7-aminodeacetylated cephalosporanic acid producing strain as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biology, and discloses a 7-aminodeacetylated cephalosporanic acid producing strain and a preparation method and application of the 7-aminodeacetylated cephalosporanic acid producing strain. Acetoxyl synthase / hydroxylase genes and acetyltransferase genes are knocked out from cephalosporium acremonium; and related genes synthesized by 7-amino-3-deacetoxycephalosporanic acid are introduced, so that the 7-aminodeacetoxycephalosporanic acid producing strain is obtained. The 7-aminodeacetylated cephalosporanic acid with high yield and high purity can be directly prepared through microbial fermentation.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, particularly relates to the field of engineering bacteria construction technology, and specifically relates to a 7-amino deacetoxycephalosporanic acid-producing bacterium, a preparation method thereof and an application thereof. Background Art

[0002] 7-Amino deacetoxycephalosporanic acid (7-amino-3-deacetoxycephalosporanic acid, 7-ADCA) is a key intermediate for synthesizing various semi-synthetic cephalosporin antibiotics (such as cefalexin, cefadroxil, and cefaclor, etc.). Due to the retention of the β-lactam ring, a structural unit decisive for antibacterial activity, in its molecule, 7-ADCA exhibits broad-spectrum antibacterial potential and thus has an important position in the pharmaceutical industry. With the increasing problem of antibiotic resistance, the demand for the development of new cephalosporin drugs is growing continuously, which also makes the demand for high-quality and high-yield 7-ADCA continue to rise.

[0003] Traditionally, 7-ADCA is mainly prepared by chemical methods or enzymatic methods. For example, through multiple-step chemical hydrolysis of cephalosporin C, or by enzymatic catalysis from 7-aminocephalosporanic acid (7-ACA). However, chemical methods usually require the use of harmful reagents such as strong acids or strong bases, not only with harsh reaction conditions, but also generating a large amount of toxic and harmful waste, causing serious environmental pollution. At the same time, its reaction steps are cumbersome, the yield is low, and it is difficult to achieve green and clean production on an industrial scale. Although microbial catalysis or enzymatic methods can alleviate the environmental pollution problem to a certain extent, there are still many technical bottlenecks in terms of catalytic efficiency, substrate adaptability, and reaction condition control.

[0004] In recent years, with the rapid development of synthetic biology and metabolic engineering, more and more researchers have begun to attempt to construct efficient genetically engineered strains to optimize the biosynthetic pathway of 7-ADCA. This method not only is expected to simplify the production process, reduce energy consumption and material costs, but also can significantly reduce the environmental burden, meeting the industrial trend of green and sustainable development. Summary of the Invention

[0005] An object of the present invention is to provide a method for preparing a highly productive 7-ADCA recombinant Acremonium chrysogenum strain. It is obtained by knocking out the deacetoxycephalosporin C synthase / hydroxylase gene and the acetyltransferase gene in Acremonium chrysogenum and introducing a ring-expanding enzyme and an acylating enzyme to obtain the 7-amino deacetoxycephalosporanic acid-producing strain.

[0006] Specifically, the amino acid sequence encoded by the deacetoxycephalosporin C synthase / hydroxylase gene has the NCBI accession number P11935.1; more specifically, the deacetoxycephalosporin C synthase / hydroxylase gene sequence is as shown in SEQ ID NO.2 or its degenerate sequence.

[0007] Specifically, the amino acid sequence encoded by the ring-expanding enzyme gene is the ring-expanding enzyme shown in any one of SEQ ID NOs. 12-18.

[0008] Preferably, the amino acid sequence of the acyltransferase is as shown in SEQ ID NO.4, or the NCBI number is ABP51959.1, P15558.2, Q05053.2, AAC34685.2, WP_092168096.1 or its mutants.

[0009] Preferably, the mutant has one or more of the following substitution mutations based on the amino acid sequence shown in SEQ ID NO.4: L409Q, Q679S, S360Q, D154V, A210K, H499V, P316A, Y579E, Q125M, Q372Y, A138S, I660N or M263A.

[0010] Specifically, the introduced acyltransferase is to introduce the encoding gene of the acyltransferase into Acremonium chrysogenum, and it is introduced in the form of an expression cassette expression vector, including a promoter and a terminator. Preferably, the promoter is the endogenous gpda promoter of Acremonium chrysogenum.

[0011] Furthermore, the introduction is site-directed introduction or random introduction.

[0012] Furthermore, it also includes knocking out or inactivating the acetyltransferase gene in Acremonium chrysogenum, and the amino acid sequence encoded by it has the NCBI accession number X65583.1.

[0013] Preferably, the introduction is to insert the encoding gene of the acyltransferase into the position of the acetyltransferase in Acremonium chrysogenum and integrate it into the genome of Acremonium chrysogenum. The amino acid sequence encoded by the acetyltransferase gene has the NCBI accession number X65583.1. Specifically, the acetyltransferase gene sequence is as shown in SEQ ID NO.1 or SEQ ID NO.3 or its degenerate sequence.

[0014] Furthermore, a target site as shown in SEQ ID NO.5 is designed on the acetyltransferase gene. Preferably, the target site is a knockout target site.

[0015] Furthermore, the vector backbone of the expression vector is plasmid pAN or pUC57.

[0016] Further, the selection marker of the expression vector is the nourseothricin resistance gene.

[0017] In the specific implementation, the genes related to the 7-aminodeacetoxycephalosporanic acid synthesis pathway are obtained by gene editing or homologous recombination.

[0018] The present invention also provides a 7-aminodeacetoxycephalosporanic acid-producing strain obtained by the above preparation method.

[0019] The present invention further provides the application of the 7-aminodeacetoxycephalosporanic acid-producing strain in the preparation of 7-aminodeacetoxycephalosporanic acid.

[0020] The present invention also provides a method for preparing 7-aminodeacetoxycephalosporanic acid, comprising the following steps: fermenting the 7-aminodeacetoxycephalosporanic acid-producing strain to obtain 7-aminodeacetoxycephalosporanic acid; optionally, further comprising the step of collecting the 7-aminodeacetoxycephalosporanic acid.

[0021] In the present invention, the deacetoxycephalosporin C synthase / hydroxylase gene and the acetyltransferase gene are knocked out in Acremonium chrysogenum, and the ring-expanding enzyme and acylating enzyme genes are introduced to obtain a 7-aminodeacetoxycephalosporanic acid-producing strain. High-yield and high-purity 7-ADCA can be directly prepared by microbial fermentation. Among them, the yield of 7-ADCA of the recombinant strain SWC2414-L409Q can reach 436 mg / L in the fermentation experiment, and the yield can reach 1000 mg / L in the fermentation experiment of the engineered strain, realizing the industrial fermentation method for synthesizing 7-ADCA. Brief Description of the Drawings

[0022] Figure 1 is the structural formula of 7-aminodeacetoxycephalosporanic acid.

[0023] Figure 2 is the synthesis pathway of 7-aminodeacetoxycephalosporanic acid.

[0024] Figure 3 is the plasmid pAN7-cefG map.

[0025] Figure 4 is the Ac-ΔcefG::cefCPCA verification diagram. Detailed Description of the Invention

[0026] The experimental methods used in the following examples are all conventional methods unless otherwise specified.

[0027] The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0028] In the following examples, there is no special limitation on the detection method of 7-aminocephalosporanic acid concentration, and the detection methods well-known to those skilled in the art can be used.

[0029] The following further details the method for producing a 7-aminocephalosporanic acid-producing bacterium and its method for producing 7-aminocephalosporanic acid according to the present invention with reference to specific examples. The technical solutions of the present invention include but are not limited to the following examples.

[0030] Example 1: Construction of gene editing tools To achieve the synthesis of 7-ADCA in Cephalosporium acremonium, it is first necessary to knockout the deacetoxycephalosporin C synthase / hydroxylase gene in this strain, and introduce the ring-expanding enzymes (i.e., deacetoxycephalosporin C synthase, H7, E727M2, E727M3, E727M5, E735M2, E735M3, E735M5) shown in SEQ ID NO.4 and SEQ ID NOs.7-12 in Patent CN202110676893.1 respectively to construct a DAOC strain (as described in Patent CN202411773160.X). On this basis, the present invention further knocks out the acetyltransferase and introduces an acylase gene to optimize the metabolic pathway. The structural formula of the 7-ADCA is as Figure 1 shown, and the synthesis pathway is as Figure 2 shown.

[0031] To directionally insert the acylase gene into the position of the cefG (acetyltransferase) gene, an editing tool pAN7-cefG gene knockout plasmid was designed and constructed. The sequence of the cefG gene is as shown in SEQ ID NO.1. The sgRNA was designed for the target sequence of the cefG gene, as shown in SEQ ID NO.5: 5’-ACTTGGCCCCGTACGGGCGC-3’, and the corresponding primer pairs were designed: P1cefG-F:agccctgggttcgattcccagattacgcaACTTGGCCCCGTACGGGCGCt (SEQ IDNO.6), P1cefG-R: ttgctatttctagctctaaaacGCGCCCGTACGGGGCCAAGT (SEQ ID NO.7), Using the pAN7 plasmid as a template, PCR amplification was carried out, and the amplification product was recovered. Subsequently, competent cells of the host bacterium were prepared using this plasmid, and Escherichia coli DH5α was preferably used as the host bacterium. Colony PCR verification was carried out by picking single colonies, and the plasmid preliminarily verified to be successful was verified by sequencing. Finally, an sgRNA plasmid capable of specifically recognizing the cefG gene was obtained.

[0032] To further achieve the transformation of this plasmid in Acremonium chrysogenum, the bleomycin resistance gene in it was replaced with the nourseothricin resistance gene, and construction and PCR verification were carried out according to the above method. For the plasmids that were initially verified successfully, sequencing verification was performed to obtain a plasmid that could recognize the cefG gene-specific sgRNA plasmid and the cas9 protein expression cassette. The specific plasmid map is shown in Figure 3 , named pAN7-cefG. This modification not only improved the applicability of the plasmid in Acremonium chrysogenum but also provided important tool support for subsequent gene editing and metabolic engineering.

[0033] Example 2: Construction of homologous repair fragments To achieve precise editing of the target gene, genomic DNA was first extracted from Acremonium chrysogenum (as described in patent CN202411773160.X) using a fungal genomic DNA extraction kit. Based on this template, specific primer pairs as shown in SEQ ID NO.8 - SEQ ID NO.11 were designed: cefG-LA-F: GACAAGATTGCGATGATGTGGAT(SEQ ID NO.8); cefG-LA-R: GGTGGGCGACGTGTGGCTGTAGGTGA(SEQ ID NO.9); cefG-RL-F: AGGCTATGGAGGTGTCAGCCTGCCGGT(SEQ ID NO.10); cefG-RL-R: GTGAAATGTGCTATGTTGCATCAAGTACC(SEQ ID NO.11), which were used to amplify the left homologous arm (LA) and right homologous arm (RL) gene fragments, with lengths of 705bp and 869bp respectively.

[0034] Next, using the corresponding acyltransferase NCBI numbers as P15558.2 (from Pseudomonas sp. SE83 strain), Q05053.2 (from Pseudomonas sp. V22 strain), AAC34685.2 (from Pseudomonas sp. 130 strain), WP_092168096.1 (from Bosea sp. OK403 strain, XY408) and ABP51959.1 (from Pseudomonas sp. GK16 strain, shown in SEQ ID NO.4) as templates to amplify the corresponding acyltransferase fragments, and homologous recombination was used to obtain acyltransferase fragments containing homologous arm fragments such as LA-XY408-RL, LA-SE83-RL, LA-P130-RL, LA-V22-RL, LA-GK16-RL.

[0035] Example 3: Transformation of Cephalosporium acremonium strain with cephalosporin C acylase and verification of recombinant transformants The donor DNA was co-transfected with the above constructed editing tool into the protoplasts of Cephalosporium acremonium (recombinant strain SWC01-SWC41 containing different types and copies of ring-expanding enzymes as described in patent CN202411773160.X), and then coated on a selective medium for screening. The medium consisted of a selective upper-layer basal medium (supplemented with nourseothricin) and a lower-layer MMSN basal medium (containing 0.95 M sucrose, 0.6 / 1.2% agar, 0.05% glucose, 0.02% ASP+N, 2 mM magnesium sulfate heptahydrate, 0.01% trace element solution). The trace element solution formula included components such as EDTA, ZnSO 4 ·7H2O, MnCl2·4H2O, etc. The treated culture dishes were inverted and the results were observed after culturing at 30°C for 5 days.

[0036] Select the transformed Cephalosporium acremonium strains from the regenerated plates and inoculate them on PDA solid medium for continuous culture until the mycelium bulges and surface wrinkles appear. Subsequently, transfer the mycelium to liquid PDA medium and culture for 4 days. Extract genomic DNA using the liquid nitrogen grinding method and perform subsequent PCR amplification and sequencing analysis. The PCR experiment designs positive control (using plasmid DNA as template), negative control (using the genomic DNA of the Cephalosporium acremonium starting strain as template), and experimental group (using the genomic DNA of recombinant transformants as template). If the cephalosporin C acylase has been successfully integrated, it is expected that a target resistance gene fragment of approximately 1026 bp can be amplified in the experimental group. Finally, send the obtained PCR products for sequencing identification, evaluate the fermentation performance of the correct transformants, and preserve the recombinant transformants that have transferred the plasmid and been verified successfully with glycerol. Rename the verified successful recombinant transformants according to the type of transferred plasmid (i.e., the type of acylase and the copy number and type of ring-expanding enzyme). The acylases are XY408, SE83, P130, V22, GK16, and the ring-expanding enzymes are H7, E727M2, E727M3, E727M5, E735M2, E735M3, E735M5 (as shown in SEQ ID NO.12 - SEQ ID NO.18). The number of times the ring-expanding enzyme appears represents the copy number. PgpdA, Pacv, Ptef1, PtrpC, Pipns are different types of promoters. For example, 727M2-SE83 means the ring-expanding enzyme is 727M2 with a single copy, the acylase is SE83, the corresponding NCBI number of the acylase is P15558.2, and the recombinant transformant containing this gene fragment is named SWC2401; H7-H7-H7-H7-XY408 means the ring-expanding enzyme H7 has 4 copies, the acylase is XY408, the corresponding NCBI number of the acylase is WP_092168096.1, and the recombinant transformant containing this gene fragment is named SWC2413; and so on, as shown in Table 1.

[0037] The recombinant transformant containing the 727M2-SE83 gene type is named SWC2401; the recombinant transformant containing the 727M3-SE83 gene type is named SWC2402, the recombinant transformant containing the H7-SE83 gene type is named SWC2403, the recombinant transformant containing the H7-H7-SE83 gene type is named SWC2404, the recombinant transformant containing the PgpdA-727M2-727M2-SE83 gene type is named SWC2405, the recombinant transformant containing the Pacv-727M2-727M2-SE83 gene type is named SWC2406, the recombinant transformant containing the Pacv-H7-H7-SE83 gene type is named SWC2407, the recombinant transformant containing the 727M2-727M2-P130 gene type is named SWC2408, the recombinant transformant containing the 727M2-727M2-727M2-V22 gene type is named SWC2409, the recombinant transformant containing the LA-727M2-727M2-727M2-727M2-P130 gene type is named SWC2410, the recombinant transformant containing the H7-H7-P130 gene type is named SWC2411, the recombinant transformant containing the H7-H7-H7-P130 gene type is named SWC2412, the recombinant transformant containing the H7-H7-H7-H7-XY408 gene type is named SWC2413, the recombinant transformant containing the PgpdA-727M2-GK16 gene type is named SWC2414, the recombinant transformant containing the Ptef1-727M2-P130 gene type is named SWC2415, the recombinant transformant containing the PtrpC-727M2-V22 gene type is named SWC2416, the recombinant transformant containing the Pacv-727M2-V22 gene type is named SWC2417, the recombinant transformant containing the Pipns-727M2-P130 gene type is named SWC2418, the recombinant transformant containing the PgpdA-H7-SE83 gene type is named SWC2419, the recombinant transformant containing the Ptef1-H7-V22 gene type is named SWC2420, the recombinant transformant containing the PtrpC-H7-X408 (the ring-expanding enzyme is a single copy of H7, and the acylating enzyme is XY408,The recombinant transformants with the promoter PtrpC gene type were named SWC2421, those with the Pacv-H7-X408 gene type were named SWC2422, those with the Pipns-H7-V22 gene type were named SWC2423, those with the PgpdA-727M2-727M2-V22 gene type were named SWC2424, those with the PgpdA-727M2-727M2-727M2-V22 gene type were named SWC2425, those with the PgpdA-727M2-727M2-727M2-727M2-V22 gene type were named SWC2426, those with the PgpdA-H7-H7--GK16 gene type were named SWC2427, those with the PgpdA-H7-H7-H7-P130 gene type were named SWC2428, those with the PgpdA-H7-H7-H7-H7-P130 gene type were named SWC2429, those with the Pacv-727M2-727M2-P130 gene type were named SWC2430, those with the Pacv-727M2-727M2-727M2-P130 gene type were named SWC2431, those with the Pacv-727M2-727M2-727M2-727M2-P130 gene type were named SWC2432, those with the Pacv-H7-H7-P130 gene type were named SWC2433, those with the Pacv-H7-H7-H7-SE83 gene type were named SWC2434, those with the Pacv-H7-H7-H7-H7-727M2-SE83 gene type were named SWC2435, those with the Pipns-727M2-727M2-GK16 gene type were named SWC2436, those with the Pipns-727M2-727M2-727M2-P130 gene type were named SWC2437, those with the Pipns-727M2-727M2-727M2-727M2-XY408 gene type were named SWC2438, those with the Pipns-H7-H7-SE83 gene type were named SWC2439, those with the Pipns-H7-H7-H7-V22 gene type were named SWC2440, those with the Pipns-H7-H7-H7-H7-P130 gene type were named SWC2441.,

[0038] Table 1. Recombinant bacteria corresponding to successfully verified recombinant transformants

[0039] Example 4, Fermentation Verification of Recombinant Transformants The correctly verified recombinant Cephalosporium acremonium in Example 3 was activated and cultured. Using an inoculation needle, streaking was performed on a PDA solid medium plate containing norbomycin at a final concentration of 300 μg / mL. After treatment with a sealing film, the culture plate was inverted and cultured in an incubator at 30 °C for 12 - 14 d. When large monoclonal mycelia grew on the streaked plate and the surface was significantly raised, the monoclonal was picked up using an inoculation loop and a colony strip with a size of 3×4 cm was drawn on another culture plate, and continued to be cultured for 12 - 14 d. The colony strip grown from the plate was inoculated into a 100 mL shake flask containing 20 mL of seed medium (corn steep liquor 30 g·L -1 , sucrose 35 g·L -1 , glucose 5 g·L -1 , methionine 0.5 g·L -1 , ammonium sulfate 8 g·L -1 , calcium carbonate 5 g·L -1 , soybean oil 5 g·L -1 , natural pH), and cultured at 28 °C with 230 rpm for 4 d. Then, it was transferred to a 7.5 L fermenter containing 3 L of fermentation medium (corn steep liquor 60 g·L -1 , soybean oil 60 g·L -1 , glucose 40 g·L -1 , starch 30 g·L -1 , dextrin 20 g·L -1 , α - amylase 0.2 g·L -1 , D / L - methionine 6 g·L -1 , ammonium sulfate 30 g·L -1 , magnesium sulfate 3 g·L -1 , calcium carbonate 5 g·L -1 , potassium dihydrogen phosphate 7 g·L -1 , trace elements (ferrous sulfate 0.3 g·L -1 , copper sulfate 0.02 g·L -1 , zinc sulfate 0.02 g·L -1 , manganese sulfate 0.01 g·L -1 ), and the pH was adjusted to 7.4 with sodium hydroxide for fermentation in a 7.5 L fermenter.

[0040] HPLC Detection of Fermentation Products: Approximately 10 mL of the fermentation broth was taken out from the fermenter and used for the determination of glucose content, nitrogen content, dry cell weight, microscopic examination of bacteria, and HPLC determination respectively. The sample preparation conditions for HPLC determination were as follows: 200 μL of the fermentation broth was mixed with 800 μL of methanol, vortexed to terminate the reaction, and the sample was sterilized with a filter membrane before injection. A chromatographic column ZORBAX SB-C18 Analytical 4.6×150 mm 5-Micron was used, and the mobile phase conditions were as follows: mobile phase A was 4% methanol, mobile phase B was 96% 0.2% phosphate, and the pH was adjusted to 7.4 with sodium hydroxide. The detection conditions were as follows: UV detector, 254 nm, running for 15 min, injecting 10 μL, column temperature 30 °C, flow rate 1 mL / min. The detection procedure is shown in Table 2, and the detection results are shown in Table 3. 7-ADCA was detected in the fermentation broth, indicating that the recombinant Cephalosporium acremonium transformant obtained in the present invention can directly ferment and produce 7-ADCA in one step. If the fermentation process and the product purification and extraction steps are further optimized, the 7-ADCA-producing bacteria obtained in the present invention can fully have the potential for industrial use.

[0041] Table 2, 7-ADCA Detection Procedure

[0042] Table 3, Verification of Fermentation Transformants

[0043] Example 5, Screening of Acylase Mutants and Fermentation Verification To further enhance the activity of deacylase in Cephalosporium acremonium, the error-prone PCR method was used to establish a random mutant library with the acyltransferase gene sequence (CPCA) in the SWC2414 strain in Example 4 as a template to obtain a higher conversion rate of the product 7-ADCA. The reaction conditions for error-prone PCR were as follows: using the acyltransferase (ABP51959.1) of the Pseudomonas sp. GK16 strain in Example 2 as a template, the reaction system included: 10 ng of template, 50 mM KCl, 2 mM MgCl2, 0.05 - 0.075 mM MnCl2, 0.2 mM dATP, 0.2 mM dGTP, 1.0 mM dCTP, 1.0 mM dTTP, 0.2 μM of upstream and downstream primers, and 5 U of Taq enzyme. The PCR reaction conditions were: 94°C for 3 min; (94°C, 20 s; 55°C, 20 s; 72°C, 60 s) for 25 cycles; 72°C for 3 min to obtain the gene mutation fragment of acyltransferase. The homologous repair fragment was constructed according to Example 2. The homologous fragment and the editing tool in Example 1 were co-transformed into Cephalosporium acremonium to obtain strains of different mutants.

[0044] Cultivation and fermentation verification were carried out on different mutant strains according to the method in Example 4, and the results are shown in Table 4: Table 4. Identification of 7-ADCA production

[0045] According to the 7-ADCA production data shown in Table 4, there were significant differences in the 7-ADCA production of different strains. The 7-ADCA production of the strain SWC2414-L409Q was the highest, reaching 436 mg / L. Followed by SWC2414-Q679S with a production of 432 mg / L, SWC2414-S360Q and SWC2414-D154V with productions of 413 mg / L and 410 mg / L respectively, and the production of SWC2414-M263A was the lowest at 255 mg / L. Generally speaking, the performances of these strains in 7-ADCA production were different, indicating that gene modification had a significant impact on 7-ADCA production.

[0046] Example 6. Construction of recombinant Cephalosporium acremonium engineering bacteria (Ac-ΔcefG::cefCPCA) The acyltransferase of the recombinant strain SWC2414-L409Q in Example 5 was constructed into the pUC57 expression vector as Figure 4 shown to obtain the pUC57-GK16-L409Q plasmid. The plasmid was transformed into Cephalosporium acremonium. Fermentation culture was carried out according to Example 4, and fermentation was carried out in 7.5 L to check for 1000 mg / L of the 7-ADCA product.

[0047] In summary, the 7-aminocephalosporanic acid-producing bacterium and its preparation method provided by the present invention have efficient conversion of raw materials under mild conditions, not only significantly improving the yield, but also having good environmental friendliness and economic feasibility, and having broad industrial application prospects.

Claims

1. A method for preparing a 7-amino deacetoxycephalosporanic acid-producing strain, characterized in that, Knock out the deacetoxycephalosporin C synthase / hydroxylase gene and the acetyltransferase gene in Cephalosporium acremonium, and introduce an expandase and an acyltransferase to obtain a 7-aminodeacetoxycephalosporanic acid-producing strain.

2. The preparation method according to claim 1, wherein The amino acid sequence encoded by the deacetoxycephalosporin C synthase / hydroxylase gene has the NCBI accession number P11935.1, and the amino acid sequence encoded by the expandase gene is the expandase shown by any one of SEQ ID NOs. 12-18.

3. The preparation method according to claim 2, characterized in that, The acyltransferase sequence is as shown in SEQ ID NO. 4 or has the NCBI number ABP51959.1, P15558.2, Q05053.2, AAC34685.2, WP_092168096.1 or its mutants; The mutants have one or more of the following substitution mutations based on the sequence shown in SEQ ID NO. 4: L409Q, Q679S, S360Q, D154V, A210K, H499V, P316A, Y579E, Q125M, Q372Y, A138S, I660N or M263A.

4. The preparation method according to claim 2, characterized in that: The introduction of the acyltransferase is to introduce the encoding gene of the acyltransferase into Cephalosporium acremonium and import it in the form of an expression cassette expression vector, including a promoter and a terminator.

5. The preparation method according to claim 4, characterized in that, It also includes knocking out or inactivating the acetyltransferase gene in Cephalosporium acremonium, and the amino acid sequence encoded by it has the NCBI accession number X65583.

1.

6. The preparation method according to claim 5, wherein, The introduction is to insert the encoding gene of the acyltransferase into the position of the acetyltransferase in Cephalosporium acremonium and integrate it into the genome of Cephalosporium acremonium, and the amino acid sequence encoded by the acetyltransferase gene has the NCBI accession number X65583.

1.

7. The preparation method according to claim 4, characterized in that, The vector backbone of the expression vector is pAN or pUC57.

8. A 7-aminodeacetoxycephalosporanic acid-producing strain obtained by the preparation method according to any one of claims 1-7.

9. Use of the 7-aminodeacetoxycephalosporanic acid-producing strain according to claim 8 in the preparation of 7-aminodeacetoxycephalosporanic acid.

10. A method for preparing 7-aminodeacetoxycephalosporanic acid, comprising the following steps: fermenting the 7-aminodeacetoxycephalosporanic acid-producing strain according to claim 8 to obtain 7-aminodeacetoxycephalosporanic acid, and collecting the 7-aminodeacetoxycephalosporanic acid.

Images