Application of ganoderma lucidum strain SS30 in preparation of products for treating cancers

Abstract

The invention discloses application of a ganoderma lucidum strain SS30 in preparation of a product for treating cancers, and belongs to the technical field of biology. The invention provides ganoderma lucidum strain SS30 mycelium polysaccharide. The ganoderma lucidum strain SS30 mycelium polysaccharide is prepared from glucose, galactose, mannose, fucose, xylose, arabinose, rhamnose, glucuronic acid, glucosamine, ribose and lacturonic acid. The polysaccharide has a remarkable effect of inhibiting transplantable pancreatic cancer and primary colorectal cancer, can achieve the effect of treating cancer by improving the immune function and reducing the oxidation product generation level, provides a new material for development and utilization of lucid ganoderma and products thereof, and has a wide application prospect. And a research basis is provided for research and development of cancer-related drugs and research of a cancer treatment mechanism.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to the application of Ganoderma lucidum strain SS30 in the preparation of products for treating cancer. Background Art

[0002] Pancreatic cancer is one of the tumors with the highest malignancy in the digestive system. Due to its insidious onset, no specific symptoms for prompt, early diagnosis is difficult, resulting in extremely poor prognosis. The only treatment method that can significantly improve the survival rate of pancreatic cancer patients is surgical resection. However, 70%-85% of patients have already had tissue metastasis such as blood, lymph, and nerves at the time of diagnosis and are not eligible for surgical resection. Patients who undergo surgical resection also face the problems of easy recurrence or metastasis after surgery. Chemotherapy remains the main treatment option. Among them, the first-line clinical drug treatment regimens mostly use gemcitabine as the basic chemotherapy drug, but drug treatment has non-negligible toxic and side effects, which are toxic to the heart, liver, kidneys, and immune system, and there are also problems of drug resistance with long-term use. The research and development of targeted drugs and immune drugs for pancreatic cancer have made certain progress in recent years, but there are still many adverse reactions. Colorectal cancer is one of the most common types of malignant tumors in the digestive tract. At present, the effective measures for treating CAC are mainly surgical resection, radiotherapy, and chemotherapy drugs, which have definite effects on patients in the relatively early stage. However, for advanced patients, radiotherapy and chemotherapy have relatively large toxic and side effects and are often accompanied by problems such as low quality of life, relatively unsatisfactory effects, and high costs. In recent years, with the in-depth research and wide application of edible and medicinal fungi, the anti-tumor effects of edible and medicinal fungi have gradually attracted attention. It can effectively reduce the adverse reactions caused by chemotherapy, thereby effectively improving the quality of life of patients, and is a new type of anti-cancer drug with high efficiency and low toxicity.

[0003] Ganoderma lucidum is commonly known as "auspicious herb" and "immortal herb", and is a fungus of the class Basidiomycetes, order Polyporales, family Polyporaceae, and genus Ganoderma. Ganoderma lucidum likes warm and humid environments and parasitizes on the dead wood or stumps of broad-leaved trees such as oak trees and beech trees under natural conditions. Wild resources are scarce, and it is now mainly cultivated by artificial log cultivation or substitute material cultivation. Traditional Chinese medicine regards Ganoderma lucidum as a top-grade nourishing medicine, with a flat nature and sweet taste, and belongs to the heart, lung, liver, and kidney meridians. It is often used to replenish qi and soothe the nerves, relieve cough and asthma, and regulate consumptive fatigue, insomnia, cough and asthma, etc. Modern pharmacological research has found that the active ingredients and pharmacological effects of Ganoderma lucidum fermented mycelium and Ganoderma lucidum fruit body are similar, and it has biological activities such as immune regulation, antioxidant, and nerve regulation. In recent years, with the development of aerospace technology, aerospace breeding technology has become a new breeding method. After crops, plants, fungi, etc. are irradiated and mutated by space radiation, new traits are produced, thus obtaining new varieties. However, the research on the functional activities of aerospace breeding products is still relatively weak at present, and there are no related products of aerospace mutagenesis breeding Ganoderma lucidum in the domestic and international markets. Summary of the Invention

[0004] The object of the present invention is to provide the application of Ganoderma lucidum strain SS30 in the preparation of products for treating cancer, so as to solve the problems existing in the above-mentioned prior art. The present invention uses the Ganoderma lucidum strain SS30 generated by space mutation as the raw material to prepare mycelial polysaccharide, which has a significant effect of inhibiting transplanted pancreatic cancer and primary colorectal cancer, and can achieve the effect of treating cancer by improving immune function and reducing the generation level of oxidation products, providing new materials for the development and utilization of Ganoderma lucidum and its products, and providing a research basis for the research and development of cancer-related drugs and the research of cancer treatment mechanisms.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a mycelial polysaccharide of Ganoderma lucidum strain SS30, which is composed of glucose, galactose, mannose, fucose, xylose, arabinose, rhamnose, glucuronic acid, glucosamine, ribose and lacturonic acid according to a molar ratio of 466.0:101.9:41.4:22.3:7.8:5.6:4.5:3.2:3.2:1.7:1, and the average molecular weight is 1.57×10 6 Da.

[0007] The present invention also provides a preparation method of the above-mentioned mycelial polysaccharide of Ganoderma lucidum strain SS30, including the following steps:

[0008] (1) After ethanol ultrasonic extraction and hot water extraction of the mycelium of Ganoderma lucidum strain SS30, a supernatant is obtained;

[0009] (2) After deproteinization, dialysis and drying of the supernatant, a crude polysaccharide is obtained;

[0010] (3) Using water and sodium chloride solution as eluents in sequence, eluting the crude polysaccharide through a DEAE Sepharose FastFlow column, collecting the eluate, and performing dialysis and drying to obtain the mycelial polysaccharide of Ganoderma lucidum strain SS30.

[0011] Further, the process of ethanol ultrasonic extraction is as follows: mixing the dried mycelium of Ganoderma lucidum strain SS30 with an 85% - 95% ethanol solution according to a ratio of 1 g:1 mL, and performing ultrasonic treatment for 20 - 60 min at 80W - 120W and 35℃ - 55℃; after ultrasonic extraction twice, centrifuging to collect the precipitate.

[0012] Further, the process of hot water extraction is as follows: mixing the precipitate with water according to a solid-to-liquid ratio of 1:15 - 1:45, and extracting at 60 - 90℃ for 60 - 120 min; after extracting twice, combining the supernatant.

[0013] Optionally, in step (2), the method for removing proteins is the Sevag method; the cut-off molecular weight of the dialysis bag used during dialysis is 8000-12000 Da.

[0014] Furthermore, the elution process is as follows: The crude polysaccharide is formulated into a sample loading solution at a concentration of 1 mg / mL, and water and a 0.1-0.3 mol / L sodium chloride solution are used as the eluent for gradient elution. The amount of eluent used is 500 mL, and the eluent collected is the 170-260 mL fraction.

[0015] Optionally, the flow rate during elution is 10 mL / 15 min.

[0016] Optionally, in step (3), the cut-off molecular weight of the dialysis bag used during dialysis is 8000-12000 Da.

[0017] The present invention also provides the use of the mycelium polysaccharide of Ganoderma lucidum strain SS30 as described above or the mycelium polysaccharide of Ganoderma lucidum strain SS30 prepared by the above preparation method in the preparation of immunomodulatory products.

[0018] The present invention also provides the use of the mycelium polysaccharide of Ganoderma lucidum strain SS30 as described above or the mycelium polysaccharide of Ganoderma lucidum strain SS30 prepared by the above preparation method in the preparation of products for treating cancer, where the cancer includes colorectal cancer and pancreatic cancer.

[0019] The present invention also provides a product for treating cancer, which contains the mycelium polysaccharide of Ganoderma lucidum strain SS30 as described above or the mycelium polysaccharide of Ganoderma lucidum strain SS30 prepared by the above preparation method; the cancer includes colorectal cancer and pancreatic cancer.

[0020] The present invention discloses the following technical effects:

[0021] The present invention uses the Ganoderma lucidum strain SS30 generated by space mutation as a raw material to prepare mycelium polysaccharide. This mycelium polysaccharide can inhibit the cell proliferation and cell colony formation ability of pancreatic cancer cells, reduce the volume of pancreatic cancer solid tumors, promote cancer cell necrosis in tumor tissues, reduce the serum NO content in tumor-bearing mice, and regulate the levels of immune factors such as IL-6, TNF-α, IL-12, and INF-γ in tumor-bearing mice, achieving the effect of treating pancreatic cancer by enhancing immune function and reducing the level of oxidative products; this mycelium polysaccharide can also inhibit the onset of colorectal cancer and regulate the levels of immune factors such as IL-6, TNF-α, IL-1β, and INF-γ in tumor-bearing mice, achieving the effect of treating colorectal cancer by enhancing immune function. The present invention provides new materials for the development and utilization of Ganoderma lucidum and its products, provides a research basis for the research and development of cancer-related drugs and the study of cancer treatment mechanisms, and has important economic value and market value. Description of the Drawings

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the accompanying drawings required in the embodiments. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other accompanying drawings can be obtained based on these drawings.

[0023] Figure 1 It is the polysaccharide chromatogram of the polysaccharide from the mycelium of Ganoderma lucidum strain SS30;

[0024] Figure 2 It is the detection result of the monosaccharide composition of the polysaccharide from the mycelium of Ganoderma lucidum strain SS30;

[0025] Figure 3 It is the infrared spectrum of the polysaccharide from the mycelium of Ganoderma lucidum strain SS30;

[0026] Figure 4 It is the inhibition rate of the polysaccharide from the mycelium of Ganoderma lucidum strain SS30 on pancreatic cancer cells SW1990;

[0027] Figure 5 It is the weight change of pancreatic cancer mice in different treatment groups;

[0028] Figure 6 It is the tumor size of pancreatic cancer mice in different treatment groups;

[0029] Figure 7 It is the spleen index of pancreatic cancer mice in different treatment groups;

[0030] Figure 8 It is the thymus index of pancreatic cancer mice in different treatment groups;

[0031] Figure 9 It is the concentration of interleukin-6 (IL-6) in the serum of pancreatic cancer mice in different treatment groups;

[0032] Figure 10 It is the concentration of tumor necrosis factor-α (TNF-α) in the serum of pancreatic cancer mice in different treatment groups;

[0033] Figure 11 It is the concentration of interleukin-12 (IL-12) in the serum of pancreatic cancer mice in different treatment groups;

[0034] Figure 12 It is the concentration of interferon-γ (IFN-γ) in the serum of pancreatic cancer mice in different treatment groups;

[0035] Figure 13 It is the concentration of nitric oxide (NO) in the serum of pancreatic cancer mice in different treatment groups;

[0036] Figure 14 It is the weight change of colorectal cancer mice in different treatment groups;

[0037] Figure 15 represents the colon length of colorectal cancer mice in different treatment groups;

[0038] Figure 16 represents the concentration of interleukin-6 (IL-6) in the colon of colorectal cancer mice in different treatment groups;

[0039] Figure 17 represents the concentration of tumor necrosis factor-α (TNF-α) in the colon of colorectal cancer mice in different treatment groups;

[0040] Figure 18 represents the concentration of interleukin-1β (IL-1β) in the colon of colorectal cancer mice in different treatment groups;

[0041] Figure 19 represents the concentration of interferon-γ (IFN-γ) in the colon of colorectal cancer mice in different treatment groups. Detailed implementation manners

[0042] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0043] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0044] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0045] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the present invention specification, which are obvious to those skilled in the art. Other implementation manners obtained from the present invention specification are obvious to those skilled in the art. The present invention specification and examples are only exemplary.

[0046] As used herein, terms such as "comprising", "including", "having", "containing", etc. are all open-ended terms, meaning including but not limited to.

[0047] The Ganoderma lucidum strain SS30 in the present invention has been disclosed in the Chinese patent "CN 114350525 A A Ganoderma lucidum Strain SS30 and Its Application". It is preserved in the General Microbiology Center of the China Microbial Culture Collection Center (CGMCC), located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The preservation date is September 30, 2021, and the preservation number is CGMCC No. 23283.

[0048] Unless otherwise specified, the test methods used in the following examples of the present invention are all conventional methods in the art; the materials, reagents, etc. used, unless otherwise specified, are all reagents and materials that can be obtained commercially.

[0049] Example 1 Preparation of Ganoderma lucidum mycelium polysaccharide

[0050] 1. Ganoderma lucidum samples: Ganoderma lucidum strain SS30 and its original strain

[0051] A certain amount of mycelium was taken from the cultured original strain and Ganoderma lucidum strain SS30, ground into powder in liquid nitrogen, and the total DNA of the two strains was extracted according to the kit instructions. Subsequently, pre-denaturation was carried out at 94 °C for 4 min, annealing at 55.5 °C for 1 min, extension at 72 °C for 4 min, for 35 cycles; extension at 72 °C for 5 min for PCR amplification. The amplified product was sequenced, and the ITS sequence obtained by sequencing was analyzed by online BLAST analysis in the NCBI database and DNA star software. The genomic sequences of the original strain and Ganoderma lucidum strain SS30 obtained were significantly different, indicating that Ganoderma lucidum strain SS30 is a newly mutagenized strain.

[0052] The gene sequence of the original strain is shown in SEQ ID NO.1:

[0053] CCTTAAGGGACGGGAAATCTACCTGAATTTGAGGTCAGAGGTCATAAAGCTGTCTCACAAACGAGACGGTTAGAAGCTCGCCAAAACGCTTCACGGTCACGGCGTAGACATTATCACACCGAGAGCCGATCCGCAAGGAATCAAGCTAATACATTTAAGAGGAGCCGACCGAAACACGGCCGACAAGCCTCCAAGTCCAAGCCTACAAACCCGCAAAGGTTTGTAAGTTGAAGATTTCATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTACATAGATGCGTTACATCGCAATACACATTCTAATACTTTATAGAGTTTGTGGTAAACGCAGGCACAGACACGCTCTACAAGCTCCGTAAAGAGCCCGCTTCACGACGTCTGAAGCCCACAGTAAGTGCACAGGTGTAGAGTGGATGAGCAGGGCGTGCACATGCCTCGGGAGGCCAGCTACAACCCAGTCAAAACTCGATAATGATCCTTCCGCAGGTTCCCCCTACGGAAG。

[0054] The gene sequence of Ganoderma lucidum strain SS30 is shown in SEQ ID NO.2:

[0055] CGTGAACGGCTGTCTACTGATTTGAGGTCAGAGGTCATAAAGCTGTCTCACAAACGAGACGGTTAGAAGCTCGCCAAAACGCTTCACGGTCACGGCGTAGACATTATCACACCGAGAGCCGATCCGCAAGGAATCAAGCTAATACATTTAAGAGGAGCCGACCGAAACACGGCCGACAAGCCTCCAAGTCCAAGCCTACAAACCCGCAAAGGTTTGTAAGTTGAAGATTTCATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTACATAGATGCGTTACATCGCAATACACATTCTAATACTTTATAGAGTTTGTGGTAAACGCAGGCACAGACACGCTCTACAAGCTCCGTAAAGAGCCCGCTTCACGACGTCTGAAGCCCACAGTAAGTGCACAGGTGTAGAGTGGATGAGCAGGGCGTGCACATGCCTCGGGAGGCCAGCTACAACCCAGTCAAAACTCGATAATGATCCTTCCGCAGGTTCACCTACGGAAG。

[0056] 2. Preparation of Ganoderma lucidum mycelium polysaccharide

[0057] 2.1 Preparation of polysaccharide from Ganoderma lucidum strain SS30 mycelium

[0058] After drying the Ganoderma lucidum strain SS30 mycelium, it was crushed and passed through an 80-mesh sieve, and then mixed with 90% ethanol solution at a ratio of 1 g:1 mL. The ultrasonic power was set at 100 W, and ultrasonic extraction was carried out at 40 °C for 40 min. Then, the precipitate was collected by centrifugation at 6000 r / min, and the extraction was repeated once. The organic reagent was evaporated to dryness.

[0059] The mycelial polysaccharide was extracted by hot water extraction method. The extraction temperature was 80 °C, the solid-liquid ratio was 1:30, the extraction time was 80 min, and the supernatant was combined after extraction twice. It was concentrated to 1 / 5 of the original volume and freeze-dried for standby. The freeze-dried powder was configured into a 5 mg / mL solution and mixed with sevag reagent (chloroform: n-butanol = 4:1) at a volume ratio of 1:1. The mixture was fully mixed and reacted for 1 h with a magnetic stirrer, centrifuged at 7000 r / min for 10 min, and the upper layer solution was separated and collected. Sevag reagent was added to the upper layer solution at a volume ratio of 2:1, and the reaction was repeated for 1 h. Then it was centrifuged at 7000 r / min for 10 min, and the upper layer solution was separated and collected. The organic reagent was removed by rotary evaporation under reduced pressure, and the concentrated solution was collected. The concentrated solution was loaded into a dialysis bag with a molecular weight cut-off of 8000 - 12000 Da, buried in a water-absorbing gel, and the dialysis solution was concentrated at low temperature to 1 / 5 of the original volume. The dialysis solution in the dialysis bag was sucked out and freeze-dried. The freeze-dried product was configured into a 1 mg / mL sample solution, and eluted with a DEAE Sepharose Fast Flow column (1.5×90 cm). The eluents were water and 0.1 - 0.3 mol / L sodium chloride solution in gradient elution. The amount of eluent used was 500 mL, and the elution flow rate was 10 mL / 15 min. The elution peak (the eluent from 170 to 260 mL) was collected. The eluent was loaded into a dialysis bag with a molecular weight cut-off of 8000 - 12000 Da, dialyzed with pure water, and freeze-dried to obtain the mycelial polysaccharide of Ganoderma lucidum strain SS30.

[0060] A 2 mg / mL solution of the mycelial polysaccharide of Ganoderma lucidum strain SS30 was prepared. After passing through a 0.22 μm microporous filter membrane, it was detected and the chromatogram was recorded by a PLaquagel-OH Mixed-H (7.5×300 mm) chromatographic column. The chromatographic conditions were a differential refractive index detector and a dual-angle laser light scattering detector; the flow rate was 1.0 mL / min, the column temperature was 45 °C, and the injection volume was 50 μL; the mobile phase was 0.1 mol / L sodium nitrate (0.01% sodium azide) with isocratic elution. The results are as Figure 1 shown. It can be seen that the polysaccharide chromatogram shows a single symmetric peak, indicating that the purity of the mycelial polysaccharide of Ganoderma lucidum strain SS30 is greater than 98.0%, and the average molecular weight is 1.57×10 6 Da.

[0061] 2.2 Mycelial polysaccharide of the original strain

[0062] The mycelial polysaccharide of the original strain was prepared with reference to the process of "2.1 Preparation of the mycelial polysaccharide of Ganoderma lucidum strain SS30".

[0063] 3. Structural analysis of the mycelial polysaccharide of Ganoderma lucidum strain SS30

[0064] Prepare a polysaccharide solution of Ganoderma lucidum strain SS30 mycelium at a concentration of 5 mg / mL. Add 2 mol / L trichloroacetic acid, fill with nitrogen, hydrolyze at 110 °C for 2 h, and then dry. Add 0.05 mL of 0.3 mol / L NaOH and 0.05 mL of PMP methanol solution, fill with nitrogen, heat in a water bath at 70 °C for 60 min. After taking it out, cool to room temperature, add 0.5 mL of 0.3 mol / L HCl, make up the volume to 2 mL with water, add 1 mL of chloroform, shake well, let it stand for layering, discard the lower chloroform layer, and repeat the extraction three times. The aqueous layer is filtered through a 0.45 μm filter membrane and determined by a C18 Agilent (4.6 mm * 250 mm * 5 μm) chromatographic column. The chromatographic conditions are Agilent 1200 and ultraviolet detector; the flow rate is 1.0 mL / min, the column temperature is 25 °C, the injection volume is 20 μL, and the detection wavelength is 245 nm; mobile phase A is 0.1 M KH2PO4 (pH 6.8), and B is acetonitrile. The results are as Figure 2 shown. It can be seen that this polysaccharide is a heteropolysaccharide composed of glucose, galactose, mannose, fucose, xylose, arabinose, rhamnose, glucuronic acid, glucosamine, ribose, and galacturonic acid, and its molar ratio is 466.0:101.9:41.4:22.3:7.8:5.6:4.5:3.2:3.2:1.7:1. The above results indicate that this polysaccharide is mainly composed of glucose and contains acidic sugars such as galactose, a small amount of mannose, and fucose.

[0065] Dry potassium bromide and the polysaccharide. Mix potassium bromide and the polysaccharide of Ganoderma lucidum strain SS30 mycelium in a mass ratio of 1:100, grind them, press into tablets, and scan in the range of 4000 - 400 cm -1 . The number of scans is 64, and the resolution is 4 cm -1 . The results are as Figure 3 shown. It can be seen that this polysaccharide has characteristic absorption peaks of cellulose-like polysaccharides. Among them, the broad absorption peak near the wavelength of 3564 cm -1 is generated by the stretching vibration of the O - H bond, indicating that there are more intramolecular hydrogen bonds, which increases the hydrophilicity of the polysaccharide; the stretching vibration caused by the methyl and methylene C - H of sugars appears near the wavelength of 2900 cm -1 . The characteristic peak of carboxyl or aldehyde group appears near the wavelength of 1600 cm -1 , indicating that the polysaccharide residue contains uronic acid; the stretching vibration caused by the C - O - C of the pyranose ring appears around the wavelength of 1000 cm -1 . The C - H bending vibration at the wavelength of 845 cm -1 belongs to the α - type glycosidic bond in the polysaccharide respectively, indicating that the polysaccharide of Ganoderma lucidum strain SS30 mycelium is an α - configuration pyranose.

[0066] Example 2 Verification of the Efficacy of Ganoderma lucidum Mycelium Polysaccharide

[0067] 1. In vitro tumor cell inhibition experiment - Pancreatic cancer

[0068] Pancreatic cancer cells SW1990 cultured to the logarithmic growth phase were adjusted to a cell concentration of 5×10 4 cells / mL, added to a 96-well plate, 100 μL per well, and cultured at 37 °C with 5% CO2 for 24 h. A blank group, a control group, and a drug administration group were set up. Among them, 100 μL of complete medium was added to each well in the blank group; 100 μL of the counted cell suspension was added to the control group; 100 μL of cell suspensions containing mycelial polysaccharide at 0.05 mg / mL, 0.10 mg / mL, 0.20 mg / mL, 0.40 mg / mL, and 0.80 mg / mL were added to the drug administration group. There were 5 replicate wells in each group. The 96-well plate was placed in a cell culture incubator and cultured for 48 h. The culture medium was poured out, 100 μL of 10% CCK-8 culture medium was added, and incubated in a 37 °C incubator for 4 h. The light absorption value was detected at 450 nm, and the growth inhibition rate of mycelial polysaccharide on pancreatic cancer cells was calculated. Cell growth inhibition rate (%) = (average OD value of the control group - average OD value of the intervention group) / (average OD value of the control group - average OD value of the blank group) × 100%. The half-maximal inhibitory concentration (IC 50 ) was calculated using Prism 7.0.

[0069] The results are as Figure 4 shown. It can be seen that mycelial polysaccharide at different concentrations has different degrees of inhibitory effects on the growth of pancreatic cancer cells SW1990. When the concentration of mycelial polysaccharide is greater than 50 μg / mL, the cell inhibition rate increases significantly, and the difference reaches an extremely significant level (P < 0.01). The half-maximal inhibitory concentration (IC 50 ) is 90.1 μg / mL, indicating that mycelial polysaccharide has an inhibitory effect on the growth of SW1990 cells and shows concentration dependence.

[0070] 2. In vivo tumor inhibition experiment - Pancreatic cancer

[0071] Pancreatic cancer cells SW1990 cultured to the logarithmic growth phase were made into a concentration of 8×10 7A cell suspension of [[X]] cells / mL was mixed with Matrigel at a ratio of 1:1. During inoculation, it was continuously mixed evenly, and 0.15 mL was subcutaneously injected into the right axilla of each mouse. Eight days after inoculation, the inoculated mice were randomly divided into 5 groups, namely the blank group, the model group, the positive group (fermented mycelium polysaccharide of the original strain), and the high- and low-dose mycelium polysaccharide groups, with 10 mice in each group. Among them, the blank group and the model group were intragastrically administered with normal saline; the positive group was intragastrically administered with 200 mg / kg of fermented mycelium polysaccharide of the original strain; the high- and low-dose groups were intragastrically administered with 200 mg / kg and 100 mg / kg of mycelium polysaccharide of Ganoderma lucidum strain SS30 respectively, once a day for 2 consecutive weeks. During this period, the growth status, mental state, and hair condition of the mice were observed every day. The results showed that 8 days after inoculating tumor cells, by examining the size of the tumor mass under the axilla of the mice after modeling, the modeling success rate was 95%. The movement of the mice in the model group gradually became slow, the mental state was listless, and the hair became gradually messy and dull; the state of the positive group was restored to a certain extent; the mental state of the mice in the high-dose mycelium polysaccharide group was better than that of the low-dose group and the positive group. The body weight changes of the mice in each group during the statistical experiment were as shown in Figure 5 shown. It can be seen that the body weight of the mice in the high-dose mycelium polysaccharide group of Ganoderma lucidum strain SS30 was higher than that of the low-dose group and the positive group.

[0072] The tumor tissues under the right axilla of the mice in each group were dissected, the total mass was weighed, and the tumor inhibition rate was calculated. The tumor inhibition rate = [(tumor weight of the model group - tumor weight of the administered group) / tumor weight of the model group] × 100%. The results were as shown in Figure 6 shown. It can be seen that both the mycelium polysaccharide of Ganoderma lucidum strain SS30 and the fermented mycelium polysaccharide of the original strain had a certain inhibitory effect on the growth of mouse tumors. Among them, the inhibitory effect of the high-dose mycelium polysaccharide group of Ganoderma lucidum strain SS30 on tumors was similar to that of the fermented mycelium polysaccharide of the original strain, slightly better than that of the fermented mycelium polysaccharide of the original strain, and both were higher than that of the low-dose mycelium polysaccharide group of Ganoderma lucidum strain SS30.

[0073] The mice in each group were dissected, the spleen and thymus were taken, weighed, and the organ coefficient was calculated. The organ coefficient = organ weight / body weight. The results were as shown in Figure 7 and Figure 8 shown. It can be seen that compared with the model group, the spleen coefficient and thymus organ coefficient of the mice in the high- and low-dose mycelium polysaccharide groups of Ganoderma lucidum strain SS30 increased, indicating that the immune function of the transplanted tumor mice was improved; the spleen index of the positive group decreased compared with the model group, and the thymus index had no significant difference from the model group. It shows that the positive regulatory effect of the mycelium polysaccharide of Ganoderma lucidum strain SS30 on the immune system of mice is stronger than that of the fermented mycelium polysaccharide of the original strain.

[0074] Blood was taken from the eyes of the mice in each group and placed in an EP tube. After centrifuging at 1000 rpm for 10 min, the serum was separated. A kit was used to measure the indexes of IL-6, IL-12, TNF-α, IFN-γ, and NO in the mouse serum. The microplate reader λ 450nmMeasure the absorbance value and calculate the concentrations of the above cytokines. The results are as Figures 9 - 13 shown. Figure 9 shown that compared with the blank group, the content of serum IL-6 in the model group increased significantly (P<0.01); compared with the model group, the content of serum IL-6 in the positive group and the high- and low-dose groups of mycelial polysaccharide of Ganoderma lucidum strain SS30 decreased significantly, and the decrease in the high-dose group of mycelial polysaccharide of Ganoderma lucidum strain SS30 was the most obvious, approaching the normal group level and being better than other groups. Figure 10 shown that compared with the blank group, the content of serum TNF-α in the model group increased significantly (P<0.01), and compared with the model group, the content of serum TNF-α in the positive group and the high- and low-dose groups of mycelial polysaccharide of Ganoderma lucidum strain SS30 decreased, and the decrease in the low-dose group was the most obvious, approaching the normal group level and being better than other groups. Figure 11 and Figure 12 shown that the contents of serum IL-12 and IFN-γ in the model group decreased compared with the blank group, and compared with the model group, the expression levels of IL-12 and IFN-γ in the positive group and the high- and low-dose groups of mycelial polysaccharide of Ganoderma lucidum strain SS30 increased, and the up-regulation in the high-dose group was the most obvious, being better than other groups. Figure 13 shown that compared with the blank group, the content of serum NO in the model group increased, reaching a significant difference (P<0.05); compared with the model group, the contents of NO in the positive group and the high- and low-dose groups of mycelial polysaccharide of Ganoderma lucidum strain SS30 decreased to varying degrees, reaching a highly significant difference (P<0.001), and the decrease in the high-dose group was the most obvious, being better than other groups.

[0075] The above experiments show that the mycelial polysaccharide of Ganoderma lucidum strain SS30 after space breeding has a stronger anti-pancreatic cancer effect than the polysaccharide of the original strain, and its inhibitory effect is related to improving the immune function of tumor-bearing mice and reducing the level of oxidative product generation.

[0076] 3. In vivo tumor inhibition experiment - colorectal cancer

[0077] A mouse model of colorectal cancer was established by intraperitoneal injection of azoxymethane (AOM) combined with free drinking of 2% dextran sulfate sodium (DSS). The mouse colorectal cancer model was randomly divided into 4 groups, namely the blank group, the model group, the positive group (fermented mycelium polysaccharide of the original strain), and the high- and low-dose mycelium polysaccharide groups, with 10 mice in each group. Among them, the blank group and the model group were gavaged with normal saline; the positive group was gavaged with 200 mg / kg of the fermented mycelium polysaccharide of the original strain; the high- and low-dose mycelium polysaccharide groups were gavaged with 200 mg / kg and 100 mg / kg of the mycelium polysaccharide of Ganoderma lucidum strain SS30 respectively, once a day for 6 consecutive weeks. During this period, the growth status, mental state, and hair condition of the mice were observed every day. It was found that the mice in the model group had diarrhea, accompanied by visible bloody stools, and the food intake decreased, the appearance was thin, the mental state was poor, the number of movements was significantly reduced, and there was piloerection on the back, and the hair was dull. In the mice given the positive drug and low- and high-dose mycelium polysaccharide, the diarrhea and bloody stools were milder, and the body weight was close to that of the normal group (P>0.05, see Figure 14 ), and the mental state and hair gloss were better than those in the model group.

[0078] After the experiment, the colon tissues of the mice in each group were taken, and the colon length was measured. The results were as Figure 15 shown. Both the low- and high-dose mycelium polysaccharide and the positive drug could reverse the colon shortening caused by the modeling drug and restore the colon length to varying degrees. Among them, the colon length of the mice in the high-dose mycelium polysaccharide group was significantly longer than that in the positive group and the low-dose mycelium polysaccharide group, and was closer to the colon length of the normal group.

[0079] The mouse colon was placed in an EP tube, and normal saline was added at a ratio of 1:9. After crushing at 50 Hz for 60 s and centrifuging at 8000 rpm for 10 min, the supernatant was separated. The levels of IL-6, IL-1β, TNF-α, and IFN-γ in the mouse colon supernatant were measured using a kit, and the absorbance was measured with a microplate reader at λ 450nm to calculate the concentrations of the above cytokines. The results were as Figures 16 - 19 shown. Figure 16 It was shown that compared with the blank group, the content of IL-6 in the colon of the model group increased extremely significantly (P<0.001); compared with the model group, the content of IL-6 in the colon of the mice in the positive drug and high- and low-dose mycelium polysaccharide groups decreased significantly. Among them, the decrease in the high-dose group of the mycelium polysaccharide of Ganoderma lucidum strain SS30 was the most obvious, which was close to the level of the normal group and was better than other groups. Figure 17 It was shown that compared with the blank group, the content of TNF-α in the colon of the model group increased extremely significantly (P<0.001). Compared with the model group, the content of TNF-α in the colon of the mice in the positive drug, high-dose mycelium polysaccharide, and low-dose mycelium polysaccharide groups decreased extremely significantly. Among them, the decrease in the positive group and the high-dose group of the mycelium polysaccharide of Ganoderma lucidum strain SS30 was the most obvious, which was close to the level of the normal group. Figure 18It was shown that, compared with the blank group, the content of IL-1β in the colon of the model group increased extremely significantly (P<0.001). Compared with the mice in the model group, the expression levels of IL-1β in the high- and low-dose mycelium polysaccharide groups and the positive group decreased significantly. Among them, the down-regulation of the high-dose mycelium polysaccharide group of Ganoderma lucidum strain SS30 was the most obvious, approaching the level of the blank group. Figure 19 It was shown that, compared with the blank group, the content of IFN-γ in the colon of the model group decreased, reaching an extremely significant difference (P<0.001). Compared with the model group, the contents of IFN-γ in the colon of mice in the high- and low-dose mycelium polysaccharide groups and the positive group increased to varying degrees, reaching a significant difference (P<0.001). Among them, the up-regulation of the high-dose mycelium polysaccharide group of Ganoderma lucidum strain SS30 was the most obvious, being superior to other groups.

[0080] The above experiments showed that the mycelium polysaccharide of Ganoderma lucidum strain SS30 after space breeding had a stronger anti-colorectal cancer effect than the polysaccharide of the original strain, and its inhibitory effect was related to the improvement of the immune function of tumor-bearing mice.

[0081] The embodiments described above are only used to describe the preferred mode of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A polysaccharide from the mycelium of Ganoderma lucidum strain SS30, characterized in that, The polysaccharide of Ganoderma lucidum strain SS30 mycelium is composed of glucose, galactose, mannose, fucose, xylose, arabinose, rhamnose, glucuronic acid, glucosamine, ribose and galacturonic acid in a molar ratio of 466.0:101.9:41.4:22.3:7.8:5.6:4.5:3.2:3.2:1.7:1, and the average molecular weight is 1.57×10 6 Da.

2. The preparation method of the Ganoderma lucidum strain SS30 mycelium polysaccharide according to claim 1, characterized in that, It includes the following steps: (1) After subjecting the mycelium of Ganoderma lucidum strain SS30 to ethanol ultrasonic extraction and hot water extraction, the supernatant is obtained; (2) After performing protein removal, dialysis, and drying treatments on the supernatant, crude polysaccharide is obtained; (3) Using water and sodium chloride solution as eluents in sequence, eluting the crude polysaccharide through a DEAE Sepharose Fast Flow column, collecting the eluate, performing dialysis and drying to obtain the polysaccharide from the mycelium of Ganoderma lucidum strain SS30.

3. The preparation method according to claim 2, characterized in that, The process of ethanol ultrasonic extraction is as follows: Mix the dried mycelium of Ganoderma lucidum strain SS30 with 85% - 95% ethanol solution at a ratio of 1 g:1 mL, and perform ultrasonic treatment for 20 - 60 min under the conditions of 80W - 120W and 35°C - 55°C; after ultrasonic extraction twice, centrifuge to collect the precipitate.

4. The preparation method according to claim 3, wherein The process of hot water extraction is as follows: Mix the precipitate with water at a solid-liquid ratio of 1:15 - 1:45, and extract at 60 - 90°C for 60 - 120 min; after extraction twice, combine the supernatants.

5. The preparation method according to claim 2, characterized in that, In step (2), the method for protein removal is the sevag method; the molecular weight cut-off of the dialysis bag used during dialysis is 8000 - 12000 Da.

6. The preparation method according to claim 2, characterized in that, The elution process is as follows: Prepare the crude polysaccharide into a sample loading solution of 1 mg / mL, use water and 0.1 - 0.3 mol / L sodium chloride solution as eluents for gradient elution, the eluent consumption is 500 mL, and collect the eluate of 170 - 260 mL.

7. The preparation method according to claim 2, characterized in that, In step (3), the molecular weight cut-off of the dialysis bag used during dialysis is 8000 - 12000 Da.

8. Use of the polysaccharide from the mycelium of Ganoderma lucidum strain SS30 described in claim 1 or the polysaccharide from the mycelium of Ganoderma lucidum strain SS30 prepared by the preparation method described in any one of claims 2 - 7 in the preparation of immunomodulatory products.

9. Use of the Ganoderma lucidum strain SS30 mycelial polysaccharide according to claim 1 or the Ganoderma lucidum strain SS30 mycelial polysaccharide prepared by the preparation method according to any one of claims 2-7 in the preparation of a product for treating cancer, characterized in that, The cancers include colorectal cancer and pancreatic cancer.

10. A product for treating cancer, characterized in that, The product contains the polysaccharide from the mycelium of Ganoderma lucidum strain SS30 described in claim 1 or the polysaccharide from the mycelium of Ganoderma lucidum strain SS30 prepared by the preparation method described in any one of claims 2 - 7; the cancers include colorectal cancer and pancreatic cancer.

Images