Klebsiella pneumoniae recombinant bacterium with high hydrogen production capacity
By knocking out the budC gene for Klebsiella pneumoniae Y7-3, the recombinant strain Klebsiella pneumoniae Y7-3-ΔbudC-2096 was constructed, which solved the problem of insufficient hydrogen energy utilization in the prior art and achieved efficient hydrogen production.
Patent Information
- Application Number
- CN202510230678.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-10-18
- Filing Date
- 2025-02-28
- Publication Date
- 2025-07-08
AI Technical Summary
The prior art is difficult to effectively utilize agricultural straw resources to prepare high value-added hydrogen energy, and the hydrogen production capacity of bio-hydrogen production technology is insufficient.
By knocking out the budC gene for Klebsiella pneumoniae Y7-3, the recombinant strain Klebsiella pneumoniae Y7-3-ΔbudC-2096 was constructed to improve its hydrogen production capacity.
显著提高了肺炎克雷伯菌的氢气产量,扩大了其在生产中的应用潜力,并为研究其产氢机制提供了参考。
Smart Images

Figure CN120272390A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly to a recombinant Klebsiella pneumoniae strain with high hydrogen-producing ability. Background Art
[0002] In today's society, the energy problem has become a major challenge affecting the development of human society and the quality of life. With the continuous growth of the world population and economy, the accelerating development of urbanization has led to a continuous increase in energy demand. However, currently, humans mainly rely on fossil energy to meet the growing energy demand. This not only leads to the depletion of fossil energy but also faces an increasing resource crisis, and also causes a large amount of greenhouse gas emissions and global climate change, bringing huge environmental risks and economic losses to human society. Therefore, the problem that needs to be solved urgently at present is how to use clean, sustainable and renewable energy to replace traditional fossil energy.
[0003] Among many renewable energies, hydrogen energy is a clean energy with high potential and prospects. The calorific value of H2 is as high as 142 kJ / g, which is one of the fuels with the highest known calorific value at present. It has been widely used in many fields such as power generation, energy storage, and transportation. With the development of fields such as hydrogen energy power generation, hydrogen energy batteries, hydrogen energy vehicles, and hydrogen energy storage, various hydrogen production technologies have been continuously developed, mainly including electrolysis, photolysis, thermal decomposition, and biological hydrogen production. Among them, electrolysis is one of the most mature hydrogen production technologies at present, but it requires a large amount of electricity; photolysis and thermal decomposition are technologies that use solar energy or nuclear energy to decompose water or other compounds to produce hydrogen, but these two technologies are difficult and costly, and have not been commercialized yet; biological hydrogen production is a new type of hydrogen production technology that uses microorganisms or plant biomass to produce hydrogen, and has the advantages of mild reaction conditions, wide raw material sources and completely renewable, and environmental friendliness.
[0004] The total annual biomass energy in China is about 3.494 billion tons. Among them, the theoretical resource amount of straw is about 829 million tons, and the collectable resource is about 694 million tons. Long-term stacking is likely to cause fires or environmental pollution by burning. How to resourcefully utilize agricultural straw has become a hot topic of research. Using the biological hydrogen production method to convert these corn straw resources into high-value-added hydrogen energy not only avoids waste but also reduces the environmental pollution caused by improper straw treatment. Summary of the Invention
[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a recombinant Klebsiella pneumoniae strain with high hydrogen-producing ability. The Klebsiella pneumoniae Y7-3 strain is used as the starting strain for transformation to obtain a recombinant Klebsiella pneumoniae strain with relatively high hydrogen-producing ability.
[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:
[0007] A recombinant Klebsiella pneumoniae with high hydrogen production ability, the recombinant Klebsiella pneumoniae is named (Klebsiella pneumoniae) Y7-3-ΔbudC-2096, and is preserved in Guangdong Provincial Microbiological Culture Collection Center on June 28, 2024, with a preservation number of GDMCC NO: 64811, and a preservation address of 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.
[0008] Furthermore, the recombinant Klebsiella pneumoniae is obtained by taking Klebsiella pneumoniae Y7-3 as the starting strain and knocking out the budC gene with the sequence number SEQ ID NO.1.
[0009] Compared with the prior art, the present invention has the following beneficial effects:
[0010] The invention uses Klebsiella pneumoniae Y7-3 as a starting bacterium for transformation to obtain a recombinant Klebsiella pneumoniae with improved hydrogen production capacity, which can expand the application of Klebsiella pneumoniae as an engineering bacterium in production and provide a reference for studying the mechanism of hydrogen production by Klebsiella pneumoniae. BRIEF DESCRIPTION OF THE DRAWINGS
[0011] Figure 1 This is a diagram showing the results of the Klebsiella pneumoniae Y7-3 gene knockout validation;
[0012] Figure 2 This is a graph showing the results of hydrogen content determination of the recombinant bacteria. DETAILED DESCRIPTION
[0013] The present invention is further described below in conjunction with the accompanying drawings and embodiments. The embodiments of the present invention include but are not limited to the following embodiments.
[0014] This embodiment provides a recombinant Klebsiella pneumoniae with high hydrogen production ability, and increases the hydrogen production efficiency of the strain by selecting a suitable Klebsiella pneumoniae strain and deleting the budC gene.
[0015] In this embodiment, a hydrogen-producing Klebsiella pneumoniae strain was first screened from the bovine rumen, named Klebsiella pneumoniae Y7-3, deposited at the China Center for Type Culture Collection, with the deposit number CCTCC NO: M2019851, and the deposit address being: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. This Klebsiella pneumoniae is prior art and has been disclosed in Chinese Patent Application CN111548959A. Whole-genome sequencing was performed on Klebsiella pneumoniae Y7-3, and its genome accession number in the NCBI database is SAMN28890170.
[0016] To further improve the hydrogen-producing ability of Klebsiella pneumoniae Y7-3, by analyzing the genomic data of Klebsiella pneumoniae Y7-3, a gene related to hydrogen production was found and knocked out, obtaining a metabolically engineered bacterium that can improve hydrogen production.
[0017] Metabolic engineering transformation is to construct a recombinant bacterium based on Klebsiella pneumoniae Y7-3. The construction method includes constructing a recombinant plasmid and introducing the recombinant plasmid into the competent cells of Klebsiella pneumoniae Y7-3. The specific operations are as follows:
[0018] (1) Insert the homologous arm gene of (S,S)-butanediol dehydrogenase / diacetyl reductase (budC) between the BamH I and Hind III restriction sites of the pK18mobSacB×101-2096 plasmid (with kanamycin resistance, and the vector has been modified) to obtain the recombinant plasmid pK18mobSacB×101-ΔbudC-2096; the gene sequence of (S,S)-butanediol dehydrogenase / diacetyl reductase (budC) is shown in SEQ ID NO.1, and the homologous arm gene sequences of budC are as shown in SEQ ID NO.2 and SEQ ID NO.3. It should be noted that the homologous arm gene sequence of budC inserted between the BamH I and Hind III restriction sites of the pK18mobSacB×101-2096 plasmid is a fusion sequence of SEQ ID NO.2 and SEQ ID NO.3:
[0019] SEQ ID NO.1 (gene):
[0020] 5’-ATGAAAAAAGTCGCACTTGTTACCGGCGCCGGCCAGGGGATTGGT AAAGCTATCGCCCTTCGTCTGGTGAAGGATGGATTTGCCGTGGCCATTGCCGATTATAACGACGCCACCGCCAAAGCGGTCGCCTCCGAAATCAACCAGGCCGGCGGCCGCGCCATGGCGGTGAAAGTGGATGTCTCCGACCGCGATCAGGTGTTTGCCGCTGTCGAACAGGCGCGCAAAACGCTGGGCGGCTTCGACGTCATCGTCAACAACGCCGGCGTGGCGCCGTCCACGCCGATCGAGTCCATTACCCCGGAGATTGTCGATAAAGTCTACAACATCAACGTCAAAGGGGTGATCTGGGGCATTCAGGCGGCGGTCGAGGCCTTTAAGAAAGAGGGTCACGGCGGGAAAATCATCAACGCCTGTTCCCAGGCCGGCCACGTCGGCAACCCGGAGCTGGCGGTGTATAGCTCCAGTAAATTCGCCGTACGCGGCTTAACCCAGACCGCCGCTCGCGACCTCGCGCCGCTGGGCATCACGGTCAACGGCTACTGCCCGGGGATCGTCAAAACGCCGATGTGGGCCGAAATTGACCGCCAGGTGTCCGAAGCTGCCGGTAAACCGCTGGGCTACGGTACCGCCGAGTTCGCCAAACGCATCACCCTTGGTCGTCTGTCCGAACCGGAAGATGTCGCCGCCTGCGTCTCCTATCTTGCCAGCCCGGATTCTGATTATATGACCGGTCAGTCATTGCTGATCGACGGCGGGATGGTATTTAACTAA-3’
[0021] SEQ ID NO.2 (upstream homologous arm sequence of budC):
[0022] 5’-GCCCGCTACCTTTACAGCTTCCGCGCCCGTCAGGTGATGATCTCC AACGGCCAGCAGACCATGGGCGTCGCCCTGCCCTGGGCCATCGGCGCCTGGCTGGTCAATCCTGAGCGCAAAGTGGTCTCCGTCTCCGGCGACGGCGGTTTCCTGCAGTCGAGCATGGAACTGGAGACCGCCGTCCGCCTGAAAGCCAACGTGCTGCACCTGATCTGGGTCGATAACGGTTACAACATGGTGGCCATCCAGGAAGAGAAAAAATATCAGCGCCTGTCCGGCGTCGAGTTCGGGCCGATGGATTTTAAAGCCTATGCCGAGTCCTTCGGCGCCAAAGGGTTTGCCGTGGAAAGCGCCGAGGCGCTGGAGCCGACCCTGCGCGCGGCGATGGACGTCGACGGCCCGGCGGTAGTGGCCATCCCGGTGGATTATCGCGATAACCCGCTGCTGATGGGTCAGCTGCATCTGAGTCAGATTCTGTAAGTCATCACAATAAGGAAAGGAAA-3’
[0023] SEQ ID NO.3 (downstream homologous arm sequence of budC): 5’-TAAATAATAAGCTCTGACATGGCTTGCCCCTGCTGATATGCAGGGGCTTTTTTTGTTTGAGAGTAAGCATTACGGTAAAACGAACCCTCTATTGATAGGTAGAGTCCGCTCCAGGCGCCCAGGGGATGTTAACGGCGTAGACGTTGCGTCAGGCGACTAGTCATTAAAAGTGCTTACTGCTTATTTGCGGGACCGCCGTCTGATTTGGGTGGGATCTTGACGACTAATCTTTGAGCTATTCCCGGTTTGCCCTTTTCAAAGCGCCATTTTTTAAGCATTTTATCAATGACTTGATGTTCCAACTCCGGAGTCGTTGTCGATTCAAGTATCTTTACATTCTGAATTCTGCCATCTGAATCAACATCGTACTGAATCCGCAGGAAACTCGGCAGTAGGTTTCCGTTCTTATCACGAGTGGTAATTGATGTGTTTGCAGAGGAAATGCTGCCTGAAGGTGTGCTGGCGCTGGCCTCTGTGCTGGCGCAGAGTGTCAGTAACAA-3’
[0024] (2) Construction of budC gene knockout strain: After the successfully constructed pK18mobSacB×101-ΔbudC-2096 plasmid was verified by sequencing, it was electrotransformed into the competent cells of Y7-3 strain. The first screening was carried out on the LB resistant plate (containing kanamycin with a final concentration of 100 mg / L) to obtain the single crossover strain. Then, the correctly screened single colony was picked and cultured in 5-10 mL LB liquid medium until the logarithmic phase, and then spread on the LB medium containing 10% sucrose and cultured until colonies grew out to obtain the double crossover strain, that is, the Klebsiella pneumoniae recombinant bacterium with the budC gene knocked out.
[0025] The recombinant bacterium and the wild Y7-3 strain (Y7-3 strain without the budC gene knocked out) were verified by PCR, and the results of gel electrophoresis verification are as Figure 1 shown. Lane 1 is the PCR product of 903 bp of the upstream and downstream primers of the budC gene of the wild strain; Lane 2 is the PCR product of 203 bp of the upstream and downstream primers of the △budC-2096 strain. The upstream and downstream primers of the wild strain budC are shown in sequences SEQ ID NO.4 and SEQ ID NO.5:
[0026] SEQ ID NO.4 (budC-F):
[0027] 5’-AAGCCCCTGCATATCAGCAG-3’
[0028] SEQ ID NO.5 (budC-R):
[0029] 5’-GTGGATTATCGCGATAACCCGC-3’
[0030] The upstream and downstream primers of the △budC-2096 strain are shown in SEQ ID NO.6 and SEQ ID NO.7:
[0031] SEQ ID NO.6 (△budC-2096-F):
[0032] 5’-TCTACCTATCAATAGAGGGTTCGTTTTACC-3’
[0033] SEQ ID NO.7 (△budC-2096-R): 5’-CGGTAGTGGCCATCCCG-3’
[0034] By comparing Figure 1 lanes 1 and 2 in
[0035] it can be shown that the budC gene in the Klebsiella pneumoniae recombinant bacterium obtained in this example has been successfully knocked out. 600 The method for preparing competent cells and electrotransformation of Klebsiella pneumoniae Y7-3 in the above steps: ① Pick a single colony and culture it in an LB medium on a shaker at 37 °C for 12 h; ② Take 1 mL and transfer it to 100 mL of LB medium, and culture it vigorously on a shaker at 37 °C until OD
[0036] The obtained recombinant Klebsiella pneumoniae was named Klebsiella pneumoniae Y7-3-ΔbudC-2096, and was deposited in the Guangdong Provincial Microbiological Culture Collection on June 28, 2024, with the collection number GDMCC NO: 64811, and the collection address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.
[0037] This example also measures the hydrogen production of the recombinant bacteria obtained above, including:
[0038] 1. Fermentation and cultivation of recombinant bacteria
[0039] The recombinant bacteria obtained above were activated in resistance culture medium plates, and then inoculated into seed culture medium, and cultured at 37° C. and 180 rpm in a shaking incubator for 12 to 16 hours to obtain seed solution;
[0040] The solvent of the seed culture medium is water, and the solutes are: 10g / L tryptone, 10g / L sodium chloride, 5g / L yeast extract powder; the pH value is 7.0; add 20mL of seed culture medium to a 100mL vial, evacuate and fill with nitrogen to remove oxygen to ensure an anaerobic environment, sterilize in a high-pressure steam sterilizer and set aside. Inoculate 5% of the seed liquid under sterile conditions, culture in a constant temperature incubator at 37°C and 180rpm for 24h to determine the hydrogen content;
[0041] Resistance medium plate: Add kanamycin (final concentration 100 μg / mL) and 20 g / L agar powder to the seed medium.
[0042] 2. Determination of hydrogen content in fermentation gas
[0043] Fermentation gas collection: Use a 50 mL clean and sterile syringe to extract all the fermentation gas from the sealed vial, transfer it to a gas collection bag, and use the syringe to measure the total amount of gas during the fermentation process;
[0044] Determination of hydrogen content: Fermentation gas was detected using gas chromatography, the chromatographic model was SP-3420A, the chromatographic column model was TDX-1 filling column, the column temperature was 150°C, the detector temperature was 160°C, the hot wire was 160°C, and high-purity argon was used as the carrier gas;
[0045] The hydrogen content test results are as follows: Figure 2 As shown in the figure, it can be seen that compared with the control group (Klebsiella pneumoniae Y7-3), the hydrogen molar yield of Klebsiella pneumoniae Y7-3-ΔbudC-2096 increased by 50.10%, indicating that the knockout of the budC gene can significantly increase the hydrogen production of Klebsiella pneumoniae Y7-3.
[0046] The above embodiments are only one of the preferred embodiments of the present invention and should not be used to limit the protection scope of the present invention. Any meaningless changes or polish made on the main design concept and spirit of the present invention, as long as the technical problems solved are still the same as those of the present invention, should be included in the protection scope of the present invention.
Claims
1. A Klebsiella pneumoniae recombinant bacterium with high hydrogen-producing ability, characterized in that, The recombinant Klebsiella pneumoniae was named (Klebsiella pneumoniae) Y7-3-ΔbudC-2096 and was deposited at the Guangdong Microbial Culture Collection Center on June 28, 2024, with the deposit number GDMCC NO: 64811 and the deposit address: 5th Floor, Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou.
2. The Klebsiella pneumoniae recombinant bacterium with high hydrogen production ability according to claim 1, characterized in that, The recombinant Klebsiella pneumoniae was obtained by knocking out the budC gene with the sequence number SEQ ID NO.1 using Klebsiella pneumoniae Y7-3 as the starting strain.
Citation Information
Patent Citations
Klebsiella pneumoniae and application thereof
CN111548959A