Morchella esculenta strain with high flavone yield

By constructing the high-yield flavonoid-producing morel engineering strain MM0483, the problem of low flavonoid content of morels was solved, the flavonoid yield was significantly improved, and its application in the medical field was expanded.

CN120272332APending Publication Date: 2025-07-08陕西紫烟阁生物科技研究院有限公司
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411868538.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-12-18
Publication Date
2025-07-08

AI Technical Summary

Technical Problem

The flavonoid content in morels is not high under traditional cultivation methods, which limits its potential application in the medical field.

Method used

A highly flavonoid-producing MM0483 was constructed. The polyketyl synthase gene (Mi-pks) was expressed under the control of the hygromycin B resistance gene (Hyg) and integrated into the morel chromosomal genome, and genetically modified by Agrobacterium transformation method.

Benefits of technology

It significantly increases the flavonoid production in morels and broadens its application potential in the medical field.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120272332A_ABST
    Figure CN120272332A_ABST
Patent Text Reader

Abstract

The embodiment of the invention provides a morchella esculenta strain with high flavone yield, and the morchella esculenta strain is MM0483, is classified and named as Morchella importuna, is preserved in the China Center for Type Culture Collection (CCTCC) on November 20, 2024, and has the preservation number of CCTCC NO: M20242606. The strain has the characteristic of high yield of flavone compounds.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a Morchella engineering strain capable of highly producing flavonoids, and this strain overexpresses the polyketide synthase gene in the flavonoid synthesis pathway. Background Art

[0002] Morchella, this rare edible fungus, belongs to Ascomycota, Pezizomycetes, Morchellales, Morchellaceae; they are named because the groove-like structure on the surface of the cap resembles a sheep's stomach. This kind of fungus is favored by people for its unique flavor and nutritional value. At the same time, it also has health benefits such as enhancing immunity and reducing cholesterol. Flavonoid compounds, widely distributed in the plant kingdom, belong to polyphenols, and these compounds have attracted much attention due to their diverse biological activities and positive effects on health, including enhancing immunity, antioxidant effects, and protective effects on the cardiovascular system.

[0003] However, the flavonoid content in Morchella under traditional cultivation methods is usually not high, which limits its potential application in the medical field. Summary of the Invention

[0004] To solve the above problems, the present invention provides a Morchella engineering strain capable of highly producing flavonoids.

[0005] To achieve the above object, the technical solution of the present invention is realized as follows:

[0006] An embodiment of the present invention provides a Morchella importuna strain capable of highly producing flavonoids. This strain is MM0483, classified and named as Morchella importuna, and has been deposited at the China Center for Type Culture Collection (CCTCC) on November 20, 2024, with the deposit number CCTCC NO: M20242606.

[0007] An embodiment of the present invention also provides a method for constructing a Morchella importuna strain capable of highly producing flavonoids. This method includes:

[0008] (1) Construction of the expression vector pCM-pks: Connect the polyketide synthase gene (Mi-pks) to a plasmid carrying the hygromycin B resistance gene (Hyg), and the hygromycin B resistance gene is expressed under the control of the transcription elongation factor promoter (TEFp) and the glyceraldehyde-3-phosphate dehydrogenase promoter (GPDp);

[0009] (2) Integrate the expression vector constructed in step (1) into the chromosomal genome of the Morchella strain M04 by the Agrobacterium tumefaciens transformation method;

[0010] (3) Obtain the Morchella importuna strain MM0483 capable of highly producing flavonoids.

[0012] In the above solution, the DNA molecule of Mi-pks is as shown in SEQ ID NO.1.

[0013] In the above solution, the DNA molecule of Hyg is as shown in SEQ ID NO.2.

[0014] In the above solution, the DNA molecule of TEFp is as shown in SEQ ID NO.3.

[0015] In the above solution, the DNA molecule of GPDp is as shown in SEQ ID NO.4.

[0016] In the above solution, the polyketide synthase gene Mi-pks is derived from Morchella importuna.

[0017] In the above solution, the constitutive promoter TEFp is derived from Morchella importuna.

[0018] In the above solution, the constitutive promoter GPDp is derived from Morchella importuna.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0020] This strain has the characteristic of high-yield flavonoid compounds. Description of the Drawings

[0021] Figure 1 It is a schematic diagram of plasmid pCM-pks, in which the polyketide synthase gene Mi-pks, promoter TEFp and GPDp are all derived from Morchella importuna.

[0022] Figure 2 It is a comparison diagram of Morchella importuna strain MM0483 (left) and control strain M04 (right) after 6 days of fermentation in PDA liquid medium. Detailed Embodiments

[0023] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention will be further described in detail below with reference to the drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0024] Embodiment

[0025] Step 1: Construction of the expression vector pCM-pks.

[0026] Specifically, pCAMBIA1391 (Cambia, Canberra, Australia) was used as the backbone for constructing the pCM-pks vector. The expression of the hygromycin B resistance gene (hyg) was controlled by the glyceraldehyde-3-phosphate dehydrogenase (GPD) promoter from Morchella importuna. The expression of the polyketide synthase gene Mi-pks from Morchella importuna was controlled by the transcription elongation factor (TEF) promoter from Morchella importuna.

[0027] pCAMBIA1391 plasmid and the GP fragment were digested with Sac II and Sph I respectively, and then the plasmid backbone (the longer fragment after digestion of the pCAMBIA1391 plasmid) and the GP fragment were ligated using T4 ligase to complete the construction of plasmid pCM-GP.

[0028] pCM-GP plasmid and the SacI-Hyg-KpnI fragment were digested with Sac I and Kpn I respectively, and then the plasmid backbone and the SacI-Hyg-KpnI fragment were ligated using T4 ligase to complete the construction of plasmid pCM-GP-Hyg.

[0029] pCM-GP-Hyg plasmid and the Mi-pks gene fragment were digested with BamHI and XmaI respectively, and then the plasmid backbone and the Mi-pks gene were ligated using T4 ligase to complete the construction of plasmid pCM-pks.

[0030] The DNA molecule of the said Mi-pks is shown as SEQ ID NO.1.

[0031] The DNA molecule of the said Hyg is shown as SEQ ID NO.2.

[0032] The DNA molecule of the said TEFp is shown as SEQ ID NO.3.

[0033] The DNA molecule of the said GPDp is shown as SEQ ID NO.4.

[0034] Step 2: Construction of the genetically engineered strain MM0483. The expression vector pCM-pks constructed in Step 1 was integrated into the chromosomal genome of the Morchella importuna strain MM483 (preserved by the Fungal Research Center of Shaanxi Institute of Microbiology) by Agrobacterium-mediated transformation to complete the construction of the genetically engineered strain MM0483.

[0035] Step 3: Shake flask fermentation. Inoculate the genetically engineered strain MM0483 into 100 ml of PDA liquid medium (200 g of potato, 20 g of glucose, 1000 ml of water, pH 7.0), and perform shake flask fermentation for 6 - 7 days under the culture conditions of 23°C and 180 rpm.

[0036] Step 4: Determination of the total flavonoid content in the fermentation broth. Use the aluminum complex method to determine the total flavonoid content in the fermentation broth.

[0037] The Morchella engineering strain of the present invention not only increases the yield of flavonoids but also may broaden the application of Morchella in the medical field.

[0038] Comparative example

[0039] The difference between this comparative example and the example is that the inoculated strain used is the Morchella importuna strain MM483.

[0040] Detect the total flavonoid content in the fermentation broth of the example and the comparative example respectively to compare their improvement effects on the total flavonoid content.

[0041] I. Experimental method

[0042] Determination of the total flavonoid content in the fermentation broth

[0043] (1) Drawing of the standard curve: ① Use rutin as the standard product and prepare a rutin standard solution with a concentration of 0.2 mg / ml. ② Respectively take 1, 2, 4, 8, 12, 16, 20 ml of the rutin standard solution, transfer them to a 50 ml volumetric flask, and make up to 25 ml with 30% ethanol. ③ Add 2.15 ml of 5% sodium nitrite solution, shake well and let stand for 6 minutes. ④ Then add 2.15 ml of 10% aluminum nitrate solution, and add 12.15 ml of 1 mol / l sodium hydroxide solution after 6 minutes. ⑤ Make up to the mark with 30% ethanol solution, after color development for 10 minutes, use the reagent blank as the reference and perform colorimetric determination at a wavelength of 510 nm. ⑥ Draw the standard curve according to the determination results and obtain the linear regression equation.

[0044] (2) Determination and calculation of the flavonoid content in the fermentation broth: ① Take 1, 2, 4 ml of the fermentation broth and place them in 50 ml volumetric flasks respectively, and make up to 25 ml with 30% ethanol. ② Treat the samples in the same way as in the standard curve drawing steps, including adding sodium nitrite, aluminum nitrate and sodium hydroxide solutions. ③ After color development, also use the reagent blank as the reference and perform colorimetric determination at a wavelength of 510 nm to measure the absorbance value A. ④ Use the previously obtained standard curve linear regression equation to calculate the flavonoid content in the sample. ⑤ After calculating the flavonoid content of each sample, calculate the average value to obtain the flavonoid content of the final sample.

[0045] II. Experimental results

[0046] Table 1 Determination of total flavonoid content in Morchella esculenta by spectrophotometry

[0047]

[0048] As shown in Table 1 and Figure 2 it can be seen that the Morchella esculenta strain prepared in the examples can produce higher concentrations of flavonoid compounds, indicating that the engineered strain obtained in the present invention has significant effects in the production of flavonoid compounds.

[0049] SEQ ID NO.1

[0050] ggatccatgaggagcctcttcaagaagaagaacaccattagatccagcagcgccaaagt

[0051] tgttgagtaatgcaagacgacgagcgccctccctgtgggaaacccacggaagattactg

[0052] cgtgcaatttcgacaccatcagttcctagtggggcgattttggggttaagtttcttgag

[0053] tgagatttgcttgggaatggtcttgtgtttcaacatgagcaacaattttgaaagaccgg

[0054] ctgcaccagatgcggcttcacaatggccgatatttgccttgacagaggtgatatgcagg

[0055] ggcttatcaggggttcttgtctgggcaaaagttccacgaagggaagcaagctcggcggg

[0056] gtcaccagcttgagtacccgtgccgtgagcctcaataacactaatgtccaaaggatcaa

[0057] caccagtctccttgagaagccgtttgaaaaggacctgttgtgtagcagcgtggggatga

[0058] gtgatagagtgtgcttcaccggattggttgacttgcacaccacggataacaccaaggat

[0059] ttggtcattctcggcaatagcgtcagagagtcgcttgaggacaaacatcccgcaaccct

[0060] cggaacgacagtatccatccgcagactcatcaaacgctttacattgcccggtaggagac

[0061] agaaaatgagcacggtcaaggccaaggtacatatcagggctggtaataacgttcacacc

[0062] accagcaacggcagcgttacagtcgccagcttcaagagcacggcaagcttggtagatgg

[0063] caatcaaagatgaagagcatgccgtgtctacaacaagcgagggaccgctgagtttcaat

[0064] gcgtacgagatacgtccgctcaagaaagctttgaggttaccggtactatagtacacgtc

[0065] gatgtcgtccctcaggttttcgctgtagtcgcccgtcgcaacgccaacataacagccga

[0066] aggactctcgagcgaaagtgtcggtagagtctgcaacatatcctgcattttcaatggcg

[0067] gtatacgccgtttgaaggagaacacgctgttgtggatcgagtgactttgcctcacgagg

[0068] agaaatgttgaagaaagtattgtcaaaagcagcaggatttttcaagaagttgccaaact

[0069] tggtgcccattgatctgactggcttggtaccgcttgaagtgtcgtaatagtttgacacg

[0070] tcgaaccgggagaaagggatctcagatacagtgttgagtccttcttcaaggactctcca

[0071] caaaccggaaacatcggttgcaccaggcatattaacacccataccaacaattgcgatta

[0072] acccggg

[0073] SEQ ID NO.2

[0074] gagctcctatttctttgccctcggacgagtgctggggcgtcggtttccactatcggcga

[0075] gtacttctacacagccatcggtccagacggccgcgcttctgcgggcgatttgtgtacgc

[0076] ccgacagtcccggctccggatcggacgattgcgtcgcatcgaccctgcgcccaagctgc

[0077] atcatcgaaattgccgtcaaccaagctctgatagagttggtcaagaccaatgcggagca

[0078] tatacgcccggagtcgtggcgatcctgcaagctccggatgcctccgctcgaagtagcgc

[0079] gtctgctgctccatacaagccaaccacggcctccagaagaagatgttggcgacctcgta

[0080] ttgggaatccccgaacatcgcctcgctccagtcaatgaccgctgttatgcggccattgt

[0081] ccgtcaggacattgttggagccgaaatccgcgtgcacgaggtgccggacttcggggcag

[0082] tcctcggcccaaagcatcagctcatcgagagcctgcgcgacggacgcactgacggtgtc

[0083] gtccatcacagtttgccagtgatacacatggggatcagcaatcgcgcatatgaaatcac

[0084] gccatgtagtgtattgaccgattccttgcggtccgaatgggccgaacccgctcgtctgg

[0085] ctaagatcggccgcagcgatcgcatccatagcctccgcgaccggttgtagaacagcggg

[0086] cagttcggtttcaggcaggtcttgcaacgtgacaccctgtgcacggcgggagatgcaat

[0087] aggtcaggctctcgctaaactccccaatgtcaagcacttccggaatcgggagcgcggcc

[0088] gatgcaaagtgccgataaacataacgatctttgtagaaaccatcggcgcagctatttac

[0089] ccgcaggacatatccacgccctcctacatcgaagctgaaagcacgagattcttcgccct

[0090] ccgagagctgcatcaggtcggagacgctgtcgaacttttcgatcagaaacttctcgaca

[0091] gacgtcgcggtgagttcaggctttttcatggtacc

[0092] SEQ ID NO.3

[0093] GGAAAATAATATATTATTGTTGCTGTCACGTGCTAATCCTATTTCCAAAATCCTTTCCA

[0094] AGTTCGCTGGACATCTCCCATGCGGTCCGTTTCATGATGTCTCGAGAGTCCGAAAACAA

[0095] GAACTCTGAACAGTGGCAAAATTCCGGGGCTGAGGGTTGTCTTAGCTGGCGAAGCGATG

[0096] ACCGCGATGCCCATGGTGTTTTGATGGTCTTAGACTTGTAATTATTTGTTGTCAAGGAG

[0097] ATCAACCAAGGTATCCAGGCCAGAGCTGCTGGGAGTCACAGCCACTTTTGAAATGTGTG

[0098] AAGTGGCTCCTCTCGAACGGGCTTGTCAATTGTGTAAAATGCGGGTGTGCGGTGCGATG

[0099] GCGAAAAGTCAAAAGGATGTTGGAGGTGCATATGCAATGCCAATGCCCTATGTGATGGG

[0100] CAAAGTCAACTCAAAATTTGAGGTGGGGTGCAATGGCGCTTAGTCAGAGCGGGGCACAC

[0101] AAATTTCGTTACCCCTCTTCCAACTTTCTCGTGGTTTTTTTTTCCCTCTCTCTCGCATC

[0102] AAACATCTCTCCAATCCCCTACATTTCTCCCTTTATTCTCCTACATATCCTGCASEQ I D NO.4

[0103] TTTGACTATTTAGTGAATCTATTTAACGCAGTGTTAGGGGCTGTTTTTAAGATGAACGA

[0104] CGCCCTTGAGAGGGATAGAATGTAGATAGCTCAAGGGGATAAAATCTTATTTCCCAAGA

[0105] TAATGGTTATCCCTAAGTAGGAGAAGGCATCAAATAAATATCAAATACCGGGAAAATAA

[0106] ACTTACTCTAGAGGAAGAAATTCTAGGATATAAGTTTGATGATGAAGATGGAGGATGCG

[0107] TGTTTGAGTTTTTGACTGAAGAGCAGTAAAGAGGATGAGGGGTGAGGGCCCAGGTATTT

[0108] ATCATGGCAAGTAGCGGGGGTGGCCGTAGCCCGTTCTAAACTTGACACGGAAACAAGAG

[0109] TAAAATTGCAATCTAGATGCGTTCAGAATTAATCAGAAGCAAATGCCCTCTACTGCATC

[0110] CCCAGGTCCCTGGATGTCTGTCCCTCCCCATTCTGTACGCGTGTGTTACCGTCTTATTC

[0111] CAAGTGCGAACCACGCCTATTCTCGGCAACCCGCTAATGCTTTGGAAACTCGGAGCGAA

[0112] AATCTCTCGGAGGCTTTCCGACAAAATCCATAAATTCACCTTATTCATATATATAAAAT

[0113] AGGAATACCCGATGCCCTCGGTAATCTCTTTACCATTCTCTCAAAATATTCTCCCCGTA

[0114] CCTCCCGT。

Claims

1. A Morchella importuna strain with high flavonoid yield, characterized in that: The strain is MM0483, taxonomically named Morchella importuna, and was deposited at the China Center for Type Culture Collection (CCTCC) on November 20, 2024, with the deposit number CCTCC NO: M20242606.

2. A method for constructing a Morchella importuna strain with high flavonoid yield as described in claim 1, characterized in that, The method includes: (1) Construction of the expression vector pCM-pks: The polyketide synthase gene (Mi-pks) was ligated to a plasmid carrying the hygromycin B resistance gene (Hyg), and the hygromycin B resistance gene was expressed under the control of the transcription elongation factor promoter (TEFp) and the glyceraldehyde-3-phosphate dehydrogenase promoter (GPDp), respectively; (2) Integrating the expression vector constructed in step (1) into the chromosomal genome of the Morchella esculenta strain M04 by Agrobacterium-mediated transformation; (3) Obtaining the high-flavonoid-producing Morchella importuna strain MM0483.

3. The construction method according to claim 2, characterized in that, The DNA molecule of the Mi-pks is shown in SEQ ID NO.

1.

4. The construction method according to claim 2, wherein The DNA molecule of the Hyg is shown in SEQ ID NO.

2.

5. The construction method according to claim 2, wherein The DNA molecule of the TEFp is shown in SEQ ID NO.

3.

6. The construction method according to claim 2, characterized in that, The DNA molecule of the GPDp is shown in SEQ ID NO.

4.

7. The method according to claim 2, wherein Among them, the polyketide synthase gene Mi-pks is derived from Morchella importuna.

8. The method according to claim 2, characterized in that, Among them, the constitutive promoter TEFp is derived from Morchella importuna.

9. The method according to claim 2, characterized in that Among them, the constitutive promoter GPDp is derived from Morchella importuna.