Separation and identification of benzo [a] pyrene degrading fungus Arthrinium acutiapiculum DL-5 in petroleum-contaminated soil, and preparation and application of microbial inoculum of Arthrinium acutiapiculum DL-5

Abstract

The invention discloses a fungus for degrading benzo [a] pyrene in petroleum-contaminated soil, and a microbial agent and application of the fungus. The fungus is a fungus for degrading benzo [a] pyrene in petroleum-contaminated soil, and the microbial agent is a fungus for degrading benzo [a] pyrene in petroleum-contaminated soil. According to the invention, a degrading strain Arthrinum acutiapicum DL-5 with benzo [a] pyrene as a carbon source is domesticated, separated and identified from petroleum-polluted soil in Ningbo, the DL-5 can utilize benzo [a] pyrene as the carbon source, and after the DL-5 is cultured in an inorganic salt culture solution with the initial concentration of benzo [a] pyrene being 25 mg / L <-1 > for 7 days, the degradation rate of the pure strain of the DL-5 on benzo [a] pyrene can reach 75% or above. And after the strain is prepared into the microbial inoculum, the degradation rate of benzo [a] pyrene can be increased to 80% or above, so that the strain and the microbial inoculum thereof have relatively good application potential in the aspect of bioremediation of polycyclic aromatic hydrocarbons.

Description

Technical Field

[0001] The present invention belongs to the field of degradation of organic pollutants, and particularly relates to the isolation and identification of a benzo[a]pyrene-degrading fungus Arthrinium acutiapicum DL-5 from petroleum-contaminated soil, as well as the preparation and application of its microbial agent. Background Art

[0002] With the rapid development of modern industrial processes, more and more pollutants are generated in industrial operations, especially persistent organic pollutants such as polycyclic aromatic hydrocarbons (PAHs). PAHs are ubiquitous and continuously accumulate in the environment. Due to the potential carcinogenic, teratogenic, mutagenic and bioaccumulative properties of PAHs, they can pose a major threat to the ecological environment and human health. Therefore, PAHs pollution has attracted wide attention. Anthropogenic activities such as industrial and mining, agriculture, and high background values of the soil environment often lead to serious over-standard of polycyclic aromatic hydrocarbons in the environment and cause pollution. In addition, most of the main pollutants in important organic pollution sites such as chemical industrial parks and their surrounding soils, oil production areas, mining areas, and sewage irrigation areas contain high concentrations of polycyclic aromatic hydrocarbons. Benzo[a]pyrene is a five-ring aromatic hydrocarbon, and it has a very close relationship with the carcinogenicity of PAHs.

[0003] The natural attenuation of toxic and harmful organic pollutants in the environment mainly depends on the metabolic action of related microorganisms. Bioremediation technology has the advantages of low cost, good effect, and no secondary pollution. Therefore, this method is the most potential remediation means for PAHs pollution remediation at present. At present, few benzo[a]pyrene-degrading fungal strains have been reported, mainly including Trichoderma, Scedosporium, Fusarium, Penicillium, and Aspergillus, etc. Since most microorganisms in the environment are unculturable, many microorganisms, especially those with specific functions, cannot be isolated by pure culture methods. Therefore, screening out strains that can effectively degrade high-concentration benzo[a]pyrene has important application value and practical significance. In this experiment, benzo[a]pyrene with a mass concentration of 25 mg·L -1 was used as the substrate for strain degradation, in order to provide data support for the biological treatment of polycyclic aromatic hydrocarbons. Summary of the Invention

[0004] The first object of the present invention is to provide a strain Arthrinium acutiapicum DL-5 with the ability to degrade benzo[a]pyrene, which was deposited on February 26, 2025 at the Guangdong Microbial Culture Collection Center (GDMCC), address: 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou, Guangdong Province, zip code: 510070, deposit number: GDMCC No: 65989.

[0005] This study reports that the strain belongs to Arthrinium acutiapicum, which can be isolated from various terrestrial and aquatic habitats. Currently, there are relatively few reports on the degradation of pollutants by Arthrinium acutiapicum, and there is no research report on the degradation of benzo[a]pyrene by Arthrinium acutiapicum at home and abroad. In this study, a strain DL-5 that uses high-concentration benzo[a]pyrene as a carbon source was domesticated and isolated from a petroleum-polluted site in Ningbo, identified, and its growth characteristics were studied. At the same time, a microbial agent was prepared to explore its degradation characteristics of benzo[a]pyrene, providing a reference for the bioremediation of PAHs-polluted environments.

[0006] The second object of the present invention is to provide the application of the above-mentioned Arthrinium acutiapicum DL-5 in the degradation of benzo[a]pyrene.

[0007] Preferably, the degradation of benzo[a]pyrene is the degradation of benzo[a]pyrene in petroleum-polluted soil.

[0008] Preferably, Arthrinium acutiapicum DL-5 is applied to degrade benzo[a]pyrene in an environment polluted by benzo[a]pyrene.

[0009] The third object of the present invention is to provide a benzo[a]pyrene-degrading microbial agent, which contains the above-mentioned Arthrinium acutiapicum DL-5 as an active ingredient.

[0010] Preferably, the preparation method of the benzo[a]pyrene-degrading microbial agent is as follows:

[0011] 1) After heating corn and water in a mass ratio of 1:5 to make a paste, add sawdust, wheat bran, and sodium lignosulfonate in a mass ratio of 150:100:10:1, knead into a ball, and put the mixture of the spherical culture medium into a pill-making machine to obtain spherical culture medium, sterilize and dry for later use;

[0012] 2) Make the cultured Arthrinium acutiapicum DL-5 into a bacterial solution;

[0013] 3) Add the bacterial solution in 2) to a 3% sodium alginate solution in a mass ratio of 1:10, fully mix the spherical culture medium in 1) with this solution, and after completion, add a 4% sterile calcium chloride solution for hardening treatment to obtain pill-shaped encapsulated fungi;

[0014] 4) Put the encapsulated fungal pellets into a sterile culture bag, culture in an incubator at 28°C for 3-7 days, and when the surface is covered with white mycelia, it is the benzo[a]pyrene-degrading microbial agent.

[0015] Preferably, in step 2), the bacterial liquid is a bacterial liquid with a mycelium content of 10 g / L.

[0016] The fourth object of the present invention is to provide a method for degrading benzo[a]pyrene, which is to sprinkle the above-mentioned Arthrinium acutiapicum DL-5 on an environment containing benzo[a]pyrene to degrade benzo[a]pyrene.

[0017] Preferably, Arthrinium acutiapicum DL-5 is sprinkled on an environment polluted by benzo[a]pyrene to degrade benzo[a]pyrene.

[0018] Preferably, Arthrinium acutiapicum DL-5 is sprinkled on petroleum-contaminated soil to degrade benzo[a]pyrene.

[0019] The present invention domesticated and isolated a degradation strain DL-5 using benzo[a]pyrene as a carbon source from a petroleum-contaminated soil in Ningbo. According to the strain morphology, physiological characteristics, ITS gene sequencing analysis and phylogenetic analysis, the strain was identified as Arthrinium acutiapicum DL-5. The optimal environmental conditions for growth are: temperature is 33 °C, pH value is 7, and sodium chloride is not added; the ITS gene sequencing analysis results of the strain show that the strain closest to DL-5 is Arthrinium acutiapicum KUMCC20-0209 (99.34%). DL-5 can utilize benzo[a]pyrene as a carbon source. In an inorganic salt culture solution with an initial concentration of benzo[a]pyrene of 25 mg·L -1 After culturing for 7 days, the degradation rate of benzo[a]pyrene by the pure bacteria of DL-5 can reach more than 75%. After DL-5 is made into a bacterial agent, the degradation rate of benzo[a]pyrene can be increased to more than 80%. Therefore, the strain DL-5 and its bacterial agent have good application potential in the bioremediation of polycyclic aromatic hydrocarbons.

[0020] Arthrinium acutiapicum DL-5 was deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC) on February 26, 2025. Address: 5th Floor, Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou, Guangdong Province, Postcode: 510070, Deposit Number: GDMCC No: 65989. Description of the Drawings

[0021] Figure 1 It is the front and back of the strain DL-5 growing on the PDB medium for 7 days in Example 1.

[0022] Figure 2is the phylogenetic relationship based on the ITS gene sequence of the strain DL-5 and its related bacteria in Example 1. The construction method is the neighbor-joining method, and the bootstrap value is set to be repeated 1000 times. Only the results with a bootstrap value greater than 50% are shown in the figure, and the scale bar 0.01 represents the substitution rate per nucleotide.

[0023] Figure 3 is the growth of the strain DL-5 in Example 2 under different culture temperatures, salinities, and pH values.

[0024] Figure 4 is the degradation efficiency of the strain DL-5 and the DL-5 bacterial agent in the inorganic salt medium containing benzo[a]pyrene (initial concentration 25 mg·L -1 ). Detailed implementation manners

[0025] In order to make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. In addition, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0026] Example 1 Isolation and identification of Arthrinium acutiapicum DL-5

[0027] 1. Materials and methods

[0028] 1.1 Sample source

[0029] Soil samples were obtained from an oil-polluted site in Ningbo and were acclimated for a long time using high-concentration benzo[a]pyrene as a carbon source. High-efficiency benzo[a]pyrene-degrading strains were obtained through multiple screening and isolation and purification.

[0030] 1.2 Culture media

[0031] 1.2.1 Inorganic salt medium

[0032] The inorganic salt medium was used for the enrichment culture of microorganisms in the samples and the benzo[a]pyrene degradation experiments under pure bacteria and bacterial agent conditions. The formulation of this medium is shown in Table 1 (containing benzo[a]pyrene solution), and its preparation method is to add each component to the solvent water, mix evenly, and sterilize to obtain.

[0033] Table 1 Formulation of inorganic salt medium

[0034]

[0035]

[0036] 1.2.2 Nutrient medium

[0037] The nutrient medium is used for the cultivation of conventional microorganisms such as the isolation, purification, preservation, and activation of fungi. The types and components of the nutrient medium used in this experiment are shown in Table 2. If it is necessary to prepare a solid medium for the experiment, only 1.5 - 2% agar powder needs to be added based on the original medium formula. If there is no special instruction for the cultivation conditions of the strain, the pH of the medium is adjusted to 7. The preparation method of the nutrient medium is to add each component to the solvent water, mix evenly, and sterilize to obtain it.

[0038] Table 2 Components of Potato - Dextrose broth medium (PDB)

[0039]

[0040] 1.3 Domestication, screening, and isolation of strains

[0041] The collected contaminated soil was added to the above - mentioned inorganic salt medium, and streptomycin sulfate and penicillin (concentration 100 μg / ml) were added to inhibit the growth of bacteria. Benzo[a]pyrene at a concentration of 50 mg·L -1 was used as the degradation substrate and placed in a 28°C incubator for dark shaking culture. The inorganic salt medium with benzo[a]pyrene as the carbon source was used for strain domestication, with a 7 - day domestication cycle. A 10% inoculum was transferred to a fresh inorganic salt medium with the same culture system and the above - mentioned enrichment process was repeated, and this was repeated three times.

[0042] The fourth - generation enriched culture sample obtained above was spread and separated by the dilution - plate method, and the sample was separated with the nutrient medium. The spread sample was placed in an incubator at the original culture temperature. After about 48 hours, obvious single colonies formed on the surface of the medium. According to the morphological size, color, hyphae and other characteristics of the colonies, several different single colonies were picked and streaked and purified on the nutrient medium plate for cultivation. If different - characteristic single colonies could still be observed on the plate after streaking and purification, they were streaked and separated again until only single colonies with the same characteristics could be observed on the same plate. One strain DL - 5 with high - efficiency degradation performance for benzo[a]pyrene was screened in the experiment. The purified single colony was picked into the corresponding solid - tube nutrient medium for cultivation, sealed with sterilized liquid paraffin, and placed at - 4°C for long - term preservation.

[0043] 1.4 Identification of strains

[0044] Strain DL - 5 was identified according to its morphological characteristics and molecular biological characteristics.

[0045] 1.4.1 Morphological characteristics

[0046] DL-5 is a fungus isolated from oil-polluted soil in Ningbo. After activation, it can form a colony with a diameter of 12.5 mm on a PDB plate after growing for 7 days at 28°C under aerobic conditions. The colony is white, round, and has white fluffy mycelia growing upwards. This fungus is an obligate aerobe( Figure 1 ).

[0047] 1.4.2 Molecular biological characteristics

[0048] The identification of molecular biological characteristics mainly includes sequencing and the construction of phylogenetic trees. Before sequencing and constructing phylogenetic trees, it is necessary to extract the DNA of the fungus (the rapid extraction kit for fungal genomic DNA used in the experiment is from Sangon Biotech (Shanghai) Co., Ltd.). To study the taxonomy of fungi, it is usually necessary to amplify the ITS gene and construct a phylogenetic tree. The amplified gene is a segment of DNA that constitutes a part of the rRNA encoded in eukaryotes. Because of its high conservation, specificity, and appropriate sequence length, it is usually used for the detection and identification of fungi.

[0049] Polymerase chain reaction (PCR) is mainly used to amplify different gene fragments. PCR requires different primers (ITS1: 5'-TCCGTAGGTGAACCTGCGG-3'; ITS4: 5′-TCCTCCGCTTATTGATATGC-3′). The system of the PCR amplification reaction: 10×buffer 2.5 μl, Mg 2+ (25 mmol / l) 1.5 μl, dNTP (25 mmol / l) 0.3 μl, forward primer (10 mmol / l) 0.5 μl, reverse primer (10 mmol / l) 0.5 μl, Taq enzyme: 0.25 μl, DNA group template 0.1 μl, deionized water 19.35 μl. The PCR amplification reaction conditions: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 45 s, annealing at 56°C for 30 s, extension at 72°C for 45 s, 30 cycles. Extension at 72°C for 10 min, and after the reaction is completed, it is stored at 4°C. After amplifying the required gene, a gel block is prepared with 0.75 - 1% agarose and added with the nucleic acid stain GelRed. The PCR product and the DNA marker (maker) containing various length fragments are added to the gel block and placed in an electrophoresis apparatus. The electrophoresis apparatus is filled with TBE (Tris-borate) buffer, and after the electrophoresis apparatus works at a certain voltage for 20 min, it is taken out and placed under a 300 nm ultraviolet lamp for observation to determine the success of the PCR product amplification reaction. Then the successfully amplified PCR product is sequenced, and the sequencing primers are the same as the amplification primers.

[0050] The fungal ITS gene sequences obtained by sequencing were uploaded to EzTaxon-e (http: / / eztaxon-e.ezbiocloud.net / ). This website will compare the submitted sequences with the ITS gene sequences of the type strains of recognized species to obtain the similarity information between the sequences. According to the results of sequence alignment analysis, the corresponding type strain can be selected as the reference strain for the isolated strains in this experiment. At the same time, the ITS gene sequence of the reference strain can be obtained, and a phylogenetic analysis can be constructed to prove the differences between the reference strain and the isolated strains in the experiment, so as to identify the isolated strains. The phylogenetic tree was constructed using the MEGA 5.05 program. Usually, the neighbor-joining method, the minimum evolution method, and the maximum parsimony method are used to construct the phylogenetic tree. Among them, the neighbor-joining method is the most commonly used, and the bootstrap value is usually set to be calculated 1000 times repeatedly.

[0051] A 603bp ITS gene sequence obtained by PCR and gene sequencing. Through ITS gene alignment, it was found that the gene similarity of this strain with Arthrinium acutiapicum KUMCC 20-0209 (accession number MT946342.1 in GenBank) was 99.34%. From the above results, it can be concluded that the isolated fungus DL-5 in this experiment belongs to the species Arthrinium acutiapicum.

[0052] The phylogenetic tree was constructed using the ITS gene sequence of DL-5 and the ITS gene sequences with relatively high similarity to it, so as to obtain the homology results between the ITS gene of DL-5 and the ITS genes with relatively high similarity to it. The phylogenetic tree constructed by the neighbor-joining method is shown in Figure 2 . At present, there are few reports on the application of this strain in the environmental field. Therefore, obtaining efficient benzo[a]pyrene-degrading bacteria has important theoretical and practical significance for the treatment and in-depth remediation of benzo[a]pyrene-polluted soil and water and PAHs pollution.

[0053] The ITS gene sequence of DL-5 is shown in SEQ ID NO.1, specifically:

[0054] CCTGCGGAGGGATCATTACAGAGTTATACAACTCCCACACCATTTGCCAACTTTACTCAGTTATGCCTCGGCGTAAGCTCCGTACGGGGCTGCCGGGTTGCGCTGCGGGCGACAGCTACCCTGTAGCTTACCCTGTAGCGCTACCCTGTAGCGTTACCCTGCGGCGGCCCGCCGGTGGAAACGAAACTCTTGTTTTATTGTATCTTCTGAGCGTCTTATTTTAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATCAGTATTCTGGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCGACCGTAGGGTCGTTCCTTAAAGACAGTGGCGGAGCGGCAGTGGTCCTCTGAGCGTAGTAAATTTATTTCTCGCTTTTGTCAGGCCCTGTCCTCCCGCCATAAAACCCCCAATTTTTTAGTGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAGGCCGGAGGA。

[0055] From the above results, it can be concluded that the strain DL-5 isolated in this experiment is the species Arthrinium acutiapicum, which is named Arthrinium acutiapicum DL-5. It was deposited at the Guangdong Microbial Culture Collection Center (GDMCC) on February 26, 2025. Address: 5th Floor, Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou, Guangdong Province, Zip Code: 510070, Deposit Number: GDMCC No: 65989.

[0056] Example 2 Growth Conditions of Arthrinium acutiapicum DL-5

[0057] Determination of growth temperature:

[0058] Prepare the nutrient medium required for the growth of the strain (Example 1). After preparation, take it to the autoclave for sterilization. Inoculate the activated strain Arthrinium acutiapicum DL-5 into the nutrient medium (experimental group), and use the nutrient medium without inoculating fungi as the control (control group). Place the medium in different temperatures for 7 days. There are three replicates for the control group and each experimental group corresponding to each temperature. Observe the growth of the fungi every day. After 7 days, pour the medium into a weighed centrifuge tube and centrifuge at 4500 rpm for 30 min. After pouring out the supernatant, place it in an oven at 60 °C and dry it to a constant weight, then weigh and calculate the dry weight of the fungal mycelium. The test temperatures are as follows: 18 °C, 23 °C, 28 °C, 33 °C, and 38 °C.

[0059] Determination of growth pH:

[0060] Prepare the nutrient medium required for the growth of the strain (Example 1). Adjust the pH of the culture solution with the following buffer systems: pH 4.0 - 5.0, 0.1 mol / l sodium citrate and 0.1 mol / l citric acid; pH 6.0 - 8.0, 0.1 mol / l NaOH and 0.1 mol / l KH2PO4; pH 9.0, 0.1 mol / l NaHCO3 and 0.1 mol / l Na2CO3. Inoculate the fungus Arthrinium acutiapicum DL-5 into the medium. There are three replicates for each pH. Use the nutrient medium without inoculating fungi as the control. Place the medium in the optimal temperature for the growth of the new bacteria and culture for 7 days. Observe the growth of the fungi every day. After 7 days, pour the medium into a weighed centrifuge tube and centrifuge at 4500 rpm for 30 min. After pouring out the supernatant, place it in an oven at 60 °C and dry it to a constant weight, then weigh and calculate the dry weight of the fungal mycelium. The tested pH values are as follows: 4.0, 5.0, 6.0, 7.0, 8.0, 9.0.

[0061] Salt concentration tolerance:

[0062] Prepare the nutrient medium required for the growth of the strain (Example 1). Adjust the salt concentration of the medium. Inoculate the activated new strain Arthrinium acutiapicum DL-5 into the sterilized medium. There are three replicates for each salt concentration. Use the nutrient medium without inoculating bacteria as the control. Place the medium in the optimal temperature for the growth of the new bacteria and culture for 7 days. After 7 days, pour the medium into a weighed centrifuge tube and centrifuge at 4500 rpm for 30 min. After pouring out the supernatant, place it in an oven at 60 °C and dry it to a constant weight, then weigh and calculate the dry weight of the fungal mycelium to obtain the range of salt concentration that the new bacteria can tolerate at best. The tested salt concentrations are as follows: mass fraction 0%, 2%, 4%, 6%, 8%, 10%.

[0063] The results are as Figure 3As shown, in nutrient broth medium, DL-5 can grow at temperatures ranging from 18 to 38 °C, and the optimal growth temperature is 33 °C, which is the enrichment temperature of this bacterium; this bacterium can grow under pH conditions of 4.0 - 9.0, and the optimal growth pH is 7.0; the salt tolerance ability of this bacterium is weak, and it grows best without salt, and can grow under conditions where the salt concentration is 0% to 6%, but its growth significantly decreases as the salinity increases, and it hardly grows at 8%.

[0064] Example 3 Degradation experiment of benzo[a]pyrene by Arthrinium acutiapicum DL-5 and its bacterial agent

[0065] 1. Preparation of the bacterial agent, the steps are as follows:

[0066] 1) After heating corn and water in a mass ratio of 1:5 to make a paste, add sawdust (sieved through 200 meshes), wheat bran, and sodium lignosulfonate in a mass ratio of 150:100:10, knead into a ball, and put the spherical culture medium mixture into a pill-making machine to make spherical culture media with a diameter of 8 mm, sterilize and dry for later use.

[0067] 2) Make the cultured DL-5 fungus into a bacterial solution with a mycelium content of 10 g / L.

[0068] 3) Add the bacterial solution to a 3% sodium alginate solution in a mass ratio of 1:10, fully mix the above spherical culture medium with this solution, and after completion, add a 4% sterile calcium chloride solution and perform hardening treatment for 20 min to obtain pill-shaped encapsulated fungi.

[0069] 4) Put the encapsulated fungal pellets into a sterile culture bag, and culture them in an incubator at 28 °C for 3 - 7 days. When the surface is covered with white mycelium, it is the DL-5 bacterial agent.

[0070] 2. Benzo[a]pyrene degradation experiment

[0071] The strain DL-5 or DL-5 bacterial agent (DL-5-agent) after 7 days of activation culture was inoculated into the inorganic salt medium (Example 1) containing initially 25 mg·L -1 of benzo[a]pyrene, and cultured with shaking. Each treatment had 3 replicates, and the culture conditions were: temperature 33 °C, pH 7.0, without adding NaCl. The inoculation amounts of pure bacteria DL-5 and DL-5 bacterial agent were both 10% by mass. The treatment without adding pure bacteria and bacterial agent was used as the control treatment.

[0072] Take each treated sample for chemical analysis. The specific steps are as follows: (1) Sample pretreatment: Add each culture sample to dichloromethane for extraction, and at the same time add 5 μL of a recovery indicator (deuterated - PAHs) with a concentration of 200 mg / L. After shaking well, transfer it to a separatory funnel and let it stand. After layering, collect the organic phase, put the lower - layer liquid back into the shaking flask, repeat the extraction with an equal volume of dichloromethane, combine the extraction solutions, and transfer them to a flat - bottom flask containing an appropriate amount of activated copper chips for rotary evaporation. Concentrate to about 2 mL, add a small amount of n - hexane (about 5 mL), rotary evaporate to 2 mL, repeat the washing three times, and replace the organic solvent with n - hexane. The concentrated solution after replacement is purified with a glass - packed column (diameter about 9 mm). The column packing from bottom to top is 3 cm of 3% deactivated neutral alumina, 3 cm of 3% deactivated silica gel, and 1 cm of anhydrous sodium sulfate. Activate the column with an appropriate amount of n - hexane, wash the packed column with 15 mL of a n - hexane / dichloromethane (volume ratio 1:1) mixed reagent, and collect about 15 mL of the eluate with a brown reagent bottle. Concentrate it to about 0.5 mL by nitrogen blowing, and finally transfer it to a 1.5 - mL vial and store it frozen. Before instrumental determination, add 5 μL of the internal standard hexamethylbenzene with a concentration of 200 mg / L. (2) Instrumental analysis: Use an Agilent 7890 gas chromatograph - 5975 mass spectrometer to determine the PAHs content in each treated sample. The chromatographic column used is an Agilent DB 5 - MS capillary chromatographic column (column length 30 m, inner diameter 0.25 mm, film thickness 0.25 μm). The obtained data is processed with an Agilent chromatographic workstation. The quantification of benzo[a]pyrene is carried out using a 6 - point calibration curve and the internal - standard method. The determination of the microbial cell concentration is carried out by the drying - and - weighing method.

[0073] The results show that the 7 - day degradation rate of benzo[a]pyrene itself is 24.2%. According to GC - MS determination and analysis, both strain DL - 5 and the microbial agent can degrade benzo[a]pyrene, and after culturing in an inorganic salt culture solution containing 25 mg / L of benzo[a]pyrene for 7 days, the degradation rate can reach over 80% ( Figure 4 ). Among them, the degradation rate of pure strain DL - 5 for benzo[a]pyrene is 82.5%, and the degradation efficiency of the microbial agent for benzo[a]pyrene is 5.7% higher than that of the pure strain, indicating that strain DL - 5 is a strong benzo[a]pyrene - degrading bacterium, and after being made into a microbial agent, the effect is better.

[0074] Conclusion:

[0075] 1) One strain of benzo[a]pyrene - degrading bacterium DL - 5 that can grow using benzo[a]pyrene as a carbon source was enriched and isolated from Ningbo petroleum - contaminated soil and made into a solid microbial agent.

[0076] 2) The strain DL-5 can form colonies that are about 12.5 mm in diameter, white, round, with white villous hyphae growing upwards. This bacterium is an obligate aerobe. According to molecular biological analysis, it can be concluded that the fungus DL-5 isolated in this experiment is the Arthrinium acutiapicum strain, and its phylogenetic tree was drawn. Currently, there are few reports on the application of this strain, especially the research on using it to degrade benzo[a]pyrene has not been reported yet.

[0077] 3) The optimal growth conditions for the strain DL-5 are a temperature of 33 °C, a pH of 7.0, and no addition of NaCl. DL-5 can use benzo[a]pyrene as a carbon source and degrade it. After culturing in an inorganic salt culture solution with an initial concentration of benzo[a]pyrene of 25 mg·L -1 for 7 days, its degradation rate can reach 82.5%. Moreover, the solid inoculant made from DL-5 has a better degradation effect on benzo[a]pyrene, reaching 88.2%. In summary, DL-5 is a strain that can degrade benzo[a]pyrene, has strong adaptability to polycyclic aromatic hydrocarbons, and the prepared inoculant has a better degradation effect, showing good application potential in bioremediation.

Claims

1. Arthrinium acutiapicum DL-5, preservation number: GDMCC No: 65989.

2. Use of Arthrinium acutiapicum DL-5 according to claim 1 in degrading benzo[a]pyrene.

3. The application according to claim 2, characterized in that, The degradation of benzo[a]pyrene is the degradation of benzo[a]pyrene in petroleum-polluted soil.

4. The application according to claim 2, wherein It is to apply Arthrinium acutiapicum DL-5 in an environment polluted by benzo[a]pyrene to degrade benzo[a]pyrene.

5. A benzo[a]pyrene-degrading microbial agent, characterized in that, It contains Arthrinium acutiapicum DL-5 according to claim 1 as an active ingredient.

6. The benzo[a]pyrene-degrading microbial agent according to claim 5, characterized in that, The preparation method of the benzo[a]pyrene-degrading bacterial agent is as follows: 1) After heating corn and water in a mass ratio of 1:5 to make a paste, add sawdust, wheat bran and sodium lignosulfonate in a mass ratio of 150:100:10:1, knead into a ball, and put the doughy culture medium mixture into a pill-making machine to obtain spherical culture medium, sterilize and dry for later use; 2) Make Arthrinium acutiapicum DL-5 into a bacterial solution; 3) Add the bacterial solution in 2) to a 3% sodium alginate solution in a mass ratio of 1:10, fully mix the spherical culture medium in 1) with this solution, and after completion, add a 4% sterile calcium chloride solution for hardening treatment to obtain pill-shaped encapsulated fungi; 4) Put the encapsulated fungal pellets into a sterile culture bag, and culture them in an incubator at 28°C for 3-7 days. When the surface is covered with white mycelia, it is the benzo[a]pyrene-degrading bacterial agent.

7. The benzo[a]pyrene-degrading microbial agent according to claim 6, characterized in that, In step 2), the bacterial solution is a bacterial solution with a mycelium content of 10 g / L.

8. A method for degrading benzo[a]pyrene, characterized in that, Sprinkle Arthrinium acutiapicum DL-5 according to claim 1 on an environment containing benzo[a]pyrene to degrade benzo[a]pyrene.

9. The method according to claim 8, wherein It is to sprinkle Arthrinium acutiapicum DL-5 on an environment polluted by benzo[a]pyrene to degrade benzo[a]pyrene.

10. The method according to claim 8, wherein It is to sprinkle Arthrinium acutiapicum DL-5 on petroleum-polluted soil to degrade benzo[a]pyrene.

Images