Tremella fuciformis fermentation liquor rich in fucose as well as preparation method and application of tremella fuciformis fermentation liquor

By screening and cultivating the fungal strain Tremella fuciformis FEJ001 rich in fucose, and using the Candida fermentation process to prepare a fucose-rich Tremella fermentation broth, solving the problem of low fucose content in the prior art, and achieving moisturizing, firming and anti-wrinkle and barrier repair effects of skin care products.

CN120272327APending Publication Date: 2025-07-08HARBIN FUERJIA TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510474627.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-15
Publication Date
2025-07-08

AI Technical Summary

Technical Problem

There are few reports of fucose-rich Tremella extracts in the prior art. The biological activity of Tremella polysaccharides has not been fully utilized, and there is a lack of functional skin care raw materials with moisturizing, anti-wrinkle and barrier repair.

Method used

By screening and cultivating the fungal strain Tremella fuciformis FEJ001 rich in fucose, deep liquid fermentation is used to optimize the fermentation process, increase the fucose content in the fermentation broth, and skin care products are prepared through the fermentation broth.

Benefits of technology

It significantly increases the fucose content in the fermentation broth of Tremella, enhances the expression of aquaporin 3 and type I collagen genes, and improves the moisturizing, firming, anti-wrinkle and barrier repair functions of skin care products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120272327A_ABST
    Figure CN120272327A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of tremella fuciformis fungi, in particular to tremella fuciformis fermentation liquor rich in fucose and a preparation method and application of the tremella fuciformis fermentation liquor. The tremella fuciformis fermentation liquor provided by the invention contains fucose with relatively high concentration, and experiments prove that the tremella fuciformis fermentation liquor provided by the invention can improve the content of aquaporin 3 and I-type collagen gene expression and improve the cell migration rate, thereby proving that the tremella fuciformis fermentation liquor has the functions of moisturizing, tightening, resisting wrinkles and repairing barrier damage.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of Tremella fungi, and particularly relates to a Tremella fermentation broth rich in fucose, a preparation method thereof, and applications thereof. Background Art

[0002] Tremella fuciformis Berk, also known as white fungus, is a higher fungus. It has a sweet and neutral taste and has the effects of nourishing yin and moistening the lungs, and nourishing the stomach and promoting fluid production. Since ancient times, it has been regarded as a good product for prolonging life and is the most precious edible mushroom and important medicinal material recognized in the world. The commonly used extraction methods for Tremella extracts are hot water extraction method, acid extraction method, alkali extraction method, and enzyme extraction method, which can extract active ingredients such as Tremella fuciformis Polysaccharides (TP), proteins, and amino acids from the fruiting bodies of Tremella. Tremella polysaccharides account for a relatively high proportion in the dry weight of the Tremella fruiting bodies, usually between 55% and 75%. In the prepared Tremella extracts, Tremella polysaccharides are also the main active ingredients. Research shows that Tremella polysaccharides have various effects such as anti-tumor, anti-viral, anti-ulcer, hypoglycemic, hypolipidemic, and regulating body immunity.

[0003] As a heteropolysaccharide, Tremella polysaccharides are mainly composed of monosaccharides such as mannose, xylose, glucuronic acid, and arabinose. Among them, fucose has important functions and effects. They mainly include: (1) enhancing immunity. Fucose can stimulate the activity of immune cells and promote the production of immune factors, thereby enhancing the body's immune defense ability and helping the body resist the invasion of external pathogens; (2) antioxidant effect: It has excellent antioxidant activity, can delay the aging process of cells, protect the normal functions of cells, and thus maintain the healthy state of the body; (3) regulating the intestinal flora: Fucose can be utilized by beneficial intestinal bacteria to regulate the balance of the intestinal flora, help improve intestinal digestion and absorption functions, and prevent the occurrence of intestinal diseases. However, there are few reports on Tremella extracts rich in fucose at present. Summary of the Invention

[0004] Therefore, the present invention provides a Tremella fungus rich in fucose. The Tremella fungus (Tremellafuciformis) FEJ001 has been deposited in the China General Microbiological Culture Collection Center, and the deposit number is CGMCC No. 41775.

[0005] In some embodiments, the present invention provides a Tremella fruiting body cultivated from the above-mentioned Tremella fungus.

[0006] In some of these embodiments, the method for cultivating Tremella fruiting bodies comprises the following steps: inoculating a fungus of the genus Tremella into a cultivation medium, and culturing at 24 - 28 °C and a humidity range of 70 - 80% for 15 - 25 days to obtain Tremella fruiting bodies.

[0007] The cultivation medium comprises wood chips, wheat bran, gypsum and sucrose, and the mass ratio of wood chips, wheat bran, gypsum and sucrose is 70 - 80:15 - 25:0.5 - 2.5:0.5 - 2.5. The moisture content of the cultivation medium is 55 - 60 wt%.

[0008] The method for cultivating Tremella fruiting bodies further comprises a step of drying the obtained Tremella fruiting bodies, and the drying temperature is 35 - 45 °C.

[0009] In some of these embodiments, the present invention also provides a Tremella fermentation broth obtained by fermenting the above-mentioned Tremella fruiting bodies.

[0010] In some of these embodiments, the present invention also provides a method for preparing the above-mentioned Tremella fermentation broth, comprising the following steps: mixing Tremella fruiting bodies, a carbon source and a nitrogen source to obtain a Tremella fermentation medium; inoculating Candida utilis into the Tremella fermentation medium for fermentation to obtain a crude fermentation broth; sterilizing and performing solid-liquid separation on the crude fermentation broth to obtain the Tremella fermentation broth.

[0011] In some of these embodiments, the content of Tremella fruiting bodies in the Tremella fermentation medium is 1 - 3 wt%.

[0012] In some of these embodiments, the nitrogen source content in the Tremella fermentation medium is 0.02 - 0.8 wt%, preferably 0.02 - 0.2 wt%.

[0013] In some of these embodiments, the content of the carbon source in the Tremella fermentation medium is 0.5 - 2 wt%.

[0014] In some of these embodiments, the Tremella fermentation medium further comprises water.

[0015] In some of these embodiments, Candida utilis is cultivated into a Candida utilis seed liquid, and then the Candida utilis seed liquid is inoculated into the Tremella fermentation medium for fermentation. The strain concentration of the Candida utilis seed liquid is 10 7 -10 9 CFU / mL, and the fermentation time is 20 - 48 h, preferably 20 - 38 h.

[0016] In some of these embodiments, the Candida utilis is at least one of the strain numbered AS2.281 or the strain with the deposit number GDMCC No.2.148.

[0017] In some of these embodiments, the carbon source includes at least one of glucose, sucrose, maltose, or fructose.

[0018] In some of these embodiments, the nitrogen source includes at least one of soy peptone, tryptone, and soybean cake powder.

[0019] In some of these embodiments, based on the total weight of the Tremella fuciformis fermentation medium, the content of the Candida utilis seed liquid is 0.5 - 2 vol%.

[0020] The Tremella fuciformis fermentation medium further includes at least one of potassium dihydrogen phosphate or dipotassium hydrogen phosphate. Among them, the content of potassium dihydrogen phosphate in the Tremella fuciformis fermentation medium is 0.1 - 0.2 wt%, and the content of dipotassium hydrogen phosphate in the Tremella fuciformis fermentation medium is 0.05 - 0.15 wt%.

[0021] In some of these embodiments, under the state of stirring, the Candida utilis seed liquid is inoculated into the Tremella fuciformis fermentation medium for fermentation. The rotation speed of the stirring is 100 - 200 rpm, and the fermentation temperature is 25 - 30 °C.

[0022] In some of these embodiments, the temperature for sterilizing the crude fermentation broth is 80 - 95 °C, and the time is 15 - 30 h.

[0023] In some of these embodiments, the step of solid - liquid separation includes filtration.

[0024] In some of these embodiments, the filtration method includes filtration with a diatom filter.

[0025] The present invention also provides a skin care product, which includes the above - mentioned Tremella fuciformis fermentation broth or the Tremella fuciformis fermentation broth prepared by the preparation method of the above - mentioned Tremella fuciformis fermentation broth.

[0026] In some of these embodiments, in the skin care product, the content of the Tremella fuciformis fermentation broth is 0.1 - 50 wt%.

[0027] The technical solution of the present invention has the following advantages:

[0028] 1. A strain of Tremella fuciformis FEJ001 provided by the present invention has been deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms, with the deposit number CGMCC No. 41775. Existing research shows that fucose, as a key functional monosaccharide, participates in constructing the unique three - dimensional spatial structure of Tremella polysaccharide. Its main chain is composed of linearly arranged mannose units, and monosaccharides such as fucose are orderly connected through glycosidic bonds to form a branched - chain structure. This special molecular architecture endows Tremella polysaccharide with excellent biological activities and physicochemical properties. The present invention successfully isolates a strain of Tremella fuciformis rich in fucose through directional screening and conditional induction techniques.

[0029] 2. The tremella fermented liquid provided by the present invention is obtained by fermenting the tremella fruiting body described above. The tremella fermented liquid provided by the present invention contains a relatively high concentration of fucose. Through experimental verification, the tremella fermented liquid provided by the present invention can increase the content of aquaporin 3 and the expression of type I collagen gene, as well as increase the cell migration rate, proving that it has the functions of moisturizing, firming and anti-wrinkle, and repairing barrier damage.

[0030] 3. A preparation method of the tremella fermented liquid provided by the present invention includes the following steps: mixing the tremella fruiting body, carbon source and nitrogen source to obtain a tremella fermentation medium; inoculating Candida utilis into the tremella fermentation medium for fermentation to obtain a crude fermentation liquid; sterilizing and separating the solid and liquid of the crude fermentation liquid to obtain the tremella fermented liquid. The present invention uses Candida utilis for deep liquid fermentation. Through fermentation process control, the proportion of fucose in the polysaccharide side chain is significantly increased, making the fermentation product show more optimized functional characteristics, and finally preparing a tremella fermentation product rich in fucose. The tremella fermented liquid rich in fucose has good moisturizing, anti-wrinkle and barrier repair effects, providing an innovative raw material choice for the development of functional skin care products.

[0031] 4. A preparation method of the tremella fermented liquid provided by the present invention, wherein the nitrogen source content in the tremella fermentation medium is 0.02 - 0.8 wt%, preferably 0.02 - 0.2 wt%; inoculating Candida utilis into the tremella fermentation medium for fermentation, and the strain concentration of the Candida utilis seed liquid is 10 7 -10 9 CFU / mL, and the fermentation time is 20 - 48 h, preferably 20 - 38 h; the Candida utilis is at least one of the strain numbered AS2.281 or the strain with the preservation number GDMCC No.2.148. The present invention significantly improves the fucose content in the tremella fermented liquid through optimizing the fermentation process, and at the same time further improves the content of aquaporin 3, the expression of type I collagen gene and the cell migration rate. Description of the Drawings

[0032] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required to be used in the description of the specific embodiments or the prior art. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0033] Figure 1 It is a physical picture of the tremella fungal strain obtained in Example 1 of the present invention. Detailed Embodiments

[0034] The following embodiments are provided to better further understand the present invention. It is not limited to the described optimal embodiment, and does not limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with other prior art features falls within the protection scope of the present invention.

[0035] For those not specifying specific experimental steps or conditions in the embodiments, the operations or conditions of the conventional experimental steps described in the literature in this field can be followed. For the reagents or instruments not indicating the manufacturer, they are all conventional reagent products that can be obtained through commercial purchase.

[0036] The Tremella fuciformis cultivated with bagged materials in Tongjiang, the Tremella fuciformis cultivated with Tilia wood in Tongjiang, and the Tremella fuciformis cultivated with bagged materials in Gutian used in the embodiments or comparative examples of the present invention are all obtained through commercial purchase.

[0037] The Candida utilis with the number AS2.281 used in the embodiments or comparative examples of the present invention is derived from Ningbo Mingzhou Biotechnology Co., Ltd.

[0038] The Candida tropicalis with the number BNCC374609, the Saccharomyces cerevisiae with the number BNCC336054, and the Lactobacillus brevis with the number BNCC337373 used in the embodiments or comparative examples of the present invention are all derived from North China Mall Chuanglian Biotechnology Co., Ltd.

[0039] The Candida utilis with the number GDMCC2.148 used in the embodiments or comparative examples of the present invention is derived from the Guangdong Provincial Culture Collection of Microorganisms.

[0040] The 10 7 -10 9 CFU / mL Candida utilis seed liquid is prepared by the following method (the common methods for preparing seed liquid in the prior art can be used to prepare the Candida utilis seed liquid of the present invention): Inoculate the colony of Candida utilis in the wort liquid medium and perform enlarged cultivation at 28 - 33 °C for 36 - 60 h to obtain the Candida utilis seed liquid.

[0041] The Saccharomyces cerevisiae seed liquid used in the embodiments or comparative examples of the present invention is prepared by the following method (the common methods for preparing seed liquid in the prior art can be used to prepare the Saccharomyces cerevisiae seed liquid of the present invention): Inoculate the colony of Saccharomyces cerevisiae in the wort liquid medium and perform enlarged cultivation at 28 - 33 °C for 36 - 60 h to obtain the Saccharomyces cerevisiae seed liquid.

[0042] The Candida tropicalis seed liquid used in the examples or comparative examples of the present invention was prepared by the following method (any common method for preparing seed liquid in the prior art can be used to prepare the Candida tropicalis seed liquid of the present invention): inoculate the colony of Candida tropicalis into the wort liquid medium, and perform enlarged culture at 28 - 33 °C for 36 - 60 h to obtain the Candida tropicalis seed liquid.

[0043] The Lactobacillus brevis seed liquid used in the examples or comparative examples of the present invention was prepared by the following method (it can also be prepared by other methods for preparing seed liquid): take the colony of Lactobacillus brevis and inoculate it into the MRS medium, and perform enlarged culture at 28 - 33 °C for 36 - 60 h to obtain the Lactobacillus brevis seed liquid.

[0044] The preparation method of the wort liquid medium is as follows: take 130 g of malt extract powder, add 1000 mL of deionized water to dissolve, mix evenly, and sterilize at 121 °C for 15 min for later use.

[0045] The preparation method of the potato dextrose agar (PDA) medium is as follows: weigh 12.0 g of potato leaching powder, 20.0 g of glucose, and 14.0 g of agar, add them to 1000 mL of purified water, heat to dissolve, adjust the pH to 6.0 - 6.5, and then sterilize at 121 °C for 15 min for later use.

[0046] The preparation method of the MRS medium is as follows: weigh 10.0 g of peptone, 8.0 g of beef extract powder, 4.0 g of yeast powder, 20.0 g of glucose, 0.2 g of magnesium sulfate, 5.0 g of sodium acetate, 2.0 g of diammonium hydrogen citrate, 2.0 g of dipotassium hydrogen phosphate, 0.04 g of manganese sulfate, and 1.0 g of Tween 80, add them to 1000 mL of purified water, heat to dissolve, adjust the pH to 5.5 - 6.0, and then sterilize at 121 °C for 15 min for later use.

[0047] The preparation method of the Tremella powder used in the examples or comparative examples of the present invention is as follows: use a pulverizer to crush the dried Tremella fruiting body and then sieve it. The lower - layer powder is the Tremella powder, and the Tremella powder can pass through a 50 - 70 - mesh sieve.

[0048] Example 1

[0049] This example provides a method for screening Tremella - genus fungi rich in fucose, and the specific steps and parameters are as follows:

[0050] (1) Select multiple sampling points with representativeness (the fungal outline of the Tremella fruiting body is obvious) in the natural ecological environment of Tremella fuciformis. For the Tremella fruiting bodies growing on different trees (such as basswood and cork oak), use sterile scissors and forceps to collect the complete fruiting bodies for later use.

[0051] (2) Add fucose at gradient concentrations as an inducer to the basal medium. After fully dissolving fucose in the basal medium, sterilize it at 121 °C for 15 min to prepare a screening medium. Among them, the gradient concentrations of fucose in the screening medium are 0.5 wt%, 1 wt%, and 2 wt% in sequence.

[0052] (3) Disinfect the Tremella fruiting body sample collected in step (1). The steps of disinfection are to first wipe the surface with a 70 vol% ethanol solution for 30 s, then soak it in a 0.1 wt% mercuric chloride solution for 5 - 10 min, and finally rinse it 3 times with sterile water.

[0053] (4) Under sterile conditions, inoculate the disinfected Tremella fruiting body sample onto a screening medium plate containing a fucose inducer. Inoculate 3 colonies or mycelial blocks on each plate. After inoculation, invert the plate and place it in an incubator, and culture it for 10 days under the conditions of 25 °C, relative humidity of 75%, light intensity of 1500 lux, and a light cycle / dark period of 12 h / 12 h.

[0054] Observe the growth of the strains, and eliminate the strains that are significantly degenerated (such as slow colony growth, sparse mycelium, and the appearance of variegated spots, etc.) and contaminated by other microorganisms. Finally, select the Tremella fungi that can survive in the medium containing 2 wt% fucose, have a uniform colony color, a velvety texture, a regular and smooth edge shape.

[0055] Inoculate this Tremella fungal colony into a potato slant medium and culture it in a microbial incubator for 14 days under the conditions of 25 °C and relative humidity of 75% to obtain purified Tremella fungi. The physical map of the Tremella fungal strain is as Figure 1 shown, and transfer the Tremella fungal strain to be refrigerated at 4 °C for standby.

[0056] Preserve the Tremella fungi screened above. The preserved Tremella fungi are named Tremella fuciformis FEJ001, and have been preserved in the China General Microbiological Culture Collection Center on January 8, 2025. Its preservation number is CGMCC No. 41775, the taxonomic name is Tremella fuciformis, and the preservation address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0057] Example 2

[0058] This example provides a cultivation method for the fruiting body of Tremella fungi rich in fucose. The specific steps and methods are as follows:

[0059] (1) Stir sawdust, wheat bran, gypsum and sucrose in a blender according to the mass ratio of 78:20:1:1. During the stirring process, add deionized water to keep the moisture content of the medium at 55 - 60 wt%, obtaining a mixture. Fill the mixture into plastic bags and treat at 100 °C for 18 h, then cool to obtain a sterilized cultivation medium.

[0060] (2) Under aseptic conditions, use a punching rod (sterilized) to punch holes in the cultivation medium. The punching parameters are a diameter of 1.5 cm, a depth of 1.5 cm, and a punching spacing of 10 cm. Inoculate the Tremella - like fungus screened above into the holes, and after inoculation, tightly plug the bag mouth with sterilized cotton. Cultivate at a temperature of 26 °C and a relative humidity of 75% for 20 days to obtain Tremella fruiting bodies rich in fucose.

[0061] Dry the harvested Tremella fruiting bodies at 40 °C to obtain dried Tremella fruiting bodies rich in fucose.

[0062] Example 3

[0063] This example provides a method for preparing a Tremella fermentation broth rich in fucose. The specific steps and methods are as follows:

[0064] (1) Crush the dried Tremella fruiting bodies prepared in Example 2, sieve through a 60 - mesh sieve to obtain Tremella powder, add a carbon source, a nitrogen source and water, and mix evenly. Among them, the addition amount of Tremella powder is 2 wt%, the addition amount of the carbon source (glucose) is 1 wt%, the addition amount of the nitrogen source (soy peptone) is 0.05 wt%, and the rest is water. After sterilization at 121 °C for 15 min, obtain a Tremella fermentation medium.

[0065] (2) Inoculate the Candida utilis seed liquid (with a cell concentration of 10 8 CFU / mL, numbered AS2.281) into the Tremella fermentation medium at an inoculation amount of 1 vol%. Under a stirring paddle speed of 150 rpm, ferment at 28 °C for 24 h to obtain a crude fermentation broth;

[0066] (3) Keep the crude fermentation broth at 90 °C for 20 min (sterilization step), and after filtration through a diatom filter, the obtained filtrate is a Tremella fermentation broth rich in Tremella fucose.

[0067] Example 4

[0068] This example provides a method for preparing a Tremella fermentation broth rich in fucose. The specific steps and methods are the same as those in Example 3, except that maltose of equal mass is used to replace glucose in step (1).

[0069] Example 5

[0070] This example provides a method for preparing Tremella fuciformis fermentation broth rich in fucose. The specific steps and methods are the same as those in Example 3, except that an equal mass of sucrose is used to replace glucose in step (1).

[0071] Example 6

[0072] This example provides a method for preparing Tremella fuciformis fermentation broth rich in fucose. The specific steps and methods are the same as those in Example 3, except that an equal mass of soybean cake powder is used to replace peptone from soybeans in step (1).

[0073] Example 7

[0074] This example provides a method for preparing Tremella fuciformis fermentation broth rich in fucose. The specific steps and methods are the same as those in Example 3, except that an equal mass of tryptone is used to replace peptone from soybeans in step (1).

[0075] Example 8

[0076] This example provides a method for preparing Tremella fuciformis fermentation broth rich in fucose. The specific steps and methods are the same as those in Example 3, except that the addition amount of glucose in step (1) is changed from 1 wt% to 2 wt%, and the addition amount of water is adjusted accordingly.

[0077] Example 9

[0078] This example provides a method for preparing Tremella fuciformis fermentation broth rich in fucose. The specific steps and methods are the same as those in Example 3, except that the addition amount of peptone from soybeans in step (1) is changed from 0.05 wt% to 0.02 wt%, and the addition amount of water is adjusted accordingly.

[0079] Example 10

[0080] This example provides a method for preparing Tremella fuciformis fermentation broth rich in fucose. The specific steps and methods are the same as those in Example 3, except that the addition amount of peptone from soybeans in step (1) is changed from 0.05 wt% to 0.2 wt%, and the addition amount of water is adjusted accordingly.

[0081] Example 11

[0082] This example provides a method for preparing Tremella fuciformis fermentation broth rich in fucose. The specific steps and methods are the same as those in Example 3, except that the fermentation temperature in step (2) is adjusted from 28 °C to 30 °C.

[0083] Example 12

[0084] This example provides a method for preparing Tremella fuciformis fermentation broth rich in fucose. The specific steps and methods are the same as those in Example 3, except that the fermentation time in step (2) is adjusted from 24 h to 38 h.

[0085] Example 13

[0086] This example provides a method for preparing Tremella fuciformis fermentation broth rich in fucose. The specific steps and methods are as follows:

[0087] (1) The dried Tremella fuciformis fruiting bodies prepared in Example 2 were crushed, passed through a 50-mesh sieve to obtain Tremella powder, and after adding a carbon source, a nitrogen source, and water, they were mixed evenly. Among them, the addition amount of Tremella powder was 1 wt%, the addition amount of the carbon source (sucrose) was 0.5 wt%, the addition amount of the nitrogen source (soybean cake powder) was 0.1 wt%, and the rest was water. After sterilization at 121 °C for 15 min, a Tremella fermentation medium was obtained.

[0088] (2) The Candida utilis seed liquid with a cell concentration of 10 7 CFU / mL (numbered AS2.281) was inoculated into the Tremella fermentation medium at an inoculation amount of 2 vol%. Under a stirring paddle speed of 200 rpm and at 25 °C, fermentation was carried out for 35 h to obtain a crude fermentation broth;

[0089] (3) The crude fermentation broth was kept at 80 °C for 30 min, and after filtration through a diatom filter, the obtained filtrate was the Tremella fuciformis fermentation broth rich in Tremella fucose.

[0090] Example 14

[0091] This example provides a method for preparing Tremella fuciformis fermentation broth rich in fucose. The specific steps and methods are as follows:

[0092] (1) The dried Tremella fuciformis fruiting bodies prepared in Example 2 were crushed, passed through a 70-mesh sieve to obtain Tremella powder, and after adding a carbon source, a nitrogen source, and water, they were mixed evenly. Among them, the addition amount of Tremella powder was 3 wt%, the addition amount of the carbon source (fructose syrup) was 2 wt%, the addition amount of the nitrogen source (soybean peptone) was 0.08 wt%, and the rest was water. After sterilization at 121 °C for 15 min, a Tremella fermentation medium was obtained.

[0093] (2) The Candida utilis seed liquid with a cell concentration of 10 9 CFU / mL (numbered AS2.281) was inoculated into the Tremella fermentation medium at an inoculation amount of 0.5 vol%. Under a stirring paddle speed of 100 rpm and at 30 °C, fermentation was carried out for 20 h to obtain a crude fermentation broth;

[0094] (3) The crude fermentation broth was kept at 95 °C for 15 min, and after filtration through a diatom filter, the obtained filtrate was the Tremella fuciformis fermentation broth rich in Tremella fucose.

[0095] Example 15

[0096] This example provides a method for preparing Tremella fuciformis fermentation broth rich in fucose. The specific steps and methods are the same as those in Example 3, except that a Candida utilis seed solution (preservation number GDMCC No. 2.148) with the same inoculation amount (bacterial concentration of 10 8 CFU / mL) is used to replace the Candida utilis seed solution in step (2).

[0097] Example 16

[0098] This example provides a method for preparing Tremella fuciformis fermentation broth rich in fucose. The specific steps and methods are the same as those in Example 3, except that in step (1), the addition amount of soy peptone is 0.8 wt%, and the amount of water in the Tremella fuciformis fermentation medium is adjusted accordingly.

[0099] Example 17

[0100] This example provides a method for preparing Tremella fuciformis fermentation broth rich in fucose. The specific steps and methods are the same as those in Example 3, except that in step (2), the fermentation time is 48 h.

[0101] Example 18

[0102] This example provides a method for preparing Tremella fuciformis fermentation broth rich in fucose. The specific steps and methods are the same as those in Example 3, except that in step (1), 0.15 wt% potassium dihydrogen phosphate and 0.1 wt% dipotassium hydrogen phosphate are additionally added to the Tremella fuciformis fermentation medium, and the amount of water in the Tremella fuciformis fermentation medium is adjusted accordingly.

[0103] Comparative Example 1

[0104] This comparative example provides a method for preparing Tremella fuciformis fermentation broth rich in fucose. The specific steps and methods are the same as those in Example 3, except that commercially available Tremella fuciformis grown on bagged materials of Tongjiang with the same mass is used to replace the Tremella fuciformis powder in step (1).

[0105] Comparative Example 2

[0106] This comparative example provides a method for preparing Tremella fuciformis fermentation broth rich in fucose. The specific steps and methods are the same as those in Example 3, except that commercially available Tremella fuciformis grown on linden wood of Tongjiang with the same mass is used to replace the Tremella fuciformis powder in step (1).

[0107] Comparative Example 3

[0108] This comparative example provides a method for preparing a Tremella fuciformis fermented liquid rich in fucose, and the specific steps and methods are the same as those in Example 3, except that an equal mass of commercially available Gutian bag-grown Tremella fuciformis is used to replace the Tremella fuciformis powder in step (1).

[0109] Comparative Example 4

[0110] This comparative example provides a method for preparing a Tremella fuciformis fermentation broth rich in fucose. The specific steps and methods are the same as those in Example 3, except that the same inoculation amount of tropical Candida (numbered BNCC374609) seed liquid (bacterial concentration of 10 8 CFU / mL) was used to replace the Candida utilis seed solution in step (2).

[0111] Comparative Example 5

[0112] This comparative example provides a method for preparing a Tremella fermentation broth rich in fucose. The specific steps and methods are the same as those in Example 3, except that the same inoculation amount of Saccharomyces cerevisiae (numbered BNCC336054) seed liquid (bacterial concentration of 10 8 CFU / mL) was used to replace the Candida utilis seed solution in step (2).

[0113] Comparative Example 6

[0114] This comparative example provides a method for preparing a Tremella fermentation broth rich in fucose. The specific steps and methods are the same as those in Example 3, except that the same inoculation amount of Lactobacillus brevis (numbered BNCC337373) seed liquid (bacterial concentration of 10 8 CFU / mL) was used to replace the Candida utilis seed solution in step (2).

[0115] Application Example 1

[0116] This application example provides a skin care product, and the specific steps and methods are as follows:

[0117] 5wt% of glycerol, 4wt% of pentanediol, 0.2wt% of xanthan gum, 0.4wt% of p-hydroxyacetophenone, 3wt% of butylene glycol, 0.05wt% of disodium EDTA, 0.1wt% of carbomer, 0.1wt% of dipotassium glycyrrhizinate, 0.1wt% of allantoin, 0.2wt% of PEG-40 hydrogenated castor oil, 0.1wt% of arginine, 10wt% of the tremella fermentation liquid provided in Example 3, and the balance of water are mixed evenly to obtain a skin care product.

[0118] Application Example 2

[0119] This application example provides a skin care product. The specific steps and methods are the same as those of Application Example 1, except that the content of Tremella fuciformis fermented liquid in the skin care product is 0.1wt%, and the amount of water added is adjusted accordingly.

[0120] Application Example 3

[0121] This application example provides a skin care product. The specific steps and methods are the same as those in Application Example 1, except that the content of Tremella fuciformis fermentation broth in the skin care product is 50 wt%, and the addition amount of water is adjusted accordingly.

[0122] Experimental Example 1

[0123] The content of fucose in the Tremella fuciformis fermentation broth prepared in Examples 3 - 18 and Comparative Examples 1 - 6 was measured. The measurement results are shown in Table 7.

[0124] The measurement method is as follows:

[0125] Pretreatment of test sample: Put the test sample into a centrifuge tube, take the supernatant after centrifugation, filter and sterilize it through a 0.22 μm filter membrane. Add concentrated hydrochloric acid to the filtrate to adjust the pH to 0.8, place it in a sealed rotary evaporator, heat it at 95 °C for 8 h, centrifuge and filter the obtained liquid, and collect the filtrate as the sample for fucose content determination;

[0126] Preparation of control sample solution: Take 100 mg of fucose standard product, accurately weigh it, and make up the volume to 100 mL in a volumetric flask with ultrapure water. After shaking well, it is used as the reference solution. Filter it through a 0.22 μm filter membrane for standby;

[0127] Determination: The content of fucose in the fermentation broth was determined by high performance liquid chromatography. The specific chromatographic conditions are as follows: refractive index detector; chromatographic column: sugar column (300 mm × 7.8 mm); mobile phase: 2.5 mM H2SO4 aqueous solution; flow rate: 0.5 mL / min; column temperature: 40 °C; injection volume: 15 μL; detection wavelength: 254 nm.

[0128] According to the retention time and peak area of the fucose standard product, determine the peak position and content of fucose in the fermentation broth.

[0129] Draw a standard curve through the fucose standard product with known concentration, and find its content on the standard curve according to the peak area of fucose in the sample.

[0130] The calculation formula is:

[0131] Among them, the dilution factor can be determined during the experiment.

[0132] Experimental Example 2

[0133] Aquaporin (AQP), also known as water pore protein, is a protein (intrinsic membrane protein) located on the cell membrane, forming "pores" on the cell membrane, which can control the entry and exit of water in cells, just like a "water pump" of cells. Aquaporin (AQP3) is expressed in the epidermis and basal layer, and is a natural moisturizing factor that maintains the interstitial and intracellular hydration levels of skin cells, and may play a key role in skin hydration and moisturization. The effect of the sample on the expression of AQP3 gene in keratinocytes was detected by in vitro experiments to evaluate whether the sample has the efficacy of promoting moisturization.

[0134] In this experimental example, the water channel protein content of the Tremella fuciformis fermentation broth prepared in Examples 3-18 and Comparative Examples 1-6 was measured to evaluate the moisturizing efficacy of the Tremella fuciformis fermentation broth, and the test results are shown in Table 7.

[0135] The test method is as follows: Dilute the Tremella fuciformis fermentation broth to be tested with a basic culture medium (DMEM) containing 10 vol% serum to a mass concentration of 0.5%.

[0136] Inoculate HaCaT human keratinocytes into a 6-well plate (200,000 cells / well) and culture them in an incubator at 37 °C for 24 h. After the culture is completed, discard the original culture medium in the well. The negative control group is added with DMEM culture medium containing 10 vol% serum, and an equal amount of the diluted test sample is added to each well in the sample group, and cultured for 24 h. After the culture is completed, discard the supernatant.

[0137] Use qRT-PCR technology to detect the mRNA expression level of AQP3 in HaCaT human keratinocytes, calculate the relative expression level according to the mRNA expression level of the negative control group, set 3 parallel samples for each sample, and take the average value of the test results.

[0138] The relevant steps are as follows:

[0139] 1. Extraction of total RNA from HaCaT cells

[0140] 1.1. Thoroughly aspirate the culture medium in the HaCaT cell culture well plate, and add 350 μL of buffer (Buffer RL) and 10 μL of Proteinase K to the culture dish.

[0141] 1.2. gDNA treatment: Place the gDNA filter column (RNase-Free gDNA Remove Column) in a 2 mL collection tube, transfer the cell lysate or tissue supernatant to the gDNA filter column, centrifuge at 12,000 rpm for 1 min, and retain the filtrate;

[0142] 1.3. Discard the gDNA filter column, add 360 μL of 70 vol% ethanol to the filtrate, and pipette 3-5 times;

[0143] 1.4. Place the RNA adsorption column (RNase-Free RNA Column) in a 2 mL collection tube, transfer the solution and the precipitate together to the adsorption column, centrifuge at 12,000 rpm for 1 min, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube;

[0144] 1.5. Add 700 μL of Buffer RW to the adsorption column, centrifuge at 12,000 rpm for 1 min, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube;

[0145] 1.6. Add 500 μL of Buffer RW1 (please check whether ethanol has been added before use) to the adsorption column, let it stand at room temperature for 2 min, centrifuge at 12,000 rpm for 1 min, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube;

[0146] 1.7. Repeat step 1.6;

[0147] 1.8. Centrifuge at 12,000 rpm for 2 min (centrifuge the empty column), pour out the waste liquid, and place the adsorption column with the lid open at room temperature for 5 min to thoroughly dry the residual wash buffer in the adsorption material;

[0148] 1.9. Transfer the adsorption column to a new RNase-Free centrifuge tube, suspend and add 20 μL of RNase-Free ddH2O to the middle part of the adsorption membrane, let it stand at room temperature for 2 min, centrifuge at 12,000 rpm for 2 min to obtain the RNA solution, and store the eluted RNA solution at -80 °C.

[0149] 2. Reverse transcription of HaCaT cell RNA

[0150] 2.1. Using the RNA prepared in step 1.9 as the template RNA, thaw the template RNA and the reagents on ice, gently flick or vortex each solution before use to mix well, and briefly centrifuge to collect the liquid remaining on the tube wall to the bottom of the tube;

[0151] 2.2. Prepare the reaction system in Table 1 on ice in an RNase-Free tube (the reaction systems in Table 1 are all from the kit purchased from Shanghai Beyotime Biotechnology Co., Ltd.), and perform reverse transcription according to the procedure in Table 2 to obtain cDNA. The relevant primer information is shown in Table 3.

[0152] Table 1 Reaction System

[0153]

[0154] Table 2 Reverse Transcription Operation Procedure

[0155] Temperature Time Description 25℃ 10min Random primers pair with the RNA template to remove genomic DNA 55℃ 15min Reverse transcription reaction and rapid inactivation of dsDNase 85℃ 5min Inactivation of reverse transcriptase

[0156] Primer sequence information of Experimental Example 2 in Table 3

[0157] Gene Primer sequence GAPDH-F GGTGGTCTCCTCTGACTTCAACA GAPDH-R GTTGCTGTAGCCAAATTCGTTGT AQP3-F CAAGGGACCAGTCGGAAG AQP3-R ATGTGAAGCCCCTGAAACA

[0158] 2.3. Dilute the obtained cDNA by 7 times, that is, mix 13 μL of cDNA and 78 μL of DEPC water gently by vortex oscillation.

[0159] The obtained cDNA product can be immediately used for the PCR reaction (the reaction system is shown in Table 4 (the reagents in the reaction system are all from the kit, and the kit is purchased from Shanghai Beyotime Biotechnology Co., Ltd.), and the operation process refers to the kit, and the reaction program is shown in Table 5), or stored at -20 °C and used within half a year. It is recommended to aliquot and store at -80 °C for long-term storage. cDNA should be avoided from repeated freezing and thawing.

[0160] Table 4 Real-Time PCR reaction system

[0161]

[0162]

[0163] Table 5 Real-Time PCR reaction program

[0164]

[0165] 2.4. Calculate the gene expression fold change (n) using the following formula:

[0166] n = 2^(-z)

[0167] z = x - y, where x = ct(target gene in sample group) - ct(housekeeping gene in sample group)

[0168] y = ct(target gene in control group) - ct(housekeeping gene in control group)

[0169] Experimental Example 3

[0170] Collagen plays a role as a structural scaffold in the dermis. Among them, type I collagen is one of the main components of the extracellular matrix of dermal cells. Type I procollagen is synthesized intracellularly by dermal fibroblasts, secreted extracellularly, and after the telopeptides are separated under the action of procollagen peptidase at the ends, it polymerizes to form collagen fibers. Type I collagen is involved in the biosynthesis of collagen fiber tissue and collagen, and is the main fiber type collagen that composes the intramuscular connective tissue of skeletal muscle. Sunlight exposure and aging can reduce the synthesis of type I collagen in the dermis, resulting in skin relaxation and wrinkles. The synthesis rate of type I collagen is regulated by the expression level of its corresponding mRNA. The test substance stimulates keratinocytes to produce type I collagen and type III collagen. By measuring the relative expression level of type I collagen mRNA, it is evaluated whether the test substance has the effect of firming and anti-wrinkle in vitro.

[0171] In this experimental example, the relative expression level of type I collagen mRNA in the Tremella fuciformis fermentation broth prepared in Examples 3 - 18 and Comparative Examples 1 - 6 was measured to evaluate the in vitro firming and anti-wrinkle efficacy of the Tremella fuciformis fermentation broth, and the test results are shown in Table 7.

[0172] The test method is the same as that of Experimental Example 2, except that the primer sequence information is shown in Table 6.

[0173] Table 6 Primer sequence information of Experimental Example 3

[0174] Gene Primer sequence GAPDH-F GGTGGTCTCCTCTGACTTCAACA GAPDH-R GTTGCTGTAGCCAAATTCGTTGT COL1-F CCTGCTGGCAAGAGTGGT COL1-R GCCCTGTTCGCCTGTCT

[0175] Experimental Example 4

[0176] The skin barrier is the first line of defense for the human body to resist external irritating substances. The defect of the skin barrier is the root cause of a series of other skin problems, such as skin allergies, irritations, dryness, and even the occurrence of wrinkles, fine lines, and pigmentation, etc. The cell migration test is carried out by making a scratch on a cell monolayer to simulate the scenario of wound formation in vivo. When tissues such as the skin or mucosa are damaged, the surrounding cells will migrate to fill the damaged area and promote wound healing. In the cell migration test, the cells at the edge of the scratch will gradually migrate towards the blank area, and this process is similar to the mechanism of in vivo cell migration to repair barrier damage. The cell migration test can observe the proliferation of cells in the scratched area, thereby evaluating the repair ability of the cells. By comparing the proliferation speed and degree of cells under different treatment conditions, it can be judged whether the test sample has the effect of promoting cell proliferation and repairing barrier damage.

[0177] In this experimental example, the proliferation speed and degree of cells under different treatment conditions of the Tremella fuciformis fermentation broth prepared in Examples 3 - 18 and Comparative Examples 1 - 6 were measured to evaluate whether it has the effect of promoting cell proliferation and repairing barrier damage, and the test results are shown in Table 7.

[0178] The test method is as follows: Dilute the Tremella fuciformis fermentation broth to be tested to a mass concentration of 0.5% with a basic culture medium (DMEM) containing 10 vol% serum; and prepare 0.05 wt% ectoine (using the basic culture medium DMEM with 10 vol% serum as the solvent).

[0179] Inoculate L929 cells in the logarithmic phase into a 6-well plate (200,000 cells / well), add DMEM medium with 10 vol% serum, and culture at 37 °C, 5% CO2, and saturated humidity for 24 h. When the cell confluence rate reaches 100%, use a 1 mL pipette tip, against a ruler, perpendicular to the cell plane, and make a scratch on the cell layer along the line perpendicular to the back of the plate. After the scratch is completed, wash the cells 3 times with sterile buffer (DPBS) to wash away non-adherent cells.

[0180] Add 1 mL of fresh DMEM culture medium with 10 vol% serum to the negative control group, add 1 mL of 0.05 wt% ectoine solution to the positive control group, and add 1 mL of 0.5 wt% sample solution to the sample group respectively. Continue to culture for 24 h. After the culture is completed, fix the cells with paraformaldehyde, stain with crystal violet, take electron microscope photos and record them at 0 h and 24 h of culture respectively. Use ImageJ software to measure the scratch area of each group, calculate the cell migration rate (%), set 3 parallel samples for each sample, and take the average value of the test results. The test results are shown in Table 7.

[0181] The calculation formula for the cell migration rate (%) is as follows:

[0182] Cell migration rate (%) = (1 - S 24 / S0) × 100%, where: S 24 is the scratch area at 24 h of culture; S0 is the scratch area at 0 h of culture.

[0183] Table 7 Measurement results of Tremella fuciformis fermentation broth

[0184]

[0185]

[0186] According to the data in Table 7, compared with Comparative Examples 1-6, the tremella fermented liquid provided in the examples of the present invention can significantly increase the content of fucose. At the same time, the relative expression level of AQP3 mRNA, the relative expression level of COLⅠ mRNA, and the cell migration rate are increased, which proves that the tremella fermented liquid provided in the examples of the present invention has good moisturizing, anti-wrinkle, and barrier repair effects. In Comparative Examples 1-3, the fucose content in the tremella fermented liquid formed by commercially available tremella was only 212.52-262.59 ppm, the relative expression level of AQP3 mRNA was 1.06-1.28, the relative expression level of COLⅠ mRNA was 1.26-1.44, and the cell migration rate was 14.38-17.49%; in Comparative Examples 4-6, the tremella fermented liquid formed by using Candida tropicalis, Saccharomyces cerevisiae, and Lactobacillus brevis as fermentation strains respectively had a fucose content of only 285.72-326.49 ppm, the relative expression level of AQP3 mRNA was 1.29-1.38, the relative expression level of COLⅠ mRNA was 1.26-1.52, and the cell migration rate was 19.42-21.36%; while in Examples 1-18 of the present invention, using the tremella fungus (Tremella fuciformis) FEJ001 preserved in the China General Microbiological Culture Collection Center with the preservation number CGMCC No. 41775 as the strain to be cultured, and using Candida utilis with the fermentation strain number AS2.281, the fucose content in the tremella fermented liquid was above 366.40 ppm, and the highest could reach 429.40 ppm. The relative expression level of AQP3 mRNA was above 1.44, and the relative expression level of COLⅠ mRNA was above 1.48. The fucose content, the relative expression level of AQP3 mRNA, and the relative expression level of COLⅠ mRNA in the tremella fermented liquid were much higher than those in Comparative Examples 1-6, and the cell migration rate could reach up to 25.89%, which was much higher than that of the positive control group, proving that the tremella fermented liquid provided in the examples of the present invention can increase the content of aquaporin 3 and the expression of type I collagen gene, and has the functions of moisturizing, firming and anti-wrinkle, and repairing barrier damage.

[0187] Furthermore, when the nitrogen source content in the tremella fermentation medium is 0.02-0.2 wt%, the fermentation time is 20-38 h, and the fermentation strain is Candida utilis with the fermentation strain number AS2.281, the fucose content, the relative expression level of AQP3 mRNA, the relative expression level of COLⅠ mRNA, and the cell migration rate in the tremella fermented liquid are increased.

[0188] Obviously, the above embodiments are merely examples given for clear illustration and not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or alterations can be made based on the above description. It is not necessary and impossible to enumerate all the implementation manners here. And the obvious changes or alterations derived therefrom still fall within the protection scope of the present invention.

Claims

1. A Tremella fuciformis fungus FEJ001 has been deposited with the China General Microbiological Culture Collection Center, and the deposit number is CGMCC No. 41775.

2. A Tremella fruiting body, characterized in that, Cultured from the Tremella fuciformis fungus described in claim 1.

3. A Tremella fuciformis fermentation broth, characterized in that, Fermented from the fruiting body of Tremella fuciformis described in claim 2.

4. The preparation method of tremella fermented liquid according to claim 3, characterized in that, Comprising the following steps, Mixing the fruiting body of Tremella fuciformis, a carbon source, and a nitrogen source to obtain a Tremella fermentation medium; Inoculating Candida utilis into the Tremella fermentation medium for fermentation to obtain a crude fermentation broth; Sterilizing and performing solid-liquid separation on the crude fermentation broth to obtain a Tremella fermentation broth.

5. The preparation method according to claim 4, characterized in that, The content of the fruiting body of Tremella fuciformis in the Tremella fermentation medium is 1-3 wt%; and / or, The nitrogen source content in the Tremella fermentation medium is 0.02-0.8 wt%, preferably 0.02-0.2 wt%; and / or, The content of the carbon source in the Tremella fermentation medium is 0.5-2 wt%; and / or, The Tremella fermentation medium further comprises water.

6. The preparation method according to claim 4, characterized in that, Candida utilis is cultivated into a Candida utilis seed solution, and then the Candida utilis seed solution is inoculated into the Tremella fuciformis fermentation medium for fermentation. The strain concentration of the Candida utilis seed solution is 10 7 -10 9 CFU / mL, the fermentation time is 20 - 48 h, preferably 20 - 38 h; and / or, The Candida utilis is at least one of the strain numbered AS2.281 or the strain with the deposit number GDMCC No. 2.148; and / or, The carbon source includes at least one of glucose, sucrose, maltose, and fructose syrup; and / or, The nitrogen source includes at least one of soybean peptone, tryptone, and soybean cake powder; and / or, The Tremella fermentation medium further comprises at least one of potassium dihydrogen phosphate or dipotassium hydrogen phosphate.

7. The preparation method according to claim 6, characterized in that, Based on the total weight of the Tremella fermentation medium, the inoculation amount of the Candida utilis seed liquid is 0.5-2 vol%.

8. The preparation method according to claim 6, characterized in that, Under the stirring state, inoculating the Candida utilis seed liquid into the Tremella fermentation medium for fermentation, the stirring speed is 100-200 rpm, and the fermentation temperature is 25-30 °C; and / or, The sterilization temperature of the crude fermentation broth is 80-95 °C, and the time is 15-30 h; and / or, The step of solid-liquid separation includes filtration.

9. A skin care product, characterized in that, Comprising the Tremella fermentation broth described in claim 4 or the Tremella fermentation broth prepared by the preparation method of the Tremella fermentation broth described in any one of claims 5-8.

10. The skin care product according to claim 9, characterized in that, The content of the Tremella fermentation broth in the skin care product is 0.1-50 wt%.