Ferritin nanoprobe for targeting gastric cancer lymphatic metastasis as well as preparation method and application of ferritin nanoprobe

Abstract

The invention discloses a ferritin nanoprobe for targeting gastric cancer lymphatic metastasis as well as a preparation method and application of the ferritin nanoprobe. According to the present invention, the fusion expression technology and the polycistron expression system are adopted to simultaneously display the two targeting peptide fragments on the cage-shaped surface of the ferritin without affecting the prokaryotic intracellular self-assembly characteristic, such that the method is simple and easy to perform, and the material innovation of the ferritin as the tumor targeting nano-probe is enriched. The three-target ferritin nano-probe constructed by the invention successfully fuses three targets of TfR1, CXCR4 and VEGFR3, endows ferritin with higher and wider affinity in combination with various gastric cancer tumor cells, and remarkably improves the targeting ability of the ferritin nano-probe for various gastric cancer tumor cells or tissues with different surface expression conditions; the difficulty of strong heterogeneity between cells / tissues in gastric cancer lymphatic metastasis diagnosis and treatment is effectively overcome.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly relates to a ferritin nanoprobe targeting gastric cancer lymphatic metastasis, its preparation method and application. Background Art

[0002] Gastric cancer is a major disease that seriously endangers the lives and health of people around the world. The vast majority of gastric cancer patients are in the advanced stage at the time of diagnosis, and radical surgical resection is currently the only treatment method that may achieve cure. For radical gastric cancer surgery, the traditional view is that the number of lymph nodes dissected is the key index for evaluating the quality of the surgery. In addition, the number of dissected lymph nodes is crucial for accurate staging and prognosis of solid tumors. Therefore, surgeons pay attention to obtaining lymph nodes during the operation for pathological evaluation. However, the conventional HE-based pathological evaluation method has low sensitivity, a high missed diagnosis rate of micrometastatic lymph nodes, a huge pathological burden, and it is difficult to perform a more rigorous evaluation method on high-risk lymph nodes, resulting in inaccurate pathological staging. Therefore, there is an urgent clinical need for a technical means that can preselect high-risk lymph nodes, which can perform a more rigorous evaluation on high-risk lymph nodes, thereby improving the prognosis. However, gastric cancer lymphatic metastasis is a multi-gene and multi-step regulatory process, and the expression of surface receptors of gastric cancer cells in different lymphatic metastasis stages is different. Therefore, it is difficult to achieve universal tracing of metastatic lymph nodes of gastric cancer relying solely on a single target.

[0003] Molecular probes modified with multiple targets are expected to achieve tracer imaging of metastatic lymph nodes of gastric cancer. The triple-targeting ligand nanoparticles can effectively target multiple receptors overexpressed in invasive tumors. By using multiple different targeting specificities, the multi-ligand strategy takes into account the spatio-temporal changes in the receptor expression pattern at the cancer site. Through the synergistic effect of each ligand, the conjugation of multiple targeting ligands to the nanoparticle surface can improve the targeting efficiency while detecting tumors in real time and targeting different stages of tumor growth.

[0004] In recent years, due to their multi-modal imaging capabilities, nanomaterials are often used for imaging and detection of the lymphatic system. Ferritin nanomaterials show excellent application prospects due to their high stability, strong loading capacity, easy production and purification. In addition, ferritin, as an endogenous protein, also has excellent biocompatibility, biodegradability and low toxicity, which are highly expected characteristics of nanoprobes in clinical applications. Summary of the Invention

[0005] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art, and to provide a ferritin nanoprobe targeting gastric cancer lymphatic metastasis.

[0006] Another purpose of the present invention is to provide a preparation method of the above-mentioned ferritin nanoprobe targeting gastric cancer lymphatic metastasis.

[0007] Another object of the present invention is to provide the application of the above-mentioned ferritin nanoprobe targeting gastric cancer lymph node metastasis.

[0008] The object of the present invention is achieved by the following technical solutions:

[0009] A recombinant ferritin nanoprobe targeting lymph node metastasis of gastric cancer cells comprises at least one of the FTn human ferritin heavy chain subunit and the VE-FTn / CX-FTn targeting peptide-ferritin fusion subunit.

[0010] The amino acid sequence of the FTn human ferritin heavy chain subunit is shown as SEQ ID NO.1.

[0011] The FTn human ferritin heavy chain subunit is obtained according to the codon coding rule from the nucleotide sequence of its encoding gene.

[0012] The nucleotide sequence of the encoding gene of the FTn human ferritin heavy chain subunit is shown as SEQ ID NO.2.

[0013] The VE-FTn targeting peptide-ferritin fusion subunit is obtained by sequentially connecting the flexible peptide segment GS and the targeting peptide segment VE at the N-terminus of the sequence of the FTn human ferritin heavy chain subunit.

[0014] The CX-FTn targeting peptide-ferritin fusion subunit is obtained by sequentially connecting the flexible peptide segment GS and the targeting peptide segment CX at the N-terminus of the sequence of the FTn human ferritin heavy chain subunit.

[0015] The amino acid sequence of the flexible peptide segment GS is (GGGGS)n, where "n" represents the number of repetitions; preferably GGGGS.

[0016] The amino acid sequence of the targeting peptide segment VE is GCYYGQSKYC.

[0017] The amino acid sequence of the targeting peptide segment CX is KPVSLSYRAPARFFESH.

[0018] The nucleotide sequences of the encoding genes of the flexible peptide segment GS and the targeting peptide segment VE / CX are obtained according to the codon coding rule.

[0019] The recombinant ferritin nanoprobe targeting lymph node metastasis of gastric cancer cells further comprises at least one fluorescent dye; preferably at least one of Cy5-NHS ester, Cy5.5-NHS ester, ICG-NHS ester and IRDye800-NHS ester; more preferably IRDye 800-NHS ester.

[0020] A preparation method of a targeted recombinant ferritin nanoprobe for lymphatic metastasis of gastric cancer cells comprises the following steps:

[0021] (1) Integrate the nucleotide sequences of the targeted peptide-ferritin fusion subunit and the human ferritin heavy chain subunit into plasmids respectively. After correct sequencing and identification, obtain positive clones, transfer them into engineering bacteria together, induce expression, and obtain the targeted recombinant ferritin for lymphatic metastasis of gastric cancer cells after purification;

[0022] (2) React the targeted recombinant ferritin for lymphatic metastasis of gastric cancer cells with a fluorescent dye to obtain the targeted recombinant ferritin nanoprobe for lymphatic metastasis of gastric cancer cells.

[0023] The above-mentioned targeted peptide-ferritin fusion subunit is at least one of VE-FTn / CX-FTn targeted peptide-ferritin fusion subunits.

[0024] The above-mentioned plasmid is at least one of pET21a, pRSFDuet, and pCDFDuet.

[0025] The above-mentioned engineering bacteria are BL21 Escherichia coli.

[0026] The above-mentioned fluorescent dye is at least one of Cy5-NHS ester, Cy5.5-NHS ester, ICG-NHS ester, and IRDye800-NHS ester; preferably IRDye 800-NHS ester.

[0027] The molar mass ratio of the targeted recombinant ferritin for lymphatic metastasis of cancer cells to the fluorescent dye is 1:30 - 50.

[0028] Application of the above-mentioned targeted recombinant ferritin nanoprobe for lymphatic metastasis of gastric cancer cells in the prognosis evaluation of non-therapeutic and diagnostic gastric cancer lymph node metastasis.

[0029] The present invention has the following advantages and effects compared with the prior art:

[0030] (1) The present invention utilizes the fusion expression technology and the polycistronic expression system to realize the simultaneous display of two targeted peptide segments on the surface of the ferritin cage, and does not affect its prokaryotic intracellular self-assembly characteristics. This method is simple and easy to operate, enriching the material innovation of ferritin as a targeted tumor nanoprobe.

[0031] (2) The three-targeted ferritin nanoprobe constructed by the present invention successfully fuses three targets, namely TfR1, CXCR4, and VEGFR3, endowing ferritin with higher and more extensive affinity for binding various gastric cancer tumor cells, significantly improving its targeting ability for various gastric cancer tumor cells or tissues with different surface expression conditions, and effectively overcoming the difficulty of strong cell / tissue heterogeneity in the diagnosis and treatment of gastric cancer lymphatic metastasis.

[0032] (3) The three targets fused in the multi-targeted ferritin nanoprobe constructed by the present invention are closely related to each stage in the process of gastric cancer lymph node metastasis, and are expected to be applied to visualize the evolution process of gastric cancer and its lymphatic metastasis, providing guiding significance for the accurate identification and thorough dissection of metastatic lymph nodes of gastric cancer before and during surgery. Description of the Drawings

[0033] Figure 1 is the flow chart for the preparation of the triple-targeted ferritin nanoprobe for the process of gastric cancer lymph node metastasis;

[0034] Figure 2 is the characterization result of the triple-targeted ferritin nanoprobe; where a is the schematic diagram of the VEGFR3, CXCR4 targeting peptide-ferritin fusion subunit and human ferritin heavy chain subunit; b is the SDS-PAGE analysis of each recombinant ferritin component; c is the structural image of each recombinant ferritin observed by transmission electron microscopy after negative staining with 2% phosphotungstic acid, and the scale bar in the figure = 20 nm;

[0035] Figure 3 is the in vitro targeting verification of the triple-targeted ferritin nanoprobe; where a is the analysis of the heterogeneous expression of CXCR4, TfR1 and VEGFR3 in different gastric cancer cells by Western blot; b is the analysis of the binding ability of single / double / triple-targeted recombinant ferritin to different gastric cancer cells by flow cytometry, where **P<0.01, ***P<0.001, ****P<0.0001; c is the cell uptake image of MGC-803 gastric cancer cells for each single / double / triple-targeted recombinant ferritin taken by confocal microscopy, the scale bar in the figure = 10 μm, blue represents the nucleus, green represents the cell membrane, and red represents the Cy5-labeled recombinant ferritin nanoprobe;

[0036] Figure 4 is the in vivo imaging of the triple-targeted ferritin nanoprobe for metastatic LNs; where a is the in vivo near-infrared fluorescence imaging of metastatic lymph nodes (MLN) and contralateral non-metastatic lymph nodes (NLN) after injection of various FTn nanoprobes (n = 3 / group); b is the ex vivo fluorescence imaging (left) and image-based quantitative analysis (right) of MLN and NLN isolated from the mice in Figure 4 a, **P<0.01, ***P<0.001, ***P<0.0001; c is the in vivo (upper) and ex vivo (lower) fluorescence imaging of MLN at different lymphatic metastasis stages after injection of the VE / CX-FTn probe (n = 3 / group); d is the quantitative analysis of the average fluorescence intensity of MLN at different lymphatic metastasis stages, where, Figure 4d left reflects the in vivo average fluorescence intensity of MLN (corresponding to Figure 4 the imaging on c), Figure 4 d right reflects the correlation between the average fluorescence intensity of MLN after ex vivo and (corresponding to Figure 4 the imaging on c below) and volume, *P < 0.05.

[0037] Figure 5 It is to use a triple-targeting ferritin nanoprobe to identify metastatic LNs in a patient's gastric specimen; where a is a schematic diagram of the gastric cancer tissue resected from the patient and the situation of nanoprobe injection under the serosa; b and c are representative images of ICG and IRdye800-labeled VE / CX-FTn for lymph nodes and lymphatic vessels in the patient's gastric specimen. The ICG group included 5 patients with a total of 146 lymph nodes; the IRdye800-labeled VE / CX-FTn group included 8 patients with a total of 95 lymph nodes. LN represents lymph node; LV represents lymphatic vessel. Scale bar = 5 mm. d is an image-based quantitative analysis of the signal-to-noise ratio of lymph nodes after treatment with ICG and nanoprobe. The signal-to-noise ratio represents the ratio of the lymph node signal to the signal of the surrounding tissue. e is a quantitative analysis of the full width at half maximum of the lymphatic vessels at the dotted line in b and c. f is the average number of recovered lymph nodes when all potential MLNs are resected. ****P < 0.0001. g is a comparison of MLNs and NLNs among all signal-positive lymph nodes. ***P < 0.001. h are representative images of MLNs and NLNs. The lymph nodes were imaged after nanoprobe injection, and then the lymph node tissue sections were stained with H&E and IHC. The scale bar for NLNs is 200 μm; the scale bar for MLNs is 500 μm Detailed implementation manners

[0038] The present invention will be further described in detail below in combination with embodiments and the accompanying drawings, but the implementation manners of the present invention are not limited thereto.

[0039] If the specific test conditions are not indicated in the following implementation manners, they are usually in accordance with conventional test conditions or in accordance with the test conditions recommended by the reagent company. The materials, reagents, etc. used, unless otherwise specified, are all reagents and materials obtained from commercial channels.

[0040] Example 1 Preparation of single / double / triple-targeting recombinant ferritin nanoprobes for gastric cancer lymphatic metastasis

[0041] The present invention designs a triple-targeting ferritin nanoprobe for the gastric cancer lymphatic metastasis process, and the steps of its preparation method are as follows:

[0042] (1) Construction of the targeting peptide-ferritin fusion gene: By overlap extension polymerase chain reaction, the nucleotide sequences corresponding to the VEGFR3 targeting peptide segment (GCYYGQSKYC) and the CXCR4 targeting peptide segment (KPVSLSYRAPARFFESH) were respectively integrated into the N-terminus of the human heavy chain ferritin heavy chain gene sequence (NCBI accession number: 2495). A flexible peptide segment containing G and S (preferably (GGGGS)n, corresponding nucleotide sequence: (GGTGGTGGTGGTTCT)n, where "n" represents the number of repetitions, and n = 1 in this example) was used to connect the two, resulting in the fusion expression ferritin genes VE-FTn and CX-FTn.

[0043] Nucleotide sequence corresponding to the VEGFR3 targeting peptide segment:

[0044] GGTTGTTATTACGGTCAGAGCAAATACTGC;

[0045] Nucleotide sequence corresponding to the CXCR4 targeting peptide segment:

[0046] AAACCGGTTAGCCTGAGCTATCGTGCACCGGCACGTTTCTTCGAAAGC CAC.

[0047] (2) Construction of the mono / dicistronic expression plasmids: The fusion expression ferritin genes VE-FTn and the human ferritin heavy chain gene Ftn obtained in (1) were digested with the restriction enzymes NcoⅠ and HindⅢ respectively to generate sticky ends, and then ligated to the back of the first cistron of the dicistronic vector pRSFDuet using T4 DNA ligase. Subsequently, CX-FTn and the human ferritin heavy chain gene Ftn were digested with the restriction enzymes NdeⅠ and XhoⅠ respectively to generate sticky ends, and then ligated to the back of the second cistron of the dicistronic vector pCDFDuet using T4 DNA ligase. In addition, the human ferritin heavy chain gene Ftn was inserted into the back of the T7 cistron of pET21a (the restriction enzyme sites selected were NdeⅠ and XhoⅠ). A total of the above 3 ligation products were constructed and transfected into DH5a competent cells respectively, spread on plates containing the corresponding resistance, and cultured upside down for 10 to 14 hours. Single clone strains were picked for expanded culture and plasmid identification, and finally the construction of the three expression vectors was completed, namely pET21a-FTn, pRSFDuet-VX-FTn-FTn, and pCDFDuet-FTn-CX-FTn.

[0048] (3) Construction and screening of expression strains: According to the functional requirements of single / double / triple targeting, the expression plasmids constructed in (2) were transfected alone / co-transfected in combination into BL21 Escherichia coli competent cells. The specific transfection plasmid combinations used are shown in Table 1. After overnight culture, positive strains were screened with corresponding antibiotics and selected for expanded culture.

[0049] Table 1 Plasmid combinations used for transfection

[0050]

[0051] (4) Expression and purification of single / double / triple targeting ferritin: The single / triple targeting ferritin Escherichia coli prokaryotic expression strains screened in (3) were cultured at 37 °C until the OD600 of the bacterial solution reached 0.6 - 0.8. Then, 1 mM IPTG was added, and induction expression was carried out overnight at 20 °C. After completion, the bacterial cell precipitate was collected by centrifugation at 12,000 rpm for 10 minutes. The precipitate was resuspended with PBS, and ultrasonic fragmentation was performed with a 120 W ultrasonic disruptor for 30 minutes. The bacteria were placed in an ice-water bath and fragmented until clear. The supernatant was collected by centrifugation at 12,000 rpm for 10 minutes to remove incompletely lysed bacteria. The supernatant was heated in a 65 °C water bath for 15 minutes, and then the supernatant was collected by centrifugation at 12,000 rpm for 10 minutes to remove most of the miscellaneous proteins. Then, the supernatant was ultrafiltered and concentrated to an appropriate volume, and separated and purified by a Superose 6 chromatographic column through an AKTA chromatography system to obtain single / double / triple targeting ferritin.

[0052] (5) Labeling with fluorescent dyes: The single / double / triple targeting recombinant ferritin obtained in (4) was reacted with fluorescent dyes at a molar mass ratio of 1:30 (including Cy5-NHS ester, Cy5.5-NHS ester, ICG-NHS ester, and IRDye 800-NHS ester) overnight in a PBS environment at 4 °C and pH = 8.0 - 8.5. The mixture was purified using a PD-10 desalting column to remove free fluorescent small molecules.

[0053] Experimentally, single / double / triple targeting recombinant ferritin nanoprobes with fluorescent labels for the gastric cancer lymphatic metastasis process were successfully obtained.

[0054] Example 2 Identification and characterization of single / double / triple targeting ferritin

[0055] The ferritin nanoprobe purified in Example 1 was boiled in a water bath for 20 minutes to separate each subunit of the target ferritin. The composition and ratio of the targeting peptide-ferritin fusion subunit and human ferritin heavy chain subunit were detected by SDS-PAGE. After negative staining with 2% phosphotungstic acid, the cage-like self-assembled morphology of ferritin and its variants was characterized by transmission electron microscopy.

[0056] The results are asFigure 2 as shown, where Figure 2 Panel b shows the protein bands of two targeted peptide-ferritin fusion subunits, VE-FTn and CX-FTn, and the FTn human ferritin heavy chain subunit, and the molecular weights prove this. By analyzing the gray scale of each band, the composition ratio of each component can also be obtained. Figure 2 Panel a shows the schematic diagrams corresponding to the three subunits. Figure 2 Panel c shows the self-assembled nanostructures of various ferritins observed under a transmission electron microscope, with a diameter of about 12 nm.

[0057] Example 3 Universality and high affinity of targeted ferritin for gastric cancer tumor cells with different expression conditions

[0058] To evaluate the expression of three surface targets (TfR1, VEGFR3, CXCR4) in four common gastric cancer cell lines, HGC-27, MGC-803, SGC-7901, and MKN-45, we used standard procedures to lyse the same cell amount of the four gastric cancer cells for Western blot analysis. The transfer membranes were incubated with the corresponding anti-TfR-1 primary antibody (ab84036, Abcam), anti-VEGFR3 primary antibody (ab27278, Abcam), anti-CXCR4 primary antibody (ab181020, Abcam), and anti-GAPDH primary antibody (YM3215, Immunoway), and then incubated with goat anti-rabbit IgG-HRP secondary antibody (RS0002, Immunoway). After adding the chemiluminescent substrate, an imaging system was used for exposure. As Figure 3 shown in Panel a, the expression of these three targets varies among different tumor cells, which also proves that there is indeed strong heterogeneity among gastric cancer cells, and these four gastric cancer cells can simulate the differences in the expression of cell surface receptors during different lymphatic metastasis stages of gastric cancer cells. As Figure 3 shown in Panel c, the effective cellular uptake of various FTn molecules by gastric cancer cell lines can be clearly observed using a confocal microscope. Flow cytometry analysis shows that the tumor cell binding ability of hybrid FTn with a combination of two or three subunits (i.e., VE-FTn, CX-FTn, and VE / CX-FTn) is significantly higher than that of single FTn ( Figure 3 Panel b). Compared with VE-FTn and CX-FTn, VE / CX-FTn has the highest binding ability to the four gastric cancer cell lines. These results indicate that the interaction between ferritin nanoprobes and cells is positively correlated with the heterogeneous combination of fusion subunits and the expression level of surface targets.

[0059] Example 4 Application of triple-targeted ferritin in a mouse lymphatic metastasis model

[0060] We evaluated whether the incorporation of VE / CX improves the targeting ability of FTn to tumor lymph node metastasis. First, 5-6 week-old male BALB / c nude mice were selected and SGC-7901 cells were injected into the unilateral footpad of mice to construct a mouse lymph node metastasis model. 30 days after inoculation, various IRdye800-labeled nanoprobes (50 μL, 500 μg / mL) were subcutaneously injected into the tumor-bearing footpad, while the same amount of nanoprobes was subcutaneously injected into the contralateral footpad as a control. At the designated time points, NIR fluorescence imaging (excitation / emission: 780 / 800 nm) was performed using an IVIS Spectral CT system (PerkinElmer). Following the same procedure, lymph node metastasis at different metastatic stages was also imaged after treatment with IRdye800-labeled nanoprobes (50 μL, 500 μg / mL).

[0061] The results showed that the popliteal metastatic lymph nodes showed significantly enhanced tracer uptake for various FTn-based nanoprobes at all time points compared with the contralateral non-metastatic lymph nodes ( Figure 4 (a, right). Among them, the fluorescence intensity of MLN traced by the triple-targeted nanoprobe VE / CX-FTn was significantly higher than that of the FTn, VE-FTn, and CX-FTn groups. This was further confirmed by fluorescence imaging of isolated MLN and NLN 6 hours after injection ( Figure 4 (b) Image-based quantitative analysis showed that the intensity ratio of MLN to NLN treated with VE / CX-FTn was 2.16, 2.45, and 3.54 times higher than that of MLN treated with VE-FTn, CX FTn, and FTn, respectively. To further demonstrate the targeting effect of VE / CX-FTn, in vivo / ex vivo fluorescence imaging of popliteal MLN at different lymphatic metastasis stages of gastric cancer was performed after injection of the nanoprobe. As the metastasis progressed, the signal intensity of MLN was observed to gradually increase ( Figure 4 Image-based quantitative analysis showed that the accumulation of VE / CX-FTn in MLN was positively correlated with the stage of lymph node metastasis, and there was also a linear relationship between the mean fluorescence intensity and tumor volume ( Figure 4 (d)

[0062] Example 5 Triple-targeted ferritin for high-risk lymph node preselection in ex vivo gastric cancer tissue samples

[0063] To clarify the efficacy of targeted nanoprobes in preselecting high-risk lymph nodes in gastric cancer patient samples. From March to May 2023, patients diagnosed with gastric cancer were enrolled and evaluated in the General Surgery Department of Nanfang Hospital to participate in this clinical trial. Inclusion criteria included biopsy-confirmed resectable gastric cancer and patients clinically suspected of having lymph node metastasis. Patients with a history of previous surgery, multiple primary tumors, and / or pregnancy were excluded. Finally, a total of 13 patients were enrolled. This prospective, single-center cohort study was approved by the Ethics Committee of Southern Medical University (Number: NFEC-202303-K23). All participants provided written informed consent before the examination.

[0064] In this study, IRdye800-labeled VE / CX-FTn was compared with the FDA-approved fluorescent dye ICG for clinical surgery. Immediately after complete resection of the patient's lesion containing lymphoid tissue, IRdye800-labeled VE / CX-FTn (8 patients) and ICG (5 patients) were injected at a concentration of 0.5 mg / mL (1 mL per site) into the subserosa of the resected tissue of the stomach ( Figure 5 as shown in a). To maintain the viability of the gastric tissue, the surgery from gastric tissue resection to probe injection was completed within 5 minutes. For each resected gastric cancer tissue, 3 - 4 injection points were selected along the curvature of the stomach according to the primary location of the gastric cancer and the surgical procedure (3 points for distal gastrectomy and 4 points for total gastrectomy). Then the tissue was incubated in warm saline at 37°C for 1 hour. Subsequently, the gastric tissue was imaged using a DPM-I imaging system. As Figure 5 shown in the representative images in b and c, the lymph nodes in the gastric tissue treated with VE / CX-FTn were clearly visible, while ICG treatment resulted in signal scattering around the lymph nodes. The signal-to-noise ratio of the lymph nodes was 4.65 for VE / CX-FTn and 1.83 for ICG ( Figure 5 as shown in d). Quantitative analysis of the full width at half maximum of the lymphatic vessels also revealed that VE / CX-FTn was superior to ICG in differentiating surrounding tissues ( Figure 5 as shown in e). Next, we attempted to explore whether VE / CX-FTn could effectively distinguish MLN and NLN isolated from gastric cancer tissues of 19 patients. Pathological examinations, including immunohistochemistry (IHC) and H&E staining, were also performed as the gold standard for determining lymph node metastasis to identify MLN. To screen all potential MLNs in the drainage area, the average number of lymph nodes retrieved by VE / CX-FTn, ICG, and pathological examination was 5, 5.2, and 18.5, respectively ( Figure 5In Fig. f), it shows that VE / CX-FTn and ICG are valuable for the accurate screening of high-risk lymph nodes in lymph node dissection. Further analysis shows that VE / CX-FTn effectively distinguished all four MLNs (100% detection rate) among 95 collected lymph nodes, while ICG failed to identify five MLNs among 146 lymph nodes (0% detection rate). In addition, 36 NLNs also showed positive fluorescence signals after VE / CX-FTn administration, but the signal intensity was 2.5 times lower than that of MLNs ( Figure 5 In Fig. g), it shows that VE / CX-FTn has a positive binding ability to MLNs in the gastric cancer tissues of patients. To further verify the targeting ability, the distribution of VE / CX-FTn in lymph nodes was studied, and then the tissues were evaluated by H&E staining and IHC. As Figure 5 shown in Fig. h, stronger fluorescence signals of VE / CX-FTn were observed in MLNs than in NLNs. It is worth noting that the distribution of VE / CX-FTn in the tissue sections of MLNs was highly consistent with the tumor metastasis area (dotted circle), which was confirmed by H&E staining and IHC.

[0065] In summary, the three-targeted ferritin nanoprobe constructed in the present invention successfully integrates three targets, namely TfR1, CXCR4, and VEGFR3, endowing ferritin with higher and broader affinity for binding various gastric cancer tumor cells. By using the fusion expression technology and the polycistronic expression system, the simultaneous display of two targeting peptide segments on the surface of the ferritin cage was achieved without affecting its prokaryotic intracellular self-assembly characteristics. This method is simple and easy to implement, enriching the material innovation of ferritin as a targeted tumor nanoprobe.

[0066] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. A gastric cancer cell lymphatic metastasis-targeted recombinant ferritin nanoprobe, characterized in that: It includes at least one of the FTn human ferritin heavy chain subunit and the VE-FTn / CX-FTn targeting peptide-ferritin fusion subunit.

2. The gastric cancer cell lymphatic metastasis-targeted recombinant ferritin nanoprobe according to claim 1, characterized in that: The amino acid sequence of the FTn human ferritin heavy chain subunit is shown in SEQ ID NO.1; The nucleotide sequence of the coding gene of the FTn human ferritin heavy chain subunit is shown in SEQ ID NO.

2.

3. The gastric cancer cell lymphatic metastasis-targeted recombinant ferritin nanoprobe according to claim 1, characterized in that: The VE-FTn targeting peptide-ferritin fusion subunit is obtained by sequentially connecting the flexible peptide segment GS and the targeting peptide segment VE to the N-terminus of the sequence of the FTn human ferritin heavy chain subunit; The CX-FTn targeting peptide-ferritin fusion subunit is obtained by sequentially connecting the flexible peptide segment GS and the targeting peptide segment CX to the N-terminus of the sequence of the FTn human ferritin heavy chain subunit.

4. The gastric cancer cell lymphatic metastasis-targeted recombinant ferritin nanoprobe according to claim 3, characterized in that: The amino acid sequence of the flexible peptide segment GS is GGGGS; The amino acid sequence of the targeting peptide segment VE is GCYYGQSKYC; The amino acid sequence of the targeting peptide segment CX is KPVSLSYRAPARFFESH; The nucleotide sequences of the coding genes of the flexible peptide segment GS and the targeting peptide segments VE / CX are obtained according to the codon coding rules.

5. The gastric cancer cell lymphatic metastasis-targeted recombinant ferritin nanoprobe according to claim 1, characterized in that: The gastric cancer cell lymphatic metastasis-targeted recombinant ferritin nanoprobe further comprises at least one fluorescent dye.

6. A preparation method of a lymphatic metastasis-targeted recombinant ferritin nanoprobe for gastric cancer cells, characterized in that It includes the following steps: (1) Integrate the nucleotide sequences of the targeting peptide-ferritin fusion subunit and the human ferritin heavy chain subunit into plasmids respectively. After sequencing and identification without error, positive clones are obtained and transferred into engineering bacteria together, induced to express, and after purification, gastric cancer cell lymphatic metastasis-targeted recombinant ferritin is obtained; (2) React the gastric cancer cell lymphatic metastasis-targeted recombinant ferritin with a fluorescent dye to obtain a gastric cancer cell lymphatic metastasis-targeted recombinant ferritin nanoprobe.

7. The preparation method according to claim 6, characterized in that The targeting peptide-ferritin fusion subunit is at least one of the VE-FTn / CX-FTn targeting peptide-ferritin fusion subunits.

8. The preparation method according to claim 6, characterized in that The plasmid is at least one of pET21a, pRSFDuet, and pCDFDuet; The engineering bacteria are BL21 Escherichia coli.

9. The preparation method according to claim 6, characterized in that The fluorescent dye is at least one of Cy5-NHS ester, Cy5.5-NHS ester, ICG-NHS ester, and IRDye 800-NHS ester; The molar mass ratio of the described cancer cell lymphatic metastasis-targeted recombinant ferritin to the fluorescent dye is 1:30 to 50.

10. Use of the gastric cancer cell lymphatic metastasis-targeted recombinant ferritin nanoprobe according to any one of claims 1 to 5 in the prognosis evaluation of gastric cancer lymph node metastasis for non-therapeutic and diagnostic purposes.

Images