction of real-time quantitative PCR (qPCR) technology and related products by ABI (USA) further developed PCR into a highly sensitive, specific, and precise nucleic acid sequence analysis technique.

[0005] The most widely used primer and probe design method in qPCR platforms is the TaqMan hydrolysis probe method. Its working principle is to utilize an oligonucleotide probe that specifically binds to the template and is labeled with a fluorescent group (donor) and a quencher group (acceptor) at both ends. At the same time, a specific PCR primer is designed upstream and downstream of the probe. Before the PCR reaction begins, due to the principle of fluorescence resonance energy transfer (FRET), the fluorescent signal emitted by the fluorescent group at one end of the TaqMan probe is absorbed by the quencher group at the other end, making the fluorescent signal undetectable by the instrument. After PCR amplification begins, the TaqMan probe specifically binds to the template. When the DNA polymerase (Taq enzyme) extends to the site where the probe binds to the template, the 5-3' exonuclease activity of the Taq enzyme cuts the TaqMan probe, causing the fluorescent group labeled on the probe to move away from the quencher group and no longer forming a FRET structure. Therefore, the signal emitted by the fluorescent group can be detected by the instrument. However, in the same reaction system, to achieve PCR detection of multiple targets, it is necessary to set up multiple TaqMan hydrolysis probes labeled with fluorescent groups of different wavelengths. Depending on the number of fluorescent channels of the detection instrument, only 4-6 different target detections can be achieved at most.

[0006] To achieve multiplex detection, melting curve analysis is a good solution. After the amplification reaction is complete, melting curve analysis is generated by gradually increasing the temperature while monitoring the fluorescence signal at each step. A characteristic peak at the melting temperature (Tm, the temperature at which the DNA double strand melts 50%) is observed. This characteristic peak can be used to distinguish specific products from other products, even if they use the same fluorescence channel.

[0007] However, melting curve analysis presents a number of challenges for primer and probe design. First, nonspecific amplification must be avoided, which can lead to false-positive results by producing products with melting temperatures similar to those of the specific product. Second, the formation of primer dimers can generate interfering signals, affecting the accuracy of the analysis. Furthermore, to ensure that the melting curve can accurately distinguish different targets, the melting temperatures of different targets must differ sufficiently to allow them to be recognized.

[0008] Summary of the Invention

[0009] The present application provides a primer-probe composition, a nucleic acid detection method and an application. The second primer of the primer-probe composition has partial sequence complementarity and forms a stem-loop structure when the target is not present, so as to avoid the false positive problem caused by primer dimers between multiple pairs of primers during amplification; when the target is present, the stem-loop structure of the primer is unwound, and the first amplification is performed after specific binding to the target. One of the specific amplification products formed after the first amplification is a single-stranded amplification product (S1), which can form a new stem-loop structure, and its 3' end is released so as to perform a second amplification that can cause a signal change; and the non-specific amplification product does not form a new stem-loop structure, and its stem-loop structure is similar to that of the second primer. Its 3' end is closed due to the formation of the stem, making it difficult to perform the next specific amplification that can cause a signal change. Therefore, the specificity of the amplification process is significantly improved. When designing probes and primers, the probe can be completely unrelated to the target sequence or have a non-strict complementary relationship, so the design of the probe is simpler, more convenient, and has a higher degree of freedom; the probe specifically binds to a portion of the complementary sequence of the second primer, so by adjusting the length and position of the sequences that the two can specifically bind to, amplification products formed with the probe with different Tm values ​​are obtained, and the presence of the target is determined based on the Tm value to achieve nucleic acid detection.

[0010] Therefore, this application can solve the problem of false positives caused by nonspecific amplification of primers in the presence of multiple specific primers in a single-tube reaction. Target sources such as bacteria, viruses, and the human genome enable clinical units, including primary care hospitals, to quickly conduct common nucleic acid tests, such as those for pathogenic microbial infections, to assist with other testing and diagnostic methods, more quickly provide diagnostic evidence and medication plans, reduce the mental and financial burden on patients, and achieve the goal of precision medicine.

[0011] This application involves the following:

[0012] 1. A primer-probe composition for nucleic acid detection, comprising at least one first primer, at least one second primer, and at least one probe;

[0013] The first primer includes a first target sequence binding region (X1') from the 5' end to the 3' end;

[0014] The second primer includes a primer signal detection region (h), a second target sequence binding region (X2'), and a third target sequence binding region (X3') from the 5' end to the 3' end; when the target is not present, the primer signal detection region (h) specifically binds to a portion of the second primer sequence to form a first stem-loop structure;

[0015] The first target sequence binding region (X1') and the second target sequence binding region (X2') specifically bind to the first target sequence (X1) and the second target sequence (X2) of one target chain in the double-stranded target, respectively, and the third target sequence binding region (X3') can specifically bind to the third target sequence of the other target chain in the double-stranded target;

[0016] The probe comprises a probe signal detection region (H) and a first detection group and a second detection group modified at any position on the probe, wherein the first detection group and the second detection group generate a detectable signal change by changing the distance between the first detection group and the second detection group on the probe;

[0017] The complementary sequence of the primer signal detection region (h) specifically binds to the probe signal detection region (H).

[0018] 2. The primer-probe combination of item 1, wherein, when the target is not present, a portion of the sequence of the second primer that forms the first stem-loop structure after specifically binding to the primer signal detection region (h) is a primer signal detection region complementary sequence (h'), and the primer signal detection region complementary sequence (h') is located between the second target sequence binding region (X2') and the third target sequence binding region (X3');

[0019] The primer signal detection region (h), the primer signal detection region complementary sequence (h') and the probe are not complementary to and / or identical in sequence to any target sequence;

[0020] Preferably, the second primer further comprises a third linker sequence located between the complementary sequence (h') of the primer signal detection region and the third target sequence binding region (X3'), and the third linker sequence is not complementary to and / or identical in sequence to any target sequence.

[0021] 3. The primer-probe composition described in item 1, when the target is not present, a portion of the sequence of the second primer that forms a first stem-loop structure after specifically binding to the primer signal detection region (h) is the second target sequence binding region (X2'), and the second primer also includes a third connecting sequence located between the second target sequence binding region (X2') and the third target sequence binding region (X3'), and the third connecting sequence is not complementary to and / or has the same sequence as any target sequence.

[0022] 4. The primer-probe combination described in any one of items 1-3, wherein any two of the first target sequence binding region (X1'), the third target sequence binding region (X3') and the second target sequence binding region (X2') are not complementary in sequence or identical in sequence.

[0023] 5. The primer-probe combination according to any one of items 1 to 4, wherein the length of the first primer and the second primer are each independently 20 to 80 bases.

[0024] 6. The primer-probe combination according to any one of items 1 to 5, wherein the length of the first target sequence binding region (X1') is 15-45 bases; and / or the Tm value of the first target sequence binding region (X1') is 40-80°C.

[0025] 7. The primer-probe composition according to any one of items 1 to 6, wherein the lengths of the primer signal detection region (h) and the complementary sequence of the primer signal detection region (h') are each independently 5-65 bases; and / or the Tm values ​​of the primer signal detection region (h) and the complementary sequence of the primer signal detection region (h') are each independently 30-80°C.

[0026] 8. The primer-probe combination according to any one of items 1 to 7, wherein the length of the second target sequence binding region (X2') is 5-65 bases; and / or the Tm value of the second target sequence binding region (X2') is 40-80°C.

[0027] 9. The primer-probe combination according to any one of items 1 to 8, wherein the length of the third target sequence binding region (X3') is 5-65 bases; and / or the Tm value of the third target sequence binding region (X3') is 40-80°C.

[0028] 10. The primer-probe combination according to any one of items 1 to 9, wherein the length of the probe signal binding region (H) is 5 to 65 bases; and / or the Tm value of the probe signal binding region (H) is 30 to 85°C.

[0029] 11. The primer-probe combination according to any one of items 1 to 10, wherein the first primer further comprises a probe anchor region (A) located at the 5' end of the first target sequence binding region (X1'); the probe anchor region (A) is used to bind to the probe; the probe anchor region (A) is not complementary to and / or has the same sequence as any target sequence.

[0030] 12. The primer-probe combination described in item 11, wherein the length of the probe anchor region (A) is 5-35 bases; and / or the Tm value of the probe anchor region (A) is 40-80°C; and / or the GC content of the probe anchor region (A) is 40-80%.

[0031] 13. The primer-probe combination according to item 11 or 12, wherein the probe further comprises a primer anchor region (A'); the probe anchor region (A) is complementary to the primer anchor region (A') sequence.

[0032] 14. The primer-probe composition of item 13, wherein the length of the primer anchor region (A') is 5-35 bases; and / or the Tm value of the primer anchor region (A') is 40-80°C; and / or the GC content of the primer anchor region (A') is 40-85%.

[0033] 15. The primer-probe combination according to any one of claims 1 to 14, wherein the probe comprises a probe signal detection region (H) and a primer anchor region (A') from the 5' end to the 3' end;

[0034] Alternatively, the probe includes a probe signal detection region (H) and a primer anchor region (A') from the 3' end to the 5' end.

[0035] 16. The primer-probe combination according to any one of items 13 to 15, wherein the Tm value of the probe anchor region (A) is greater than the Tm value of the primer signal detection region (h).

[0036] 17. The primer-probe combination according to any one of items 11 to 14 and 16, wherein the first primer further comprises a fourth linker sequence located between the probe anchor region (A) and the first target sequence binding region (X1′);

[0037] And / or, the second primer further comprises a first linker sequence located between the primer signal detection region (h) and the second target sequence binding region (X2');

[0038] and / or, a second linker sequence located between the second target sequence binding region (X2') and the primer signal detection region complementary sequence (h');

[0039] And / or, the probe further comprises a fifth linker sequence located between the primer anchor region (A') and the probe signal detection region (H);

[0040] The first connecting sequence, the second connecting sequence, the fourth connecting sequence and the fifth connecting sequence are not complementary to and / or identical in sequence to any target sequence.

[0041] 18. The primer-probe combination according to any one of items 1 to 17, wherein the first detection group is a fluorescent reporter group, and the second detection group is a fluorescence quencher group or a group that generates a fluorescent signal by fluorescence resonance energy transfer with the fluorescent reporter group;

[0042] Preferably, the fluorescent reporter group is selected from any one or more of ALEX-350, FAM, VIC, TET, CAL FluorGold540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, Cy3, Cy5, Cy5.5 and Quasar 705; the fluorescence quencher group is selected from any one or more of DABCYL, BHQ (such as BHQ-1 or BHQ-2), ECLIPSE and TAMRA;

[0043] Preferably, on the probe, the distance between the fluorescent reporter groups is 3-250 angstroms; preferably, 3-201 angstroms; more preferably, 3-140 angstroms.

[0044] 19. The primer-probe combination according to any one of items 1 to 18, wherein the 3' end of the probe contains a blocking region.

[0045] 20. The primer-probe combination according to any one of items 1 to 19, wherein the primer-probe combination comprises one probe and at least two second primers, wherein the sequences of the primer signal detection regions (h) on different second primers are different, and the complementary sequences of the primer signal detection regions (h) on different second primers specifically bind to the probe signal binding region (H) at different locations;

[0046] Preferably, the first primer is one, two or more.

[0047] 21. A primer-probe system for nucleic acid detection, comprising the primer-probe composition according to any one of claims 1 to 20.

[0048] 22. A method for nucleic acid detection, comprising contacting a target sample with the primer-probe combination of any one of items 1 to 20 and / or the primer-probe system of item 21, performing at least two amplifications, and analyzing whether a target is present;

[0049] Wherein, the target sample includes a target sequence;

[0050] Preferably, the source of the target sample includes any one or more of bacteria, viruses, and pathogens;

[0051] Preferably, the method for analyzing whether there is a target includes: judging whether there is a target by signal changes before and after amplification; and / or, judging whether there is a target by analyzing the melting curve of the amplified product; and / or, judging whether there is a target by signal changes before and after denaturation of the amplified product;

[0052] Preferably, the amplification comprises: randomly distributing the reaction system into at least 500 reaction units, each reaction unit containing one target of the sample to be tested or not containing the target of the sample to be tested;

[0053] And / or, performing PCR amplification on all reaction units.

[0054] 23. The method according to item 22, wherein after the target sample is contacted with the primer-probe composition and / or the primer-probe system, when the target is present in the target sample, a first specific amplification is performed using the target as a template and the first and second primers as primers to obtain a single-stranded amplification product (S1); the single-stranded amplification product (S1) comprises, from the 5' end to the 3' end, at least a first target sequence binding region (X1'), a complementary sequence of the second target sequence (X2), a complementary sequence (X3") of the third target sequence binding region (X3'), an optional complementary sequence of a third linker sequence and / or a complementary sequence of a primer signal detection region complementary sequence (h'), a complementary sequence (X2") of the second target sequence binding region (X2'), and a complementary sequence of the primer signal detection region (h);

[0055] In the single-stranded amplification product (S1), the Gibbs free energy of a conformation formed by the specific binding of the complementary sequence of the second target sequence (X2) and the complementary sequence (X2") of the second target sequence binding region (X2') is less than the Gibbs free energy of a conformation formed by the specific binding of the complementary sequence of the primer signal detection region (h) and the complementary sequence of the complementary sequence of the primer signal detection region (h'); or, the Gibbs free energy of a conformation formed by the specific binding of the complementary sequence of the second target sequence (X2) and the complementary sequence (X2") of the second target sequence binding region (X2') is less than the Gibbs free energy of a conformation formed by the specific binding of the complementary sequence of the primer signal detection region (h) and the complementary sequence (X2") of the second target sequence binding region (X2');

[0056] The single-stranded amplification product (S1) combines with the complementary sequence of the second target sequence and the complementary sequence (X2") of the second target sequence binding region (X2') to form a second stem-loop structure;

[0057] When the target is present, the second stem-loop structure of the single-stranded amplification product (S1) is unraveled, and a second specific amplification is performed using the probe as a template and the single-stranded amplification product (S1) as a primer to obtain a double-stranded amplification product formed with the probe;

[0058] The melting temperature of the double-stranded amplification product formed with the probe is detected to achieve nucleic acid detection.

[0059] 24. A use of the primer-probe combination according to any one of items 1 to 20 and / or the primer-probe system according to item 21, wherein the use comprises preparing a product for nucleic acid detection and / or nucleic acid detection;

[0060] Preferably, the nucleic acid detection product is related to a disease;

[0061] More preferably, the disease is papilloma.

[0062] 25. A nucleic acid detection kit comprising the primer-probe combination according to any one of items 1 to 20 and / or the primer-probe system according to item 21;

[0063] Preferably, the kit further comprises an amplification reagent;

[0064] More preferably, the amplification reagent comprises DNA polymerase and dNTPs;

[0065] More preferably, the amplification reagent further comprises reverse transcriptase.

[0066] Effects of the Invention

[0067] 1. Multiplex Detection: The method described in this application can simultaneously perform analysis in two dimensions, fluorescence channels and melting temperature, in a single-tube reaction. That is, using the same fluorescence channel, different targets can be detected through melting temperature characteristics; or using different fluorescence channels, target type detection can be achieved by multiplying the number of fluorescence channels by the melting temperature characteristics.

[0068] 2. Strong specificity: The method described in the present application can enable the blocking primer to present a hairpin structure (i.e., the first stem-loop structure formed by the second primer) in the absence of a target sequence, and the second primer has two regions that bind to the target sequence (i.e., the second target sequence binding region (X2'), and the third target sequence binding region (X3')); when the target sequence is present, the original hairpin structure of the second primer is opened, which does not affect the amplification efficiency, and the single-stranded amplification product formed presents another hairpin structure, which does not affect the binding to the probe to generate a signal.

[0069] 3. High sensitivity: In the method described in this application, the probe can be completely unrelated to the target sequence, so the requirement for the length of the target sequence is very low. When the target type is a short nucleic acid fragment, such as free nucleic acid, a shorter target sequence length has a higher sensitivity in detection.

[0070] 4. Low fluorescence background: Each fluorescent channel uses only one probe, which not only reduces the reagent cost, but also can distinguish the amplified products by their different melting temperatures, greatly reducing the fluorescence background in the PCR reaction and improving the reaction sensitivity.

[0071] 5. Adjustable melting temperature: The method described in the present application utilizes the different melting temperatures of the double-stranded amplification products formed with the probe for differentiation. Therefore, by adjusting the length or sequence of the primer signal detection region (h), and / or adjusting the position of the complementary sequence of the primer signal detection region (h) and the probe signal detection region (H) of the probe, the melting temperature of the secondary amplification double-stranded product formed with the probe is increased or decreased, so that the melting temperatures of different targets are sufficiently different and easier to be accurately identified.

[0072] 6. Good inclusiveness: The primer probe design method described in this application has only two parts complementary pairing with the target sequence, namely the first primer and the second primer. Compared with the Taqman hydrolysis probe method, which requires three parts (the first primer, the second primer and the probe) to complementarily pair with the template, when there are many highly variable regions in the target sequence, such as viral or bacterial genomes, the primer probe design method described in this application has better inclusiveness and lower design difficulty.

[0073] 7. Wide scope of application: The method described in this application can be applied to nucleic acid detection of various sample types, including serum samples, plasma samples, whole blood samples, sputum samples, swab samples, lavage fluid samples, fresh tissue samples, formalin-fixed paraffin-embedded tissue (FFPE), etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1. Melting curve of the amplification product after using the reverse primer (R1) in Example 2.

[0075] Figure 2. Melting curve of the amplification product after using the reverse primer (R2) in Example 2.

[0076] Figure 3. Melting curve of the amplification product after using the reverse primer (R3) in Example 2.

[0077] Figure 4. Melting curves of the four targets in Example 3.

[0078] Figure 5. Melting curve of the no-template control when the primers and probes of Example 3 were added simultaneously; the abscissa is temperature (°C).

[0079] Specific implementation methods

[0080] It should be noted that certain terms are used in the specification and claims to refer to specific components. Those skilled in the art will understand that they may use different terms to refer to the same component. This specification and claims do not distinguish components based on differences in terms, but rather on differences in their functions.

[0081] Throughout the specification and claims, the words "including" or "comprising" are open-ended terms and should be interpreted as "including but not limited to." The specification subsequently describes preferred embodiments of the present application. However, the description is for the purpose of general principles of the specification and is not intended to limit the scope of the present application. The scope of protection of the present application shall be determined by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0082] It should be understood that the embodiments of the present application described herein include "consisting of" and / or "consisting essentially of" embodiments. Reference herein to "about" a value or parameter includes (and describes) variations with respect to that value or parameter itself. For example, a description referring to "about X" includes a description of "X."

[0083] As used herein, reference to an "other than" value or parameter generally means and describes an "other than" value or parameter. For example, the method is not for treating cancer type X, meaning that the method is for treating cancers other than type X.

[0084] As used herein, the term "about XY" has the same meaning as "about X to about Y."

[0085] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. It should also be noted that claims can be drafted to exclude any optional element. Thus, this statement is intended to serve as antecedent basis for use of exclusive terminology such as "only," "only" and the like in connection with the recitation of claim elements, or the use of a limitation such as "no."

[0086] As used herein, the term "and / or" in phrases such as "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, as used herein, the term "and / or" in phrases such as "A, B and / or C" is intended to include each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0087] Independently means that the choices (e.g., values) of the factors are unrelated and unconnected. For example, if A and B are independently m, n, or q, this means that if A is m, B can be m, n, or q. For example, if A is n, B can be m, n, or q. For example, if B is q, A can be m, n, or q.

[0088] As used herein, "specific pairing and binding" or "specific binding" refers to the binding of two single-stranded nucleic acid molecules with complementary sequences through base pairing under certain conditions (e.g., suitable temperature and ionic strength). It is well known to those skilled in the art that specific binding does not require complete complementary pairing between two single-stranded nucleic acid molecules; specific binding can occur even with a few base mismatches.

[0089] A primer-probe composition for nucleic acid detection, comprising at least one first primer, at least one second primer, and at least one probe;

[0090] The first primer includes a first target sequence binding region (X1') from the 5' end to the 3' end;

[0091] The second primer includes a primer signal detection region (h), a second target sequence binding region (X2'), and a third target sequence binding region (X3') from the 5' end to the 3' end; when the target is not present, the primer signal detection region (h) specifically binds to a portion of the second primer sequence to form a first stem-loop structure;

[0092] The first target sequence binding region (X1') and the second target sequence binding region (X2') specifically bind to the first target sequence and the second target sequence of one target chain in the double-stranded target, respectively, and the third target sequence binding region (X3') can specifically bind to the third target sequence of the other target chain in the double-stranded target;

[0093] The probe comprises a probe signal detection region (H) and a first detection group and a second detection group modified at any position on the probe, wherein the first detection group and the second detection group generate a detectable signal change by changing the distance between the first detection group and the second detection group on the probe;

[0094] The complementary sequence of the primer signal detection region (h) specifically binds to the probe signal detection region (H).

[0095] In the present application, "complementary" refers to forward complementation or reverse complementation, preferably reverse complementation.

[0096] It should be noted that the first target sequence binding region (X1') and the third target sequence binding region (X3') are both target-specific sequences. Target-specific sequences refer to specific regions used to specifically identify and amplify target DNA or RNA sequences in PCR (polymerase chain reaction) or other molecular biology experiments. For the amplification of double-stranded targets, the first target sequence binding region (X1') and the second target sequence binding region (X2') can bind to the same target chain in the double-stranded target (one target chain in the double-stranded target, i.e., the target single chain); and the third target sequence binding region (X3') can bind to the other target chain in the double-stranded target (one target chain in the double-stranded target, i.e., the target single chain). For example: a double-stranded target contains target single chain A and target single chain B; wherein, the first target sequence binding region (X1') and the second target sequence binding region (X2') respectively bind to different fragments of the target single chain A, that is, the target single chain A contains the first target sequence (X1) and the second target sequence (X2); and the third target sequence binding region (X3') binds to the target single chain B, that is, the target single chain B contains the third target sequence (X3).

[0097] The target in this application is double-stranded DNA. The target can be double-stranded DNA obtained from original DNA double strands, double-stranded DNA obtained by amplification of single-stranded DNA, or double-stranded DNA obtained by reverse transcription from RNA; the target can be naturally occurring, engineered, or artificially synthesized.

[0098] In some embodiments, the first primer is a forward primer and the second primer is a reverse primer; in some embodiments, the first primer is a reverse primer and the second primer is a forward primer.

[0099] In some embodiments, when the target is not present, a portion of the sequence of the second primer that forms the first stem-loop structure after specifically binding to the primer signal detection region (h) is a primer signal detection region complementary sequence (h'), and the primer signal detection region complementary sequence (h') is located between the second target sequence binding region (X2') and the third target sequence binding region (X3'); the primer signal detection region (h), the primer signal detection region complementary sequence (h') and the probe are not complementary to any target sequence and / or have the same sequence. In some embodiments, the sequences of the primer signal detection region (h) and the primer signal detection region complementary sequence (h') are forward complementary or reverse complementary; preferably, they are reverse complementary. In some embodiments, the second primer further includes a first connecting sequence located between the primer signal detection region (h) and the second target sequence binding region (X2'). In some embodiments, the second primer further includes a second connecting sequence located between the second target sequence binding region (X2') and the primer signal detection region complementary sequence (h'). In some embodiments, the second primer further includes a third connecting sequence located between the primer signal detection region complementary sequence (h') and the third target sequence binding region (X3'). Wherein, the first connecting sequence, the second connecting sequence and the third connecting sequence are not complementary to any target sequence and / or have the same sequence. In some embodiments, the second primer includes a primer signal detection region (h), a second target sequence binding region (X2'), a primer signal detection region complementary sequence (h'), a third connecting sequence and a third target sequence binding region (X3') from the 5' end to the 3' end. In some embodiments, the second primer includes a primer signal detection region (h), a second target sequence binding region (X2'), a primer signal detection region complementary sequence (h'), and a third target sequence binding region (X3') from the 5' end to the 3' end. In some embodiments, the second primer includes, from the 5' end to the 3' end, a primer signal detection region (h), a first linker sequence, a second target sequence binding region (X2'), a primer signal detection region complementary sequence (h'), a third linker sequence, and a third target sequence binding region (X3'). In some embodiments, the second primer includes, from the 5' end to the 3' end, a primer signal detection region (h), a second target sequence binding region (X2'), a second linker sequence, a primer signal detection region complementary sequence (h'), a third linker sequence, and a third target sequence binding region (X3'). In some embodiments, the second primer includes, from the 5' end to the 3' end, a primer signal detection region (h), a first linker sequence, a second target sequence binding region (X2'), a second linker sequence, a primer signal detection region complementary sequence (h'), and a third target sequence binding region (X3').In some embodiments, the second primer includes, from the 5' end to the 3' end, a primer signal detection region (h), a first linker sequence, a second target sequence binding region (X2'), a second linker sequence, a primer signal detection region complementary sequence (h'), a third linker sequence, and a third target sequence binding region (X3').

[0100] In some embodiments, the Tm value of the primer signal detection region (h) is simultaneously smaller than the Tm value of the first target sequence binding region (X1') and the Tm value of the third target sequence binding region (X3') in the first primer; so that during the nucleic acid detection process, the first target sequence binding region (X1') and the third target sequence binding region (X3') first bind to the target for the first amplification to form a single-stranded amplification product (S1), and then the complementary sequence of the primer signal detection region (h) is released and specifically binds to the probe signal detection region (H) on the probe.

[0101] During sequence amplification, when there is no target sequence in the amplification system or the target sequence content is so low that amplification cannot be performed, the primer signal detection zone (h) specifically binds to the primer signal detection zone complementary sequence (h'), so that the second primer forms a stem-loop structure. Specifically, the primer signal detection zone (h) and the primer signal detection zone complementary sequence (h') form a "stem", and the second target sequence binding region (X2') between the primer signal detection zone (h) and the primer signal detection zone complementary sequence (h') forms a "loop". This stem-loop structure avoids the false positive problem caused by the formation of primer dimers between primers. When there is a target in the amplification system, the second primer uses the target as a template and continues to extend an extended chain along the 3' direction of the third target sequence binding region (X3'). The extended chain contains a second target sequence (X2) that can specifically bind to the second target sequence binding region (X2'). The two combine, resulting in the destruction of the "stem" formed by the primer signal detection zone (h) and the primer signal detection zone complementary sequence (h').

[0102] In some embodiments, when the target is not present, a portion of the sequence of the second primer that forms the first stem-loop structure after binding to the primer signal detection region (h) is the second target sequence binding region (X2'), and the second primer further includes a third connecting sequence located between the second target sequence binding region (X2') and the third target sequence binding region (X3'), and the third connecting sequence is not complementary to any target sequence and / or has the same sequence. Wherein, the binding between the primer signal detection region (h) and the second target sequence binding region (X2') is not a completely base complementary binding; the primer signal detection region (h) and the second target sequence binding region (X2') have partial sequence complementarity. Exemplary examples include: a partial sequence of the primer signal detection region (h) and a partial sequence of the second target sequence binding region (X2') are complementary; or, the entire sequence of the primer signal detection region (h) and a partial sequence of the second target sequence binding region (X2') are complementary; or, a partial sequence of the primer signal detection region (h) and the entire sequence of the second target sequence binding region (X2') are complementary.

[0103] In some embodiments, the second primer further includes a first connecting sequence located between the primer signal detection region (h) and the second target sequence binding region (X2'). In some embodiments, the second primer further includes a second connecting sequence located between the second target sequence binding region (X2') and the primer signal detection region complementary sequence (h'). In some embodiments, the second primer includes, from the 5' end to the 3' end, a primer signal detection region (h), a second target sequence binding region (X2'), a third connecting sequence that is not complementary to any target sequence and / or has the same sequence, and a third target sequence binding region (X3'). In some embodiments, the primer signal detection region (h) and the second target sequence binding region (X2') in the second primer are directly connected; at this time, the sequence of the primer signal detection region (h) is long enough to form the stem in the stem-loop structure, and the partial sequence of the primer signal detection region (h) is complementary to the partial sequence of the second target sequence binding region (X2'). In some embodiments, a first connecting sequence is connected between the primer signal detection region (h) and the second target sequence binding region (X2') of the second primer; in this case, the primer signal detection region (h) is relatively short, and the first connecting sequence is connected between the primer signal detection region (h) and the second target sequence binding region (X2'), and the loop portion of the stem-loop structure formed is mainly formed by the first connecting sequence. In some embodiments, the second primer is composed of a primer signal detection region (h), a first connecting sequence, a second target sequence binding region (X2'), a third connecting sequence, and a third target sequence binding region (X3') from the 5' end to the 3' end. In some embodiments, the second primer is composed of a primer signal detection region (h), a second target sequence binding region (X2'), a third connecting sequence, and a third target sequence binding region (X3') from the 5' end to the 3' end. In some embodiments, the second primer comprises, from the 5' end to the 3' end, a primer signal detection region (h), a first linker sequence, a second target sequence binding region (X2'), a second linker sequence, a primer signal detection region complementary sequence (h'), a third linker sequence, and a third target sequence binding region (X3'). In some embodiments, the first primer is F1 with a sequence as shown in SEQ ID NO: 2. In some embodiments, exemplary, the second primer is R2 with a sequence as shown in SEQ ID NO: 4, or R3 with a sequence as shown in SEQ ID NO: 5.

[0104] When sequence amplification is performed, when there is no target sequence in the amplification system or the target sequence content is so low that amplification cannot be performed, the primer signal detection zone (h) is combined with the second target sequence binding zone (X2') through partial base sequence complementary pairing, so that the second primer forms a stem-loop structure. Specifically, a partial sequence of the primer signal detection zone (h) is complementary to the second target sequence binding zone (X2') to form a "stem", and the part of the primer signal detection zone (h) that is not complementary to the second target sequence binding zone (X2') at all forms a "loop". This stem-loop structure avoids the false positive problem caused by the formation of primer dimers between primers. Of course, it is understandable that if the "loop" is formed only by the primer signal detection zone (h), then the primer signal detection zone (h) is long enough. When a target is present in the amplification system, using one strand of the double-stranded target as a template, the second primer continues to extend an extended strand along the 3' direction of the third target sequence binding region (X3'). The extended strand contains a second target sequence (X2). The second target sequence (X2) specifically binds to the second target sequence binding region (X2'), thereby destroying the "stem" formed by the primer signal detection region (h) and the second target sequence binding region (X2').

[0105] In some embodiments, the first primer further comprises a probe anchor region (A) located at the 5' end of the first target sequence binding region (X1'); the probe anchor region (A) is used to bind to the probe; the probe anchor region (A) is not complementary to any target sequence and / or has the same sequence as any target sequence. In some embodiments, the first primer further comprises a fourth connecting sequence located between the probe anchor region (A) and the first target sequence binding region (X1'), and the fourth connecting sequence is not complementary to any target sequence and / or has the same sequence as any target sequence. In some embodiments, the first primer comprises the probe anchor region (A) and the first target sequence binding region (X1') from the 5' to the 3' end; in some embodiments, the first primer comprises the probe anchor region (A), the fourth connecting sequence and the first target sequence binding region (X1') from the 5' to the 3' end.

[0106] In some embodiments, the probe further comprises a primer anchor region (A'); the primer anchor region (A') is not complementary to any target sequence and / or has the same sequence. In some embodiments, the primer anchor region (A') and the probe anchor region (A) are complementary; in some embodiments, the primer anchor region (A') and the probe anchor region (A) are forward complementary; in some embodiments, the primer anchor region (A') and the probe anchor region (A) are reverse complementary. In some embodiments, the probe further comprises a fifth connecting sequence located between the primer anchor region (A') and the probe signal detection region (H), and the fifth connecting sequence is not complementary to any target sequence and / or has the same sequence.

[0107] It should be noted that the present application does not limit the location of the anchor region (A') and the probe signal detection region (H) on the probe, and they can be set arbitrarily. In some embodiments, the probe includes the probe signal detection region (H) from the 5' end to the 3' end; in some embodiments, the probe includes the primer anchor region (A') and the probe signal detection region (H) from the 5' end to the 3' end; further, the first detection group and the second detection group are modified between the primer anchor region (A') and the probe signal detection region (H). In some embodiments, the probe includes a primer anchor region (A'), a fifth linker sequence and a probe signal detection region (H) from the 5' end to the 3' end; in some embodiments, the probe includes a fifth linker sequence and a probe signal detection region (H) from the 5' end to the 3' end; in some embodiments, the probe includes a probe signal detection region (H) from the 3' end to the 5' end; in some embodiments, the probe includes a primer anchor region (A') and a probe signal detection region (H) from the 3' end to the 5' end, and further, the first detection group and the second detection group are modified at the 5' end of the probe signal detection region (H); in some embodiments, the probe includes a primer anchor region (A'), a fifth linker sequence and a probe signal detection region (H) from the 3' end to the 5' end; in some embodiments, the probe includes a fifth linker sequence and a probe signal detection region (H) from the 3' end to the 5' end.

[0108] In a specific embodiment, the probe is probe P having a sequence as shown in SEQ ID NO: 1. In some embodiments, the primer probe composition is P1F1R2; in some embodiments, the primer probe composition is P1F1R3; in some embodiments, the primer probe composition is P1F1R1R2; in some embodiments, the primer probe composition is P1F1R1R3; in some embodiments, the primer probe composition is P1F1R1R2R3; in some embodiments, the primer pair is P1F1R2R3.

[0109] In some embodiments, the probe comprises one or more probe signal detection regions (H); in some embodiments, the probe comprises one or more primer anchor regions (A').

[0110] In some embodiments, the probe includes 1-2 primer anchor regions (A') and 1-2 probe signal detection regions (H).

[0111] In some embodiments, the probe is any one of the structures 1) to 4);

[0112] 1) The probe comprises a primer anchor region (A') and a probe signal detection region (H);

[0113] 2) The probe comprises a probe signal detection region (H) and two primer anchor regions (A'), the two primer anchor regions (A') are respectively located on both sides of the probe signal detection region (H), and the sequences of the two primer anchor regions (A') are different;

[0114] 3) The probe comprises a primer anchor region (A') and two probe signal detection regions (H), the two probe signal detection regions (H) are respectively located on both sides of the primer anchor region (A'), and the sequences of the two probe signal detection regions (H) are different;

[0115] 4) The probe comprises two primer anchor regions (A') and two probe signal detection regions (H), wherein the primer anchor regions (A') and the probe signal detection regions (H) are arranged alternately, the sequences of the two primer anchor regions (A') are different, and the sequences of the two probe signal detection regions (H) are different.

[0116] In some embodiments, the 3' end of the probe contains a blocking region. This solution ensures that when the single-stranded amplification product (S1) is combined with the probe and then subjected to secondary amplification, the 3' end of the single-stranded amplification product (S1) only extends to the end of the probe, thereby reducing nonspecific amplification.

[0117] In the present application, the blocking region (blocking region) is used to prevent the extension of the nucleic acid chain by DNA polymerase, thereby preventing the part of chain extension in, for example, the PCR process. The blocking region can be modified with 3'-Spacer C3, 3'-Phosphat, 3'-ddC, 3'-Inverted End, etc., so that its 3'OH is blocked, thereby preventing its extension reaction. The blocking region can also be a polymerase enzyme blocking group, a group with the functional property of further extending the polymer. The blocking group can be any chemical group that can be connected to a nucleotide, which allows the 5' end of the modified nucleotide to be connected to the 3' end of another nucleotide in the DNA chain but will not allow the nucleotide to be connected to the 3' hydroxyl group of the modified nucleotide. Suitably, the absence of the OH group at the 3' position will prevent further extension by polymerase activity. In some embodiments, the blocking group is selected from acetyl, CH3, glycyl, leucyl and alanyl groups. In other embodiments, the blocking group can be in the form of a di- or tripeptide.

[0118] In some embodiments, the Tm value of the probe anchor region (A) is greater than the Tm value of the primer signal detection region (h), so that: when the single-stranded amplification product (S1) binds to the probe, the probe anchor region (A) of the single-stranded amplification product (S1) first specifically binds to the primer anchor region (A') on the probe, and with the help of this, the complementary sequence of the primer signal detection region (h) of the single-stranded amplification product (S1) and the probe signal detection region (H) on the probe specifically bind, and then the 3' end extension process of the single-stranded amplification product (S1) is performed, that is, first bind and then extend, so that the probe anchor region (A) plays its role in assisting the first amplification of the single-stranded amplification product (S1) and the probe to bind. In addition, the generation of primer dimers (dimers) during the amplification process can also be effectively avoided. It is worth noting that even if dimers are generated during the amplification process, the signals of the dimers can be distinguished by the melting curve. If the signal is collected at a higher melting temperature, the signal of the dimer will not be collected. The specific method used is: the signal change generated by the double-stranded product formed after the complementary sequence of the primer signal detection region (h) in the single-stranded amplification product (S1) specifically binds to the probe, or the signal change generated by the secondary amplification double-stranded product (double-stranded amplification product formed with the probe) formed after the complementary sequence of the primer signal detection region (h) in the single-stranded amplification product (S1) specifically binds to the probe and extends is different. The different signal changes refer to different signal strengths and / or different melting temperatures.

[0119] In some embodiments, when the primer probe composition contains at least two of the second primers, the sequences of the primer signal detection regions (h) on different second primers are different, the complementary sequences of the primer signal detection regions (h) on different second primers are complementary to the sequences at different positions of the probe signal binding region (H), or the complementary sequences of the primer signal detection regions (h) on different second primers are different from the positions at which the probe signal binding region (H) specifically binds. In some embodiments, the primer probe composition includes a first primer, two or more second primers and a probe. In a specific embodiment, the primer probe composition is F1, R1, R2, R3 and P1. In this scheme, multiple detection can be achieved with only one first primer and a probe. In some embodiments, the primer probe composition includes two or more first primers, two or more second primers and two or more probes. In some embodiments, the primer probe composition includes at least one pair, at least two pairs, at least three pairs, at least four pairs or more pairs of primer pairs. In a specific embodiment, comprise a kind of primer pair, two kinds of primer pairs, three kinds of primer pairs, four kinds of primer pairs, five kinds of primer pairs, six kinds of primer pairs, seven kinds of primer pairs, eight kinds of primer pairs or the more primer pairs that amplification system allows in the described primer probe composition.It will be appreciated by those skilled in the art that different primer pairs are used to increase different target sequences.In some embodiments, comprise at least one, at least two, at least three, at least four or more kinds of probes in the described primer probe composition.In a specific embodiment, comprise one, two, three, four, five, six, seven, eight or the more probes that amplification system allows in the described primer probe composition.One or more probes are used to detect different target sequences.

[0120] As used herein, the terms "one," "two," or "three" refer to the number of probes or primers being used. Different types of probes have different sequences and detection labels; different types of primers have different sequences.

[0121] Wherein, "the sequence of the primer signal detection region (h) on different second primers is different" means that the sequence of the primer signal detection region (h) of different second primers has different bases and / or different lengths, so that different single-stranded pre-amplification products (S1) containing complementary sequences of different primer signal detection regions (h) bind to the probe and extend to form different double-stranded amplification products formed with the probe, and the melting temperature curves of different double-stranded amplification products formed with the probe can be separated from each other. Since the melting temperature of the double-stranded amplification product formed with the probe is detected during the melting curve analysis, the melting temperature of the double-stranded amplification product formed with the probe can be adjusted by adjusting the bases and / or length of the sequence of the primer signal detection region (h).

[0122] In some embodiments, when the primer probe composition contains at least two probes, the sequences of the probe signal detection regions (H) of different probes are different, the sequences of the primer signal detection regions (h) of different second primers are different, and the complementary sequences of different primer signal detection regions (h) and the positions at which the probe signal detection regions (H) specifically bind are different.

[0123] The following is an illustrative example of the nucleic acid detection process of the primer-probe composition of the present application. For example, the target is, for example, a double-stranded target, specifically a single-stranded target chain A and a single-stranded target chain B; wherein, the single-stranded target chain A contains a first target sequence (X1), a second target sequence (X2), and a complementary sequence of a third target sequence (X3); the single-stranded target chain B contains a complementary sequence of the first target sequence (X1), a complementary sequence of the second target sequence (X2), and a third target sequence (X3). The first primer includes a probe anchor region (A) and a first target sequence binding region (X1') from the 5' end to the 3' end; the second primer includes a primer signal detection region (h), a second target sequence binding region (X2'), a primer signal detection region complementary sequence (h'), and a third target sequence binding region (X3') from the 5' end to the 3' end; the probe includes a primer anchor region (A') and a probe signal detection region (H). When the primer-probe composition of the present application is used for nucleic acid detection, in the presence of the target, the second primer binds to the single-stranded target chain B, specifically, the third target sequence binding region (X3') at the 3' end of the second primer specifically binds to the third target sequence (X3) on the single-stranded target chain B; then, using the single-stranded target chain B as a template, the second primer extends the complementary chain of the single-stranded target chain B from its 3' end (also called the amplification product of the second primer and the target sequence); the complementary chain (i.e., the amplification product of the second primer and the target sequence) is obtained by base-pairing with the single-stranded target chain B, and therefore contains the first target sequence (X1) and the second target sequence (X2). When the first primer is present, the first target sequence (X1) on the complementary chain specifically binds to the first target sequence binding region (X1') on the first primer, and the first primer amplifies using the amplification product of the second primer and the target sequence as a template to obtain a single-stranded amplification product (S1). The single-stranded amplification product (S1) includes, from the 5' end to the 3' end, a probe anchor region (A), a first target sequence binding region (X1'), a complementary sequence of the second target sequence (X2) and a complementary sequence (X3") of the third target sequence binding region (X3'), a complementary sequence of the primer signal detection region complementary sequence (h'), a complementary sequence (X2") of the second target sequence binding region (X2'), and a complementary sequence of the primer signal detection region (h).

[0124] In the single-stranded amplification product (S1), the Gibbs free energy of the conformation formed by the specific binding of the complementary sequence of the second target sequence (X2) and the complementary sequence (X2") of the second target sequence binding region (X2') is less than the Gibbs free energy of the conformation formed by the specific binding of the complementary sequence of the primer signal detection region (h) and the complementary sequence of the primer signal detection region complementary sequence (h'); or, the Gibbs free energy of the conformation formed by the specific binding of the complementary sequence of the second target sequence (X2) and the complementary sequence (X2") of the second target sequence binding region (X2') is less than the Gibbs free energy of the conformation formed by the specific binding of the complementary sequence of the primer signal detection region (h) and the complementary sequence (X2") of the second target sequence binding region (X2'). This solution ensures that when the single-stranded amplification product (S1) forms a stem-loop structure, the "stem" is formed after the complementary sequence of the second target sequence (X2) and the complementary sequence (X2") of the second target sequence binding region (X2') are specifically bound.

[0125] Furthermore, in the above amplification process, if it is specific amplification, the obtained single-stranded amplification product (S1) will further form a stem-loop structure. Specifically, there will be two complementary sequences in the single-stranded amplification product (S1), namely: 1) the complementary sequence of the primer signal detection region (h) and the complementary sequence of the primer signal detection region (h') specifically bind to form a stem structure; 2) the complementary sequence of the second target sequence (X2) and the complementary sequence (X2") of the second target sequence binding region (X2') specifically bind to form a stem structure. Therefore, the stem-loop secondary structure formed may have two conformations. In this application, "conformation prediction software or website, etc. that can obtain the secondary conformation of the single-stranded amplification product (S1)" can be exemplified by the ΔG online calculation website: https: / / sg.idtdna.com / calc / analyzer. When performing conformation prediction, the website can be used to predict the conformation of the gene fragment and calculate the Gibbs free energy change of a certain conformation. "Gibbs free energy" The "energy change" is also called Gibbs free energy, also called Gibbs function, which is an important parameter in thermodynamics and was proposed by the famous American physicist and chemist Gibbs in 1876; it is abbreviated as ΔG, and its unit can be kcal / mole. In the present application, the size of ΔG is used to determine the stability of the secondary structure. When performing conformational prediction on the single-stranded amplification product (S1), an optional method is, for example: inputting the base composition of the obtained single-stranded amplification product (S1) into a tool such as a conformation prediction software or a website that can obtain the secondary conformation of the single-stranded amplification product (S1). When the result shows that the single-stranded amplification product (S1) can obtain a stem-loop secondary structure and there is a conformation of the stem-loop structure formed by specific binding of the complementary sequence of the second target sequence (X2) and the complementary sequence (X2") of the second target sequence binding region (X2'), it is the primer probe combination required for nucleic acid detection.

[0126] In the present application, it is hoped that the single-stranded amplification product (S1) has a stem-loop structure formed by the specific binding of the complementary sequence of the second target sequence (X2) and the complementary sequence (X2") of the second target sequence binding region (X2') as the dominant conformation; that is, the conformation of "the complementary sequence of the primer signal detection region (h) and the complementary sequence of the primer signal detection region complementary sequence (h') specifically binding to form a stem structure" almost does not exist or does not exist at all during conformation prediction, which is a result that the present application more hopes to obtain. Therefore, when designing the primer probe, the single-stranded amplification product (S1) formed is selected to be the design result of the stem-loop structure formed by the binding of the second target sequence binding region (X2') and the second target sequence (X2) as the dominant conformation for core analysis. Acid detection. However, at the same time, in the present application, if the conformation prediction of the single-stranded amplification product (S1) is performed, it is predicted that "1) the complementary sequence of the primer signal detection region (h) and the complementary sequence of the primer signal detection region complementary sequence (h') combine to form a stem structure; 2) the complementary sequence of the second target sequence (X2) and the complementary sequence (X2") of the second target sequence binding region (X2') specifically combine to form a stem-loop structure", when the single-stranded amplification product (S1) with the conformation of "the complementary sequence of the second target sequence (X2) and the complementary sequence (X2") of the second target sequence binding region (X2')" is amplified to generate sufficient detection signals, it can also be used for the nucleic acid detection of the present application.

[0127] After the single-stranded amplification product (S1) is formed, the 3' end of the single-stranded amplification product (S1) is in a released state. When the second amplification is performed, if non-specific amplification is performed, the single-stranded amplification product (S1) obtained will not contain the complementary sequence (X2") of the second target sequence binding region (X2') and the complementary sequence of the second target sequence (X2) at the same time. Therefore, the complementary sequence of the second target sequence (X2) and the complementary sequence (X2") of the second target sequence binding region (X2') cannot form a stem-loop structure; however, the complementary sequence of the primer signal detection region (h) and the complementary sequence of the primer signal detection region complementary sequence (h') are still present in the product. These two sequences combine to form a stem-loop structure, which makes the 3' end of the single-stranded amplification product (S1) closed, making it difficult to perform the next amplification that produces a detectable signal change. Therefore, the design of this structure achieves stronger specific amplification. During the second amplification, if the probe comprises a primer anchor region (A') and a probe signal detection region (H) from the 3' end to the 5' end, specific amplification is performed, and the complementary sequence of the primer signal detection region (h) at the 3' end of the single-stranded amplification product (S1) specifically binds to a portion of the sequence of the probe signal detection region (H) on the probe. At this point, amplification is initiated using the probe as a template and the single-stranded amplification product (S1) as a primer. The 3' end of the single-stranded amplification product (S1) is extended by ≥0 bases to the 5' end of the probe, thereby obtaining a double-stranded amplification product formed with the probe. If the probe comprises a primer anchor region (A') and a probe signal detection region (H) from the 5' end to the 3' end, the complementary sequence of the primer signal detection region (h) at the 3' end of the single-stranded amplification product (S1) specifically binds to a portion of the sequence on the probe signal detection region (H) on the probe. Simultaneously, the probe anchor region (A) at the 5' end of the single-stranded amplification product (S1) specifically binds to the primer anchor region (A') at the 5' end of the probe. Similarly, amplification is initiated using the probe as a template and the single-stranded amplification product (S1) as a primer. The 3' end of the single-stranded amplification product (S1) extends, pushing open the double-stranded binding of the probe anchor region (A) and the primer anchor region (A'), and then continues to extend to the 5' end of the probe, thereby obtaining a double-stranded amplification product formed with the probe. The Tm value of the double-stranded amplification product formed with the probe is then detected to achieve detection.

[0128] When multiple target sequences are to be detected simultaneously, the complementary sequences of the primer signal detection regions (h) obtained in the different single-stranded amplification products (S1) are different, for example, the complementary sequences of the primer signal detection regions (h1), the complementary sequences of the primer signal detection regions (h2), etc.; Since the complementary sequences of different primer signal detection regions (h) are respectively bound to different positions of the probe, the length and base composition of the double-stranded amplification products formed with the probe are different, and their Tm values ​​are different, thereby realizing multiple detection. It should be understood that in the present application, when the entire sequence of the primer signal detection region (h) and the probe signal detection region (H) are the same, a probe can only bind to one target sequence; when the partial sequence of the primer signal detection region (h) and the probe signal detection region (H) are the same, a plurality of primer signal detection regions (h) can be designed, and then the complementary sequences of the primer signal detection regions (h) on the different chain amplification products (S1) are respectively specifically bound to the sequences at different positions of the probe signal detection region (H), so that a probe can realize the simultaneous detection of multiple targets. By designing primer signal detection regions (h) and probe signal detection regions (H) of different lengths and / or base compositions, the length and / or base composition of the double-stranded amplification products finally obtained and formed with the probe are different, so as to distinguish different target sequences by detecting the Tm values ​​of different products. Therefore, the method of the present application can achieve simultaneous detection of multiple target sequences using only one probe. In addition, the number of newly added probes can further increase the number of targets detected simultaneously.

[0129] In addition, when the primer-probe combination of the present application is used for detection, its fluorescence changes are as follows: when there is no target sequence, the probe is single-stranded, and the distance between the first detection group and the second detection group on the probe is close, and no detectable signal change is generated; when the target sequence is present, the probe and the first primer bind to each other, so that the distance between the first detection group and the second detection group on the probe becomes larger, thereby generating a detectable signal change.

[0130] Specifically, before the second specific amplification, when the probe is not bound to the single-stranded amplification product (S1), the probe is single-stranded, and because the probe molecule is flexible and curled, the distance between the first detection group modified on the probe and the second detection group is close, and no detectable signal is generated; after starting the second specific amplification, when the probe is bound to the single-stranded amplification product (S1), a double chain is formed, and the distance between the first detection group modified on the probe and the second detection group becomes larger, resulting in a detectable signal change, and then detected by the instrument. And using the probe as a template, after the single-stranded amplification product (S1) is used as a primer for specific amplification (i.e., the second specific amplification), the double-stranded amplification product formed with the probe is obtained. After the second specific amplification ends, melting curve analysis is performed, and in the process of temperature change, the double-stranded amplification product formed with the probe will be melted to a single chain at a certain temperature, and now the distance between the first detection group and the second detection group changes, generating a signal (such as changing from having a fluorescent signal to having no fluorescent signal or the fluorescent signal weakening, etc.), which can be detected by the instrument; the detection of the target sequence is finally achieved by measuring the Tm value of the double-stranded amplification product formed with the probe. By adjusting the sequence composition and length of the primer signal detection region (h) on the second primer, or its complementary position with the probe signal detection region (H) of the probe, the Tm value of the double-stranded amplification product formed with the probe can be adjusted, thereby achieving multiple detection.

[0131] In some embodiments, the lengths of the first, second, third, fourth, and fifth linker sequences are each independently 0-20, 1-20, 5-20, 5-15, 10-15, or any length range within the range of 0-20 bases. In a specific embodiment, the lengths of the first, second, third, fourth, and fifth linker sequences are each independently 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or any length within the range of 0-20 bases.

[0132] In some embodiments, the length of the first primer and the second primer is each independently 15-80, 20-50, 20-35, 35-70, 45-70, 55-65 or any length range within the range of 15-80 bases. In a specific embodiment, the length of the first primer and the second primer is each independently 15, 18, 20, 23, 25, 27, 30, 33, 35, 38, 40, 42, 45, 48, 50, 53, 55, 58, 60, 62, 65, 68, 70, 72, 75, 78, 80 or any length within the range of 15-80 bases.

[0133] In some embodiments, the Tm values ​​of the first target sequence binding region (X1') and the third target sequence binding region (X3') are each independently 40-80° C., 50-70° C., 60-80° C., 70-80° C., or any temperature range within the range of 40-80° C. In a specific embodiment, the Tm values ​​of the first target sequence binding region (X1') and the third target sequence binding region (X3') are each independently 40, 45, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, or any temperature within the range of 40-80° C. In some embodiments, the GC content of the third target sequence binding region (X3') is any range within the range of 20-80%, 30-70%, 50-80%, 60-80%, 70-80%, 60-70%, 50-70%, 40-70%, 40-60%, 50-60%, 40-50% or 20-80%. In some embodiments, the length of the first target sequence binding region (X1') is any range within the range of 15-45, 15-25, 15-35, 25-45, 25-35, 35-45 or 15-45 bases. In a specific embodiment, the length of the first target sequence binding region (X1') is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45 or any length within the range of 15-45 bases. In some embodiments, the length of the third target sequence binding region (X3') is any range of lengths within the range of 5-65, 5-15, 5-25, 5-35, 5-45, 5-55, 15-25, 15-35, 15-45, 5-55, 15-65, 25-35, 25-45, 25-55, 25-65, 35-45, 35-55, 35-65, 45-55, 45-65, 55-65 or 5-65 bases. In a specific embodiment, the length of the third target sequence binding region (X3') is 5, 7, 10, 13, 15, 18, 20, 22, 25, 27, 30, 33, 35, 37, 40, 43, 45, 48, 50, 52, 55, 57, 60, 62, 64, 65 or any length within the range of 5-65 bases.

[0134] In some embodiments, the length of the primer signal detection region (h) and the primer signal detection region complementary sequence (h') are each independently 5-65, 15-25, 15-35, 15-45, 5-55, 25-45, 25-55, 25-65, 35-45, 35-65, 45-65, 55-65 or any length range within the range of 5-65 bases. In a specific embodiment, the length of the primer signal detection region (h) and the primer signal detection region complementary sequence (h') are each independently 5, 7, 10, 13, 15, 18, 20, 22, 25, 27, 30, 33, 35, 37, 40, 43, 45, 48, 50, 52, 55, 57, 60, 62, 64, 65 or any length within the range of 5-65 bases. In some embodiments, the Tm values ​​of the primer signal detection region (h) and the primer signal detection region complementary sequence (h') are each independently any temperature range within the range of 30-80°C, 40-70°C, 50-70°C, 40-60°C or 30-80°C. In a specific embodiment, the Tm values ​​of the primer signal detection zone (h) and the primer signal detection zone complementary sequence (h') are each independently 30, 35, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80 or any temperature in the range of 30-80°C. In some embodiments, the GC content of the primer signal detection region (h) and the primer signal detection region complementary sequence (h') are each independently any range within the range of 20-80%, 50-80%, 50-70%, 40-60%, 50-60%, 40-50% or 20-80%.

[0135] In some embodiments, the length of the second target sequence binding region (X2') is 5-65, 15-45, 15-65, 25-35, 25-45, 35-45, 45-55, 55-65 or any length range within the range of 5-65 bases. In a specific embodiment, the length of the second target sequence binding region (X2') is 5, 7, 10, 13, 15, 18, 20, 22, 25, 27, 30, 33, 35, 37, 40, 43, 45, 48, 50, 52, 55, 57, 60, 62, 64, 65 or any length within the range of 5-65 bases. In some embodiments, the Tm value of the second target sequence binding region (X2') is 40-80° C., 40-70° C., 60-70° C., 50-60° C., 40-50° C., or any temperature range within the range of 40-80° C. In a specific embodiment, the Tm value of the second target sequence binding region (X2') is 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, or any temperature within the range of 40-80° C. In some embodiments, the GC content of the second target sequence binding region (X2') is any range within the range of 40-80%, 60-70%, 50-70%, 50-60%, 40-50% or 40-80%.

[0136] In some embodiments, the probe is 20-100 bases in length; in a specific embodiment, the probe is 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or any length within the range of 20-100 bases in length.

[0137] In some embodiments, the lengths of the probe anchor region (A) and the primer anchor region (A') are each independently 5-35, 5-15, 5-25, 10-20, 10-30, 15-25, 15-35, 25-35, or any length range within the range of 5-35 bases. In a specific embodiment, the lengths of the probe anchor region (A) and the primer anchor region (A') are each independently 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or any length within the range of 5-35 bases. 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 82, 84, 85, or any temperature within the range of 40-85°C. 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, or any temperature in the range of 40-80°C. In some embodiments, the GC content of the primer anchor region (A') is independently any range within the range of 20-80%, 50-80%, 60-80%, 40-70%, 40-60%, 50-60%, 40-50%, or 20-80%. In some embodiments, the GC content of the probe anchor region (A) is independently any range within the range of 30-80%, 50-80%, 60-70%, 50-70%, 40-70%, 40-60%, 50-60%, 40-50%, or 30-80%.

[0138] In some embodiments, the length of the probe signal binding region (H) is any length range within the range of 5-65, 15-45, 25-35, 25-45, 25-55, 35-55, 45-55 or 5-65 bases. In a specific embodiment, the length of the probe signal binding region (H) is 5, 7, 10, 13, 15, 18, 20, 22, 25, 27, 30, 33, 35, 37, 40, 43, 45, 48, 50, 52, 55, 57, 60, 62, 64, 65 or any length within the range of 5-65 bases. In some embodiments, the Tm value of the probe signal binding region (H) is any temperature range within the range of 30-85°C, 60-70°C, 50-60°C, 40-50°C or 30-85°C. In a specific embodiment, the Tm value of the probe signal binding region (H) is 30, 35, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 85 or any temperature in the range of 30-85°C. In some embodiments, the GC content of the probe signal binding region (H) is any range within the range of 20-80%, 50-80%, 60-80%, 70-80%, 60-70%, 50-70%, 40-70%, 40-60%, 50-60%, 40-50% or 20-80%.

[0139] In some embodiments, the first detection group and the second detection group modified on the probe produce a detectable signal change by a change in distance. The generation of the signal change includes, but is not limited to, relying on fluorescence quenching (static or dynamic mechanism), fluorescence resonance energy transfer (FRET) and / or monomer-excimer emission switching with a pyrene fluorophore. Energy transfer, quenching and excimer formation processes are distance-dependent, so the structural rearrangement of the probe upon binding to the target changes the distance between the attached fluorophores, which should result in a change in the system signal.

[0140] In some embodiments, the first detection group is a fluorescent reporter group, and the second detection group is a fluorescence quencher group or a group that generates a fluorescent signal by fluorescence resonance energy transfer with the fluorescent reporter group. Exemplary, optional fluorescent reporter groups include, but are not limited to, any one or more of ALEX-350, FAM, VIC, TET, CAL FluorGold540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, Cy3, Cy5, Cy5.5, and Quasar 705; the fluorescence quencher group includes, but is not limited to, any one or more of DABCYL, BHQ (such as BHQ-1 or BHQ-2), ECLIPSE, and TAMRA. In some embodiments, the distance between the fluorescent reporter group and the fluorescent reporter group is any distance range within the range of 3-250 angstroms, 3-201 angstroms, 3-140 angstroms or 3-250 angstroms. It should be noted that in the present application, there is no special restriction on the positions of the first detection group and the second detection group on the probe, and they can be modified at any position of the probe. In addition, the modification order of the first detection group and the second detection group on the probe is also not restricted. The first detection group can be modified first along the 5' end to the 3' end of the probe, and then the second detection group can be modified; or the second detection group can be modified first along the 5' end to the 3' end of the probe, and then the first detection group can be modified. In some embodiments, when the probe includes a primer anchor region (A') and a probe signal detection region (H) from the 5' end to the 3' end, the first detection group and the second detection group are modified between the primer anchor region (A') and the probe signal detection region (H). In some embodiments, when the probe includes a primer anchor region (A') and a probe signal detection region (H) from the 3' end to the 5' end, the first detection group and the second detection group are modified at the 5' end of the probe signal detection region (H). In some embodiments, at least one detection group is modified at the 5' end of the probe signal detection region (H) of the probe. In some embodiments, alternatively, at least one detection group is modified within the probe signal detection region (H) of the probe.

[0141] The present application provides a primer-probe system for detection, which includes the above-mentioned primer-probe composition.

[0142] The present application also provides a nucleic acid detection method, comprising contacting a target sample with the above-mentioned primer-probe composition, performing at least two amplifications, and analyzing whether a target is present; wherein the target sample includes a target sequence.

[0143] After the amplification is completed, a melting curve analysis is performed. During the temperature change process, the double-stranded amplification product formed with the probe (i.e., the double-stranded amplification product of the second amplification) will melt at a certain temperature. At this time, the probe with the first detection group and the second detection group will change from a double-stranded state to a single-stranded state, causing the distance between the detection groups to change, generating a signal that can be detected by the instrument. The signal detected by the instrument presents a melting curve as the temperature changes. When the Tm value of the peak position of the melting curve is within the characteristic Tm value range of the specific detection channel of the target, it indicates that the target is contained in the sample to be tested; the specific detection channel is the fluorescent channel corresponding to the first detection group on the probe, and the characteristic Tm value is the melting temperature of the double-stranded amplification product formed with the probe.

[0144] In this application, "double amplification" refers to the first amplification in the PCR reaction process, in which "the primer and the target specifically bind to form a single-stranded pre-amplification product", and the second amplification in which "the single-stranded pre-amplification product specifically binds to the probe and amplifies". The two amplifications can be performed in the same PCR reaction program, that is, the denaturation temperature, annealing temperature and extension temperature used in the two amplifications are the same.

[0145] In the present application, the primer-probe combination comprises multiple sets of first primers and second primers for different targets. When performing a multiplex PCR assay using the primer-probe combination, different targets can be identified by fluorescence channels or by melting temperature. For example, when different targets are identified by fluorescence channels, different probes can be used for different targets. When different targets are identified by melting temperature, different target sequences can share the same probe.

[0146] In this application, there are no particular limitations on the target sample, as long as it contains the target sequence. In some embodiments, the target sample is a cell, tissue, organ, or individual obtained from a living or non-living organism, and the target sample only needs to contain the target sequence. In some embodiments, the target sample is a nucleic acid sample obtained from, including but not limited to, whole blood, plasma, serum, cerebrospinal fluid, urine, feces, cells, or tissues.

[0147] The methods described herein are applicable to any suitable cell type. In some embodiments, the cells include, but are not limited to, bacteria, fungal cells, prokaryotes, protozoa, plant cells, or animal cells; in some embodiments, the fungal cells are, for example, yeast cells; the animal cells are, for example, mammalian cells, such as human cells. In some embodiments, the cells are of natural origin, such as cells isolated from a tissue biopsy. In some embodiments, the cells are cells isolated from a cell line cultured in vitro. In some embodiments, the cells are from a primary cell line. In some embodiments, the cells are from an immortalized cell line. In some embodiments, the cells are genetically engineered cells.

[0148] In some embodiments, the source of the target sample includes any one or more of bacteria, viruses, and pathogens. The method of the present application is applicable to target samples derived from various types of bacteria, viruses, and pathogens. In some embodiments, the virus is a genetically engineered virus, a wild-type virus, and / or a modified virus. The method of the present application is applicable to various types of target samples, illustrative of which are serum samples, plasma samples, whole blood samples, sputum samples, swab samples, lavage fluid samples, fresh tissue samples, and formalin-fixed paraffin-embedded tissue (FFPE).

[0149] In some embodiments, the amplifying comprises the steps of:

[0150] The reaction system is randomly divided into more than 500 reaction units, each reaction unit containing one target of the sample to be tested or no target of the sample to be tested;

[0151] And / or, performing PCR amplification on all reaction units.

[0152] In some embodiments, the detection method is a digital PCR detection method.

[0153] In some embodiments, the reaction system is randomly distributed into 500 to 20,000 reaction units, and each reaction unit contains one target of the sample to be tested or does not contain the target of the sample to be tested.

[0154] In some embodiments, analyzing whether a target is present comprises the steps of:

[0155] Obtaining the signal changes generated after amplification, and judging whether the target is present in the sample to be tested based on the signal changes;

[0156] And / or, the amplified product is heated, and whether the sample to be tested contains the target is determined based on the signal changes before and after the heating.

[0157] In some embodiments, analyzing whether a target is present comprises the steps of:

[0158] Obtaining the signal changes generated after amplification, and judging whether the target is present in the sample to be tested based on the signal changes;

[0159] And / or, performing melting curve analysis on the amplified product to determine whether the sample to be tested contains the target.

[0160] In the present application, PCR can be used for sequence amplification.

[0161] In some embodiments, PCR includes: denaturation after pre-denaturation, annealing, and extension. In some embodiments, the temperature during pre-denaturation is 90-96°C, 90-92°C, 90-94°C, 92-94°C, 92-96°C, 94-96°C, or any temperature range within the range of 90-96°C; in one embodiment, the temperature during pre-denaturation is 90°C, 91°C, 92°C, 93°C, 94°C, 95°C, 96°C, or any temperature within the range of 90-96°C. In some embodiments, the pre-denaturation time is 2-15 minutes, 5-15 minutes, 8-15 minutes, 12-15 minutes, 2-10 minutes, 2-8 minutes, 2-5 minutes, 8-12 minutes, 5-12 minutes, 12-15 minutes, or any time range within the range of 2-15 minutes. In one embodiment, the pre-denaturation time is any time within the range of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 minutes.

[0162] In some embodiments, the temperature during denaturation is 90-95° C., 90-92° C., 92-95° C., or any temperature range within the range of 90-95° C. In one embodiment, the temperature during preliminary denaturation is 90° C., 91° C., 92° C., 93° C., 94° C., 95° C., or any temperature within the range of 90-95° C. In some embodiments, the denaturation time is 10-60 seconds, 10-50 seconds, 10-40 seconds, 10-30 seconds, 10-20 seconds, 20-30 seconds, 20-40 seconds, 20-50 seconds, 20-60 seconds, 30-40 seconds, 30-50 seconds, 30-60 seconds, 40-50 seconds, 40-60 seconds, 50-60 seconds, or any time range within the range of 10-60 seconds. In one embodiment, the denaturation time is any time within the range of 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 seconds.

[0163] In some embodiments, the annealing temperature is 50-75° C., 50-60° C., 50-70° C., 55-65° C., 55-75° C., 60-70° C., 65-75° C., or any temperature range within the range of 50-75° C. In one embodiment, the annealing temperature is 50° C., 52° C., 54° C., 56° C., 58° C., 60° C., 62° C., 64° C., 66° C., 68° C., 70° C., 72° C., 74° C., or any temperature within the range of 50-75° C. In some embodiments, the annealing time is 30-90 seconds, 30-50 seconds, 40-80 seconds, 50-80 seconds, 60-70 seconds, or any time range within the range of 30-90 seconds. In one embodiment, the annealing time is 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or any time in the range of 30-90 seconds.

[0164] In some embodiments, PCR is performed with a cycle number of 35-50, 35-40, 35-45, 40-45, 40-50, 45-50, or any range within the range of 35-50; illustratively, the cycle number is 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.

[0165] In some embodiments, the PCR comprises: pre-denaturation at 90-96°C for 5-15 minutes, denaturation at 90-95°C for 10-60 seconds, annealing and extension at 50-75°C for 30-90 seconds, for 35-50 cycles; melting curve analysis at 35-95°C with a heating rate of 0.05°C / s, and fluorescence signal acquisition. Exemplarily, the PCR comprises: pre-denaturation at 95°C for 2 minutes; denaturation at 94°C for 10 seconds, annealing and extension at 56°C for 30 seconds, for a total of 45 cycles; melting curve analysis at 40-95°C with a heating rate of 0.05°C / s, and fluorescence signal acquisition.

[0166] In some embodiments, the concentration of the first primer in the reaction system is 30-1000nM, 30-100nM, 100-300nM, 100-500nM, 300-500nM, 300-600nM, 300-800nM, 300-1000nM, 50-800nM or any concentration range within the range of 30-1000nM; in one embodiment, the concentration of the first primer in the reaction system is 30nM, 100nM, 300nM, 350nM, 400nM, 450nM, 500nM, 550nM, 600nM, 650nM, 700nM, 750nM, 800nM, 900nM, 1000nM or any concentration range within the range of 30-1000nM.

[0167] In some embodiments, the concentration of the second primer in the reaction system is 30-500nM, 30-50nM, 50-100nM, 50-150nM, 50-200nM, 50-300nM, 50-400nM, 100-500nM, 300-500nM, or any concentration range within the range of 30-500nM; in one embodiment, the concentration of the second primer in the reaction system is 30nM, 50nM, 80nM, 100nM, 150nM, 200nM, 250nM, 300nM, 350nM, 400nM, 450nM, 500nM, or any concentration within the range of 30-500nM.

[0168] In some embodiments, the concentration of the probe in the reaction system is 100-1200nM, 150-250nM, 150-400nM, 150-650nM, 150-800nM, 150-1000nM, 150-1200nM, 250-650nM, 300-500nM or any concentration range within the range of 100-1200nM; in one embodiment, the concentration of the probe in the reaction system is 100nM, 150nM, 200nM, 250nM, 300nM, 350nM, 400nM, 450nM, 500nM, 600nM, 700nM, 800nM, 900nM, 1000nM, 1200nM or any concentration within the range of 150-1200nM.

[0169] In some embodiments, the concentration of the first primer is 30-1000 nM, the concentration of the second primer is 30 nM-500 nM, and the concentration of the probe is 150-1200 nM. In a specific embodiment, the concentration of the first primer is 500 nM, the concentration of the second primer is 100 nM, and the concentration of the probe is 400 nM.

[0170] The present application provides an application of the above primer-probe composition and / or the above primer-probe system, wherein the application includes preparing a product for nucleic acid detection and / or nucleic acid detection;

[0171] Preferably, the nucleic acid detection product is related to a disease;

[0172] More preferably, the disease is papilloma.

[0173] As will be appreciated by those skilled in the art, the detection method of the present application is applicable to any type of disease detection.Target can be selected from at least one of papillomavirus, adenovirus (Adenovirus, ADV), influenza B virus (Influenza A virus, IBV), mycoplasma pneumoniae (Mycoplasma pneumoniae, MP), 2019 novel coronavirus (SARS-CoV-2), respiratory syncytial virus (Respiratory Syncytial Virus, RSV), influenza A virus (Influenza A virus, IAV) and non-small cell lung cancer etc. Papillomavirus can be exemplarily human papillomavirus HPV16 type, human papillomavirus HPV18 type, human papillomavirus HPV56 type, human papillomavirus HPV58 type.

[0174] The application also provides a nucleic acid detection kit, comprising the above-mentioned primer-probe composition and / or the above-mentioned primer-probe system. In some embodiments, the kit also includes an amplification reagent. In some embodiments, the amplification reagent includes DNA polymerase and dNTPs. In some embodiments, when the nucleic acid template is RNA, the amplification reagent also includes a reverse transcriptase. In some embodiments, the amplification reagent also includes a reagent that can promote PCR reaction, such as KCl, MgCl2, Tris-HCl, dithiothreitol (DTT), (NH4)2SO4, etc. Example

[0175] Specific embodiments of the present application will be described in more detail below with reference to the accompanying drawings. Although specific embodiments of the present application are shown in the accompanying drawings, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments described herein. Rather, these embodiments are provided to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0176] Example 1. Primer pairs and primer-probe compositions for single-plex detection of human papillomavirus HPV type 16

[0177] The primer pairs involved in this embodiment are as follows:

[0178] Primer F1, 5' to 3' direction:

[0179] TGTGGTGGGAAAGAGAACCTGAAACATTGCAGTTCTCTTTTGGTGC, SEQ ID NO: 2; wherein, the TGTGGTGGGAAAGAG starting from the 5' end is the probe anchor region (A), and the remaining part AACCTGAAACATTGCAGTTCTCTTTTGGTGC is the first target sequence binding region (X1').

[0180] Primer R1, 5' to 3' direction:

[0181] CGATCGCCAAAGGGCGTAACCGAAATCGGTTGAACC, SEQ ID NO: 3; wherein, the CGATCGCC starting from the 5' end is the primer signal detection region (h), the AAA after the primer signal detection region (h) is the linker sequence, and the GGGCGTAACCGAAATCGGTTGAACC after the linker sequence is the third target sequence binding region (X3').

[0182] Primer R2, 5' to 3' direction:

[0183] CGATCGCCCTGCTTTTATACTAACCGGGGCGATCGGGGCGTAACCGAAATCGGTTGAACC, SEQ ID NO: 4; wherein, CGATCGCC starting from the 5' end is the primer signal detection region (h), CTGCTTTTATACTAACCGG after the primer signal detection region (h) is the second target sequence binding region (X2'), GGCGATCG after the second target sequence binding region (X2') is the primer signal detection region complementary sequence (h'), and GGGCGTAACCGAAATCGGTTGAACC after the primer signal detection region complementary sequence (h') is the third target sequence binding region (X3'). The primer signal detection region (h) in primer R2 spontaneously binds to the complementary sequence (h') to form a primary stem-loop structure. The Gibbs free energy change of the secondary structure when this primary stem-loop structure is stable (i.e., in the dominant conformation) is calculated as ΔG1. The ΔG1 value is -18.04 kcal / mole, indicating the most dominant conformation. Exemplary ΔG values ​​for different secondary structures can be obtained through the ΔG online calculation website: https: / / sg.idtdna.com / calc / analyzer.

[0184] Primer R3, 5' to 3' direction:

[0185] CCGGTTAGCTGCTTTTATACTAACCGGAAAGGGCGTAACCGAAATCGGTTGAACC, SEQ ID NO: 5; wherein, CGATCGCC starting from the 5' end is the primer signal detection region (h), CTGCTTTTATACTAACCGG after the primer signal detection region (h) is the second target sequence binding region (X2'), AAA after the second target sequence binding region (X2') is the linker sequence, and GGGCGTAACCGAAATCGGTTGAACC after the linker sequence is the third target sequence binding region (X3').

[0186] The primer-probe combination involved in this embodiment includes the above-mentioned primer pair and probe P, as shown below:

[0187] Probe P, 5' to 3' direction:

[0188] CTCTTTCCCACCACATTTAGCCGACCGTAGTCCGGTTAGCCTAACCGGCGATCGCC, SEQ ID NO: 1; wherein, CTCTTTCCCACCACA starting at the 5' end is the primer anchor region (A'), and the remaining portion after the primer anchor region (A') is the probe signal detection region (H). The CGATCGCC at the 3' end of the probe signal detection region (H) of this probe is identical to the sequence of the primer signal detection region (h) of primers R2 and R1; the CCGGTTAG adjacent to CGATCGCC at the 3' end of the probe signal detection region (H) of this probe is identical to the sequence of the primer signal detection region (h) of primer R3. The probe modifications are: T16-CY5, T28-BHQ2 (starting from the 5' end, the 16th base T is modified with CY5; the 28th base T is modified with BHQ2).

[0189] When the pathogen target is specifically amplified, the forward primer F1 and the reverse primer (primer R1 or R2 or R3) amplify the target nucleic acid to obtain a double-stranded preamplifier product. A single-stranded amplification product (S1) obtained by amplification with primer R2 includes, from its 5' end to its 3' end, a probe anchor region (A), a first target sequence binding region (X1'), a complementary sequence of the second target sequence (X2), a complementary sequence of the third target sequence binding region (X3'), a complementary sequence of the primer signal detection region complementary sequence (h'), a complementary sequence of the second target sequence binding region (X2'), and a complementary sequence of the primer signal detection region (h); the complementary sequence (X2") of the second target sequence binding region (X2') and the complementary sequence of the second target sequence (X2) in the single-stranded amplification product (S1) spontaneously bind to form a second stem-loop structure. The Gibbs free energy change of the secondary structure when the second stem-loop structure is stable is calculated as ΔG2, and the ΔG2 value is -32.98 kcal / mole, which is the most dominant conformation. Exemplary ΔG values ​​for different secondary structures can be obtained through the ΔG online calculation website: https: / / sg.idtdna.com / calc / analyzer.

[0190] The probe signal detection region (H) of probe P specifically binds to the complementary sequence of the primer signal detection region (h) of one of the single-stranded amplification products (S1), and the primer anchor region (A') of probe P complementarily pairs with the probe anchor region (A) at the 5' end of the single-stranded amplification product (S1). After the amplification is completed, a melting curve analysis is performed. During the temperature change process, the double-stranded product formed by probe P and the single-stranded amplification product (S1) will melt at a certain temperature. At this time, the probe P with the first detection group and the second detection group will become a single-stranded state, causing the fluorescent signal to change and can be detected by the instrument.

[0191] Example 2. Human papillomavirus HPV type 16 single-plex detection system and method

[0192] The human papillomavirus HPV type 16 single-plex detection system includes the primer-probe combination of Example 1, a template, a DNA polymerase, an UDG enzyme, and a reaction buffer (the specific PCR reaction system is shown in Table 1), and performs target-specific amplification and fluorescence signal detection.

[0193] The detection method includes the following steps:

[0194] (1) First, in the PCR amplification reaction cycle, the forward primer F1 and the reverse primer (R1 or R2 or R3) can specifically amplify the target nucleic acid sequence to obtain a single-stranded amplification product (S1); the single-stranded amplification product (S1) specifically binds to the probe P and extends ≥0 bases to form a double-stranded amplification product.

[0195] (2) After the PCR amplification is completed, a melting curve analysis is performed. The double-stranded product formed by the probe P and the single-stranded amplification product (S1) will melt at a certain temperature. At this time, the probe (P1) with the first detection group and the second detection group will become a single-stranded state, causing the fluorescent signal to change and can be detected by the instrument.

[0196] The reaction system in this embodiment is shown in Table 1:

[0197] Table 1 PCR reaction system

[0198] The reaction conditions for PCR in this embodiment are pre-denaturation at 95°C for 2 minutes; denaturation at 94°C for 10 seconds, annealing and extension at 56°C for 30 seconds, for a total of 45 cycles; melting curve analysis at 40-95°C with a heating rate of 0.05°C per second, and fluorescence signal acquisition.

[0199] In this example, the reaction buffer and primer-probe premix were mixed according to the reaction system described in Table 1. The nucleic acid template to be tested was a human papillomavirus (HPV) 16 plasmid synthesized by General Biotechnology (Anhui) Co., Ltd., quantified and diluted, and then mixed with the reaction system at 50 copies / reaction. A no-template control (NTC) was also set up, in which ultrapure water or 1X TE buffer was used instead of the nucleic acid template. PCR amplification and melting curve analysis were then performed. The presence of HPV 16 in the sample was determined based on the characteristic Tm value of the target in a specific detection channel.

[0200] For testing, this example utilizes a SLAN real-time fluorescence quantitative PCR instrument and reagents and consumables from Shanghai Hongshi Medical Technology Co., Ltd. The 2X PCR Reaction Buffer includes: 3mM MgCl2, 30mM Tris-HCl (pH 8.3), 0.5mM dNTPs, 70mM (NH4)2SO4, etc. The test results from the kit described in this example were analyzed using the SLAN real-time fluorescence quantitative PCR analysis software from Shanghai Hongshi Medical Technology Co., Ltd., compatible with the instrument.

[0201] The results were interpreted by the Tm value of the melting curve. In the PCR reaction system, except for the reverse primer, the other components used in Figures 1 to 3 (eg, probe, forward primer, etc.) were the same.

[0202] Figure 1 shows the melting curves of the amplified products using the reverse primer (R1). The higher melting peak is the melting curve obtained with the HPV16 plasmid as the nucleic acid template, while the lower melting peak is the melting curve obtained with the no-template control (NTC). As can be seen in Figure 1, false-positive melting peaks also appear in the no-template control wells, aligning with the melting peak with a Tm of approximately 80°C in the CY5 channel of the positive reaction wells containing the HPV16 plasmid. This suggests that using a primer structure similar to that of reverse primer R1 can easily lead to false-positive results.

[0203] Figure 2 shows the melting curves of the amplified products using reverse primer (R2). The melting peak is for the HPV16 plasmid used as the nucleic acid template, while the peak is for the no-template control (NTC). Figure 2 shows that the positive reaction wells containing the HPV16 plasmid exhibit a melting peak with a Tm of 79.5°C in the CY5 channel, while the no-template control wells exhibit no melting peak. This indicates that using a primer structure similar to reverse primer R2 can avoid the problem of false positives.

[0204] Figure 3 shows the melting curves of the amplified products using reverse primer (R3). The melting peak is for the HPV16 plasmid used as the nucleic acid template, while the peak is for the no-template control (NTC). Figure 3 shows that the positive reaction wells containing the HPV16 plasmid exhibit a melting peak with a Tm of 57°C in channel CY5, while the no-template control wells exhibit no melting peak. This indicates that using a primer structure similar to reverse primer R2 can avoid the problem of false positives.

[0205] In addition, from Figures 2 and 3 , it can be seen that reverse primers R2 and R3 have the same target sequence binding region (GGGCGTAACCGAAATCGGTTGAACC), but their primer signal detection regions are different (CGATCGCCC for R2 and CCGGTTAG for R3). This results in the single-stranded amplification products formed by the two having different specific binding positions with the same probe P1, resulting in obvious differences in the Tm values ​​of the melting peaks (79.5°C in Figure 2 and 57°C in Figure 3).

[0206] Example 3. Multiplex detection system and method

[0207] This example performs multiplex detection for human papillomavirus types HPV16, HPV18, HPV56, and HPV58. The primers and probes involved are as follows (5' to 3' direction):

[0208] Primers:

[0209] PF1 / HPV16: GCGCCGCTCGCGGGCGTAACCGAAATCGGTTGAACCGAAACCGG, SEQ ID NO: 6; wherein, the GCGCCGCTCGC starting from the 5' end is the probe anchor region (A).

[0210] PR1 / HPV16: ACGGCGATGCAGACATTTTATGCACCAAAAGAATCGCCGTCGCTCCTGTGGGTCCTGAAACATTGCA, SEQ ID NO: 7; wherein, ACGGCGA starting from the 5' end is the primer signal detection region (h), and TCGCCGT starting from the 34th base of the 5' end is the primer signal detection region complementary sequence (h').

[0211] PF2 / HPV18: GCGCCGCTCGCCACAATACTATGGCGCGCTTTGAGGATCC, SEQ ID NO: 8; wherein, the GCGCCGCTCGC starting from the 5' end is the probe anchor region (A).

[0212] PR2 / HPV18: TCGCTACTAACACGGCGACCCTACAAGCTACCTGTAGTAGCGAGCAGTGAAGTGTTCAGTTCCGTGCACA, SEQ ID NO: 9; wherein, TCGCTACT starting from the 5' end is the primer signal detection region (h), and TCGCCGT starting from the 36th base of the 5' end is the primer signal detection region complementary sequence (h').

[0213] PF3 / HPV56: GCGCCGCTCGCTGTGGACATATCCATGGAGCCACAATTCAA, SEQ ID NO: 10; wherein, the GCGCCGCTCGC starting from the 5' end is the probe anchor region (A).

[0214] PR3 / HPV56: AGCGCGATTCCACAGGAACGTCCACGAAGCCTATCGCGCTCAATTAAAGGTATTTCTAATACCTCACTCAAGTGG, SEQ ID NO: 11; wherein, AGCGCGA starting from the 5' end is the primer signal detection region (h), and TCGCGCT starting from the 34th base of the 5' end is the primer signal detection region complementary sequence (h').

[0215] PF4 / HPV58: GCGCCGCTCGCTGGTAGGCTACTGCAGGACTATGTTCC, SEQ ID NO: 12; wherein, the GCGCCGCTCGC starting from the 5' end is the probe anchor region (A).

[0216] PR4 / HPV58: TCGTACGGGGACGCAGAGGAGAAACCACGGACCCGTACGATCTCCAACGCCTGACACAAATCATGCA, SEQ ID NO: 13; wherein, TCGTACGG starting from the 5' end is the primer signal detection region (h), and CCGTACGA starting from the 33rd base of the 5' end is the primer signal detection region complementary sequence (h').

[0217] Probe PB: GCGAGCGGCGCTACGGCGATCGCTACTAGCGCGATCGTACGG (modifications: T12-FAM, T20-BHQ1), SEQ ID NO: 14. The GCGAGCGGCGC at the 5' end of the probe is the primer anchor region (A'), and the rest of the probe after the primer anchor region (A') is the probe signal detection region (H); wherein, the ACGGCGA after the primer anchor region (A') is consistent with the primer signal detection region (h) sequence in PR1 / HPV16; the subsequent TCGCTACT is consistent with the primer signal detection region (h) sequence in PR2 / HPV18; the subsequent AGCGCGA is consistent with the primer signal detection region (h) sequence in PR3 / HPV56; and the final TCGTACGG is consistent with the primer signal detection region (h) sequence in PR4 / HPV58.

[0218] The human papillomavirus multiplex detection system of this embodiment includes the above-mentioned primer-probe combination, template, DNA polymerase, UDG enzyme and reaction buffer (the specific PCR reaction system is shown in Table 2) to perform target specific amplification and fluorescence signal detection.

[0219] The detection method includes the following steps:

[0220] (1) First, within the PCR amplification reaction cycle, after amplification, a single-stranded amplification product (S1) is obtained; after the single-stranded amplification product (S1) specifically binds to the probe P and extends ≥0 bases, a double-stranded amplification product is formed.

[0221] (2) After the PCR amplification is completed, a melting curve analysis is performed. The double-stranded product formed by the probe P and the single-stranded amplification product (S1) will melt at a certain temperature. At this time, the probe (P1) with the first detection group and the second detection group will become a single-stranded state, causing the fluorescent signal to change and can be detected by the instrument.

[0222] The reaction system in this embodiment is shown in Table 2:

[0223] Table 2 PCR reaction system

[0224] The reaction conditions for PCR in this embodiment are pre-denaturation at 95°C for 2 minutes; denaturation at 94°C for 10 seconds, annealing and extension at 56°C for 30 seconds, for a total of 45 cycles; melting curve analysis at 51-95°C with a heating rate of 0.05°C per second, and fluorescence signal acquisition.

[0225] In this embodiment, the reaction buffer and the primer probe premix are mixed according to the reaction system described in Table 2. The nucleic acid template to be tested is a human papillomavirus HPV16 plasmid, a human papillomavirus HPV18 plasmid, a human papillomavirus HPV56 plasmid, or a human papillomavirus HPV58 plasmid, all synthesized by General Bio (Anhui) Co., Ltd., quantified and diluted, and then mixed with the reaction system at 50 copies / reaction. At the same time, a no-template control (NTC) is set, that is, 1XTE Buffer is used instead of the nucleic acid template, and then PCR amplification and melting curve analysis are performed. The presence of the virus in the sample can be determined based on the characteristic Tm value of the target in a specific detection channel.

[0226] For testing, this example utilizes a SLAN real-time fluorescence quantitative PCR instrument and reagents and consumables from Shanghai Hongshi Medical Technology Co., Ltd. The 2X PCR Reaction Buffer includes: 3mM MgCl2, 30mM Tris-HCl (pH 8.3), 0.5mM dNTPs, 70mM (NH4)2SO4, etc. The test results from the kit described in this example were analyzed using the SLAN real-time fluorescence quantitative PCR analysis software from Shanghai Hongshi Medical Technology Co., Ltd., compatible with the instrument.

[0227] The results were interpreted by the Tm value of the melting curve.

[0228] The primer probes of this embodiment were all added, and only one virus template was added at a time. After PCR amplification, a melting curve analysis of the double-stranded amplification product formed with the probe was performed, and the melting curves of the four targets were placed on a graph, as shown in Figure 4. From left to right in Figure 4 are the melting peaks of the positive reaction wells to which HPV16 plasmid, HPV18 plasmid, HPV56 plasmid, and HPV58 plasmid were added. The primer probes of this embodiment were all added, and no positive plasmid template was added (i.e., no template control), and then a melting curve analysis of the double-stranded amplification product formed with the probe was performed, i.e., the NTC group, as shown in Figure 5. Figure 5 shows that each primer does not cause primer dimers.

[0229] The description of the present disclosure is provided for purposes of illustration and description and is not intended to be exhaustive or to limit the disclosure to the disclosed form. Many modifications and variations will be apparent to those skilled in the art. The embodiments are selected and described in order to better illustrate the principles and practical applications of the present disclosure and to enable those skilled in the art to understand the present disclosure and design various embodiments with various modifications suitable for specific applications.

Claims

1. A primer-probe composition for nucleic acid detection, the primer-probe composition comprising at least one first primer, at least one second primer and at least one probe; The first primer includes a first target sequence binding region (X1') from the 5' end to the 3' end; The second primer includes a primer signal detection region (h), a second target sequence binding region (X2'), and a third target sequence binding region (X3') from the 5' end to the 3' end; when the target does not exist, the primer signal detection region (h) specifically binds to a portion of the sequence of the second primer to form a first stem-loop structure; in, The first target sequence binding region (X1') and the second target sequence binding region (X2') specifically bind to the first target sequence (X1) and the second target sequence (X2) of one of the target chains in the double-stranded target, respectively, and the third target sequence binding region (X3') can specifically bind to the third target sequence (X3) of the other target chain in the double-stranded target; The probe comprises a probe signal detection region (H) and a first detection group and a second detection group modified at any position on the probe, wherein the first detection group and the second detection group generate a detectable signal change by a change in the distance between the first detection group and the second detection group on the probe; The complementary sequence of the primer signal detection region (h) specifically binds to the probe signal detection region (H).

2. The primer-probe composition according to claim 1, wherein when the target is not present, a portion of the sequence of the second primer that forms the first stem-loop structure after specifically binding to the primer signal detection region (h) is a primer signal detection region complementary sequence (h'), and the primer signal detection region complementary sequence (h') is located between the second target sequence binding region (X2') and the third target sequence binding region (X3'); The primer signal detection region (h), the primer signal detection region complementary sequence (h') and the probe are not complementary to and / or identical in sequence to any target sequence; Preferably, the second primer further comprises a third connecting sequence located between the complementary sequence (h') of the primer signal detection region and the third target sequence binding region (X3'), and the third connecting sequence is not complementary to and / or identical in sequence to any target sequence.

3. According to the primer-probe composition of claim 1, when the target is not present, a portion of the sequence of the second primer that forms a first stem-loop structure after specifically binding to the primer signal detection region (h) is a second target sequence binding region (X2'), and the second primer also includes a third connecting sequence located between the second target sequence binding region (X2') and the third target sequence binding region (X3'), and the third connecting sequence is not complementary to any target sequence and / or has the same sequence as any target sequence.

4. According to the primer-probe combination according to any one of claims 1-3, any two of the first target sequence binding region (X1'), the third target sequence binding region (X3') and the second target sequence binding region (X2') are not complementary in sequence or identical in sequence.

5. The primer-probe combination according to any one of claims 1 to 4, wherein the first primer further comprises a probe anchor region (A) located at the 5' end of the first target sequence binding region (X1'); and / or, the probe further comprises a primer anchor region (A'); The primer anchor region (A') specifically binds to the probe anchor region (A).

6. The primer-probe combination according to any one of claims 1 to 5, wherein the probe comprises a probe signal detection region (H) and a primer anchor region (A') from the 5' end to the 3' end; Alternatively, the probe includes a probe signal detection region (H) and a primer anchor region (A') from the 3' end to the 5' end.

7. The primer-probe combination according to any one of claims 1 to 6, wherein the Tm value of the probe anchor region (A) is greater than the Tm value of the primer signal detection region (h).

8. The primer-probe combination according to any one of claims 5 to 7, wherein the first primer further comprises a fourth linking sequence located between the probe anchor region (A) and the first target sequence binding region (X1'); And / or, the second primer further comprises a first connecting sequence located between the primer signal detection region (h) and the second target sequence binding region (X2'); and / or, a second linking sequence located between the second target sequence binding region (X2') and the primer signal detection region complementary sequence (h'); And / or, the probe further comprises a fifth connecting sequence located between the primer anchor region (A') and the probe signal detection region (H); The first connecting sequence, the second connecting sequence, the fourth connecting sequence and the fifth connecting sequence are not complementary to and / or identical in sequence to any target sequence. 9 . The primer-probe combination according to claim 1 , wherein the 3′ end of the probe contains a blocking region.

10. The primer-probe combination according to any one of claims 1 to 9, wherein the primer-probe combination contains one probe and at least two second primers, the sequences of at least the primer signal detection regions (h) on different second primers are different, and the complementary sequences of the primer signal detection regions (h) on different second primers specifically bind to the probe signal binding region (H) at different positions; Preferably, the first primer is one, two or more.

11. A primer-probe system for nucleic acid detection, comprising the primer-probe composition according to any one of claims 1 to 10.

12. A method for nucleic acid detection, comprising contacting a target sample with the primer-probe combination according to any one of claims 1 to 10 and / or the primer-probe system according to claim 11, performing at least two amplifications, and analyzing whether a target is present; in, The target sample includes a target; Preferably, the source of the target sample includes any one or more of bacteria, viruses, and pathogens; Preferably, the method for analyzing whether there is a target includes: judging whether there is a target by the signal change before and after amplification; and / or judging whether there is a target by analyzing the melting curve of the amplified product; and / or judging whether there is a target by the signal change before and after denaturation of the amplified product; Preferably, the amplification comprises: randomly distributing the reaction system into at least 500 reaction units, each reaction unit containing one target of the sample to be tested or not containing the target of the sample to be tested; And / or, performing PCR amplification on all reaction units.

13. The method according to claim 12, after the target sample is contacted with the primer-probe composition and / or the primer-probe system, when the target is present in the target sample, a first specific amplification is performed with the target as a template and the first primer and the second primer as primers to obtain a single-stranded amplification product (S1); the single-stranded amplification product (S1) includes at least the first target sequence binding region (X1'), the complementary sequence of the second target sequence (X2), the complementary sequence (X3") of the third target sequence binding region (X3'), the complementary sequence of the optional third connecting sequence and / or the complementary sequence of the primer signal detection region complementary sequence (h'), the complementary sequence (X2") of the second target sequence binding region (X2') and the complementary sequence of the primer signal detection region (h); In the single-stranded amplification product (S1), the Gibbs free energy of a conformation formed by the specific binding of the complementary sequence of the second target sequence (X2) and the complementary sequence (X2") of the second target sequence binding region (X2') is less than the Gibbs free energy of a conformation formed by the specific binding of the complementary sequence of the primer signal detection region (h) and the complementary sequence of the complementary sequence of the primer signal detection region (h'); or, the Gibbs free energy of a conformation formed by the specific binding of the complementary sequence of the second target sequence (X2) and the complementary sequence (X2") of the second target sequence binding region (X2') is less than the Gibbs free energy of a conformation formed by the specific binding of the complementary sequence of the primer signal detection region (h) and the complementary sequence (X2") of the second target sequence binding region (X2'); The single-stranded amplification product (S1) combines with the complementary sequence of the second target sequence and the complementary sequence (X2") of the second target sequence binding region (X2') to form a second stem-loop structure; When the target is present, the second stem-loop structure of the single-stranded amplification product (S1) is unraveled, and a second specific amplification is performed using the probe as a template and the single-stranded amplification product (S1) as a primer to obtain a double-stranded amplification product formed with the probe; The melting temperature of the double-stranded amplification product formed with the probe is detected to achieve nucleic acid detection.

14. An application of the primer-probe composition according to any one of claims 1 to 11 and / or the primer-probe system according to claim 12, wherein the application comprises preparing a product for nucleic acid detection and / or nucleic acid detection; Preferably, the nucleic acid detection product is related to a disease; More preferably, the disease is papilloma.

15. A nucleic acid detection kit, comprising the primer-probe combination according to any one of claims 1 to 10 and / or the primer-probe system according to claim 11; Preferably, the kit further comprises an amplification reagent; More preferably, the amplification reagent comprises DNA polymerase and dNTPs; More preferably, the amplification reagent also includes reverse transcriptase.

Images