Gene-knocked-in bovine primary cell for rapid proliferation of myogenic cells and preparation method of bovine primary cell

Abstract

The invention relates to a myogenic cell rapid proliferation gene knock-in bovine primary cell and a preparation method thereof, and belongs to the technical field of gene editing and biology. Specific sgRNA is designed aiming at a bovine genome safety site H11, and directional insertion of a target gene is realized by taking a gene containing a homologous arm and a muscle-promoting cell proliferation gene Ufc1 and a gene Ufl1 as a donor template through Cas9 protein mediated DNA double-strand cutting. The method has the advantages that the cutting efficiency of the safety site H11 is improved to 90% or above, so that the obtaining rate of the positive monoclonal cell strain can be remarkably improved; the ssDNA is used as a donor fragment to be introduced into bovine fibroblasts, the survival rate of electrotransfected cells is two times that of double-stranded plasmid DNA, and meanwhile, the transfection efficiency is improved by more than four times. The cell proliferation efficiency of the Ufc1 gene knock-in cell strain is improved by 1.6 times compared with that of a wild type, and the Ufc1 gene knock-in cell strain is applied to cattle and provides important technical support for genetic improvement of muscle tissue engineering and animal husbandry.

Description

Technical Field

[0001] The present invention relates to a bovine primary cell with a myocyte-promoting rapid proliferation gene knocked in and a preparation method thereof, belonging to the fields of gene editing and biotechnology. Background Art

[0002] Among the significant differences in the feed conversion rate of economic animals from 1:1.5 to 1:15, cattle, as ruminants, have a feed conversion rate as high as 1:15, directly increasing the production cost of beef.

[0003] In the field of clinical treatment, the CRISPR / Cas9-mediated targeted integration technology has shown great potential. To improve the efficiency of CRISPR / Cas9-mediated KI experiments, it is crucial to use highly efficient sgRNAs. Currently, CRISPR-Cas9 genome-edited human cell therapies have recently entered the clinic. For example, targeting the chimeric antigen receptor (CAR) insertion into the TRAC locus (constant region of the T cell receptor (TCR) α chain), which enhances the potency and persistence of CAR-T cells in preclinical studies by utilizing the endogenous gene regulatory elements that control normal TCR expression. However, this method has not been applied to large animals such as cattle. Several different methods are used to introduce donor templates, including viral transduction with recombinant adeno-associated virus (rAAV) or co-electroporation with naked DNA in the form of double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), circular or linear. rAAV has amazing knock-in efficiency and the lowest toxicity, but its cost and complexity severely restrict its development. Non-viral methods have been applied to primary human cell types; however, further improvement is needed (especially for large templates and other species) to reduce DNA toxicity, improve knock-in purity, and increase cell yield.

[0004] Numerous studies have shown that UFMylation-related genes (including but not limited to core members such as Ufc1 and Ufl1) play a crucial role in the processes of muscle cell proliferation and differentiation by regulating cell protein biosynthesis, cell cycle progression, and other aspects. For example, overexpressing UFC1 and UFL1 proteins can significantly accelerate the proliferation rate of myoblasts. Our previous research further revealed that when the expression of key genes UFL1 / DDRGK1 / CDK5RAP3 in the UFMylation system is downregulated, the muscle development of mice is severely impaired; conversely, overexpressing the Ufc1 gene in mouse myoblast C2C12 cells can effectively enhance the proliferation efficiency of the cells. Based on this discovery, targeted overexpression of UFMylation-related genes in bovine muscle cells through gene editing technology is expected to significantly improve the proliferation efficiency of bovine muscle cells, thereby optimizing the feed conversion rate and meat yield of beef cattle and promoting the development of the beef cattle industry. However, currently, gene editing research on bovine muscle growth at home and abroad focuses on the application of the myostatin (MSTN) gene or β-adrenergic agonists, and there are few reported successful cases so far. This highlights the urgency and importance of exploring new regulatory mechanisms such as UFMylation modification in the beef cattle industry. Summary of the Invention

[0005] The objective of the present invention is to propose a gene knock-in bovine primary cell technology and its supporting preparation method that can promote the rapid proliferation of muscle cells in view of the deficiencies existing in the prior art. Specifically, this method aims to safely and efficiently achieve the targeted knock-in of genes promoting muscle cell proliferation in bovine fetal fibroblasts through precise gene editing means, thereby providing a new approach for the genetic improvement of high-yield traits of beef cattle and the breeding of excellent varieties.

[0006] To achieve this goal, the present invention first screened and determined suitable safe insertion sites in the bovine genome, designed sgRNAs for these sites, and verified their activities. A suitable vector system was selected to integrate and construct the target gene promoting muscle cell proliferation and homologous arm fragments of matching length, or ssDNA was used as a direct donor template. Subsequently, using advanced electroporation technology, Cas9 nuclease protein, sgRNA, and donor plasmid were co-introduced into bovine fetal fibroblasts, and the knock-in efficiencies of different templates and their toxicities to the cells were compared. After drug screening, monoclonal cells with good growth status were selected for further culture. Finally, through comprehensive identification by multiple molecular biology techniques such as Sanger sequencing, qPCR, and Western Blot, monoclonal positive cells that successfully achieved gene knock-in were confirmed and obtained.

[0007] Based on the above objectives, the present invention relies on the CRISPR / Cas9 technology and successfully constructs targeted modification of the bovine genomic safe site H11, and realizes the stable knock-in of the myoblast proliferation-promoting gene in bovine fetal fibroblasts. Specifically, the present invention first develops a primary bovine cell with the knock-in of the myoblast rapid proliferation gene. The primary bovine cell is preserved in the China Center for Type Culture Collection (CCTCC), Wuhan University, with the preservation number CCTCC NO: C202520, and the cell classification name: bovine fetal fibroblast Bff-uf11KI, and the preservation date is December 24, 2024. It provides cell resources for subsequent research.

[0008] The present invention selects an sgRNA targeting the non-coding region of the bovine H11 locus, which is located in the intersection region between the transcription start points of two key genes, Drg1 (Gene ID: 540161) and Eif4enif1 (Gene ID: 514108) (located on chromosome 17, in the interval of 72950140 to 72950159). The sequence of this sgRNA is designed as shown in SEQ ID NO.1. The donor ssDNA containing the myoblast proliferation-promoting gene has the homologous arm length set to 300 bp upstream and downstream of the sgRNA cleavage site, while the homologous arm length of the plasmid donor is optimized to 1000 bp upstream and downstream of the sgRNA cleavage site according to experimental requirements. Designing a longer homologous arm sequence effectively improves the efficiency and stability of the long fragment donor gene knock-in.

[0009] Specifically, the primary bovine cell is obtained by specifically cleaving the Cas9 protein at the bovine genomic safe site H11 under the guidance of a precisely designed sgRNA, and then using a donor DNA template containing homologous arms and the myoblast proliferation-promoting gene sequence to achieve stable knock-in of the target gene through the homologous recombination mechanism. The sgRNA targets the intersection region where the Drg1 and Eif4enif1 genes on bovine chromosome 17 are transcribed in opposite directions, and its sequence is as shown in SEQ ID NO.1. The donor DNA template contains 300 bp (ssDNA) and 1000 bp (plasmid) left and right homologous arms respectively.

[0010] Based on the above principle, the present invention provides a method for preparing a primary bovine cell with the knock-in of the myoblast rapid proliferation gene, and this method includes the following key steps: Step 1: Locate the bovine safe site H11, design an sgRNA targeting H11, and compare it with the sgRNA of Rosa26 to screen the sgRNA with high activity for standby.

[0011] Step 2: Transfect the highly active sgRNA, Cas9 protein, and donor homologous arm plasmid or ssDNA containing the high proliferation rate gene into bovine fetal fibroblasts. Through drug screening or fluorescence screening, perform monoclonal culture, identify positive cells by Sanger sequencing, and detect the mRNA and protein expression efficiency of the target gene, finally obtaining positive fetal fibroblasts with the high proliferation efficiency gene knocked in.

[0012] In the above method, the constructed H11 sgRNA and Rosa 26 sgRNA in Step 1 are transfected into primary bovine fetal fibroblasts together with Cas9 protein respectively. The transfection conditions are 1350 V, 30 ms, and 1 pulse. The sgRNA activity is verified by using PCR amplification followed by T7E1 enzyme digestion and Sanger sequencing. The upstream and downstream primer sequences of H11 for PCR are shown as SEQ ID NO.4 and SEQ ID NO.5 respectively, and the upstream and downstream primers of Rosa26 are shown as SEQ ID NO.6 and SEQ ID NO.7 respectively.

[0013] In Step 2, design for 300 bp before and after the H11 sgRNA respectively, and merge the myoblast proliferation target gene Ufc1 to construct the donor ssDNA. To study the knock-in efficiency of ssDNA and its toxic effect on cells, a comparative experiment is designed with a double-stranded plasmid DNA template with the same sequence as the pcDNA3.1 vector. Using the pcDNA3.1 vector as the backbone, the homologous arms are designed for 1000 bp before and after the H11 sgRNA respectively, and the donor plasmid is constructed by merging the high myoblast proliferation rate target gene Ufl1.

[0014] The electroporation system used to construct positive cells in Step 2 is 20 pmol Cas9 protein, 60 pmol of H11 sgRNA, and 2 μg of the homologous arm plasmid or ssDNA containing the myoblast proliferation gene. The transfection conditions are 1350 V, 30 ms, and 1 pulse.

[0015] The present invention has optimized and improved the transfection method of sgRNA, abandoning the traditional transfection mode that relies on vectors to carry sgRNA and Cas9 gene fragments, and instead adopting the scheme of directly transfecting the pre-designed small fragment sgRNA and purified Cas9 protein. This transfection method has brought remarkable effects: on the one hand, it greatly improves the cleavage efficiency of the safe site and effectively increases the acquisition efficiency of positive monoclonal cells; on the other hand, in the donor plasmid construction link, through the experimental comparison of the two methods of using smaller fragment ssDNA and larger double-stranded pcDNA3.1 vector, it is found that the smaller fragment ssDNA can obtain better cell survival rate during electroporation.

[0016] The present invention designs specific sgRNAs targeting the bovine genomic safe site H11. Through the DNA double-strand cleavage mediated by the Cas9 protein, using the donor templates containing homologous arms and the myoblast proliferation genes Ufc1 and Ufl1 respectively, efficient directional insertion of the target gene is achieved. The advantages are as follows: (1) By optimizing the sgRNA design and establishing a positive clone screening system, the cleavage efficiency of the safe site H11 is increased to over 90%, thereby significantly improving the acquisition rate of positive monoclonal cell lines; (2) The present invention innovatively uses ssDNA as the donor fragment to introduce into bovine fibroblasts. There is no precedent for applying this method to cattle, and the method using the traditional double-stranded plasmid DNA as the template is also used. Compared with the traditional double-stranded plasmid DNA, the cell survival rate of this method after electroporation is twice that of the double-stranded plasmid DNA, and the transfection efficiency is increased by more than 4 times. (3) Regarding the gene editing of UFC1 and UFL1 in cattle, the prior art does not mention it. It is known from research that these two genes promote the proliferation of muscle cells. The cell proliferation efficiency of the Ufc1 gene knock-in cell line is increased by 1.6 times compared with the wild type. The innovative application to cattle provides important technical support for muscle tissue engineering and genetic improvement of the livestock industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 It is the T7 enzyme digestion verification activity diagram of 3 sgRNAs; in the figure, M: DNA marker; WT: wild-type bovine fibroblasts; 1-1: Rosa26 sgRNA-1; 1-2: Rosa26 sgRNA-1; 2-1: Rosa26 sgRNA-2; 2-2: Rosa26 sgRNA-2; H11: H11 sgRNA. The red arrow indicates the DNA fragment after cleavage.

[0018] Figure 2 It is the Sanger sequencing diagram of the cleavage guided by H11 sgRNA; the blue-marked interval in the figure is the region where H11 sgRNA is located.

[0019] Figure 3 It is the cell survival rate and transfection efficiency after transfection with ssDNA and plasmid; in the figure, A is the trypan blue staining and counting of cells 24 h after electroporation, and the red arrow indicates the cells that turn blue after staining, that is, dead cells; B is the bright-field pictures of cells at 24 h and 48 h after electroporation and the corresponding CCK8 cell proliferation curves; C is the immunofluorescence staining of positive cells at 48 h after transfection, and the green represents the UFC1 protein.

[0020] Figure 4PCR identification diagram of positive bovine fibroblasts with Ufc1 knock-in; in the figure, Marker: DNA marker; sgRNA-Ufc1: stable knock-in of Ufc1 gene; Ufc1: negative control; WT: wild-type bovine fibroblasts. The amplified fragment after stable knock-in of Ufc1 gene should be 1575 bp.

[0021] Figure 5 qPCR quantitative detection diagram of cells with stable knock-in of Ufc1 gene in an embodiment of the present invention.

[0022] Figure 6 Western Blot and quantitative analysis diagram of cells with stable knock-in of Ufc1 gene in an embodiment of the present invention.

[0023] Figure 7 Immunofluorescence diagram of cells with stable knock-in of Ufc1 gene in an embodiment of the present invention; in the figure, transfected for 2 days: immunofluorescence diagram 2 days after transfection of bovine fibroblasts with sgRNA, Cas9 protein and donor ssDNA; Ufc1-KI: immunofluorescence diagram of cells after stable knock-in of Ufc1 gene and screening.

[0024] Figure 8 Diagram of mRNA and protein expression changes of Ufc1 gene during growth Figure 8 In which A is the mRNA and protein expression levels of Ufc1 gene in the thigh muscles of calves and adult cows, B is the mRNA and protein expression levels of Ufc1 gene during the proliferation of bovine fibroblasts, C is the mRNA and protein expression levels of Ufc1 gene in the thigh muscles of 3-month-old and 5-month-old mice, D is the mRNA and protein expression levels of Ufc1 gene during the proliferation of mouse myoblast C2C12, and E is the mRNA and protein expression levels of fast muscle and Ufc1 gene during the differentiation of C2C12 cells.

[0025] Figure 9 Crystal violet staining diagram and growth curve diagram of mouse C2C12 cells with stable overexpression of Ufc1 gene in an embodiment of the present invention.

[0026] Figure 10 PCR identification diagram of Ufl1 knock-in bovine fibroblasts in another embodiment of the present invention; in the figure, Marker: DNA marker; WT: wild-type bovine fibroblasts; Ufl1-KI: stable knock-in of Ufl1 gene. The amplified fragment after stable knock-in of Ufl1 gene should be 2029 bp.

[0027] Figure 11 qPCR quantitative detection diagram of cells with stable knock-in of Ufl1 gene in another embodiment of the present invention.

[0028] Figure 12 Western blot and quantitative analysis of cells with stably knocked-in Ufl1 gene in another embodiment of the present invention.

[0029] Figure 13 Immunofluorescence of cells with stably knocked-in Ufl1 gene in another embodiment of the present invention; in the figure, WT: wild-type bovine fibroblasts; Ufl1-KI: immunofluorescence of cells after stable knocking-in of Ufl1 gene and screening.

[0030] Figure 14 Graph of protein expression changes of Ufl1 gene during growth. In the figure, A in 14 shows the protein expression levels of Ufl1 gene in the thigh muscles of calves and adult cows, B shows the protein expression levels of Ufl1 gene in the thigh muscles of 2-month-old and 3-month-old mice, and C shows the protein expression levels of Ufl1 gene during the proliferation of mouse myoblast C2C12.

[0031] Figure 15 Crystal violet staining of mouse C2C12 cells with stably knocked-down Ufl1 gene in another embodiment of the present invention.

[0032] Figure 16 EdU staining of mouse C2C12 cells with stably knocked-down Ufl1 gene in another embodiment of the present invention.

[0033] Biological material preservation information: Bovine primary cells, cell classification name: Bovine fetal fibroblasts Bff-uf11KI Bos taurus, preserved in China, Wuhan, China Center for Type Culture Collection (CCTCC), Wuhan University on December 24, 2024, preservation number: CCTCC NO: C202520. Detailed implementation methods

[0034] All reagents used in the following examples are commercially available. Unless otherwise specified, the usage methods are existing methods and will not be elaborated.

[0035] Example 1 During the growth of beef cattle, the mRNA expression level and protein level of Ufc1 gene in the hind leg muscles increased significantly (as shown in A in Figure 8 . When bovine fibroblasts proliferated, the transcriptional level and protein content of Ufc1 gene also increased (as shown in B in Figure 8 . Similarly, the same results were observed when the hind leg muscles of mice grew and when mouse myoblast C2C12 cells proliferated and differentiated (as shown in Figure 8as shown in C-E in [reference], indicating that UFC1 protein is essential and needs to be elevated during muscle growth and development. Overexpression of the Ufc1 gene in mouse myoblast C2C12 cells showed that, within the same growth time, the crystal violet staining of the KI group was deeper than that of the control CON group, and the cell growth curve increased faster. Based on the premise that overexpression of the Ufc1 gene increased the cell proliferation efficiency by 1.863 times (as shown in Figure 9 ), the present invention constructs bovine fetal fibroblasts stably knocked in with genes promoting myocyte proliferation by CRISPR / Cas9 technology. The specific operations are as follows: 1. Method for searching for the bovine H11 safe site sequence: First, in the NCBI database, it was found that the chromosomes where the bovine (Bos taurus) Drg1 and Eif4enif1 genes (Gene IDs are 540161 and 514108 respectively) are located are chromosome 17 of cattle. Then, in the UCSC database Apr.2018 Chromosome:ARS-UCD1.2 / chr17: 70184879-70189263, the chromosome 17 sequence of cattle was searched to determine the sequence between the Drg1 and Eif4enif1 genes.

[0036] 2. Method for searching for the bovine Rosa26 safe site sequence: Search for the mouse Rosa26 safe site sequence Gene ID: 14910 in the NCBI database, and then perform Blast alignment to find that bovine Rosa26 is on chromosome 22 of cattle. Select the sequence between the first exon and the second exon to design the targeting site, and its location in the UCSC database is Apr. 2018 Chromosome:ARS-UCD1.2 / chr22: 17209927-17211438.

[0037] 3. Design and synthesis of sgRNA: Enter the gene sequence on the CHOPCHOP website, with the species being bosTau9, to obtain multiple potential target sequences. Select appropriate sequences with higher scores, namely H11: TTAGCCATAAGACTACCTAT (SEQ ID NO.1), Rosa26 sgRNA-1: TGTCGAGTCTCGATTATGGG (SEQ ID NO.2), Rosa26 sgRNA-2: ATGAAGTCCAGGCAACACCT (SEQ ID NO.3). The three sgRNAs were synthesized by Nanjing Genscript Biotech Corporation.

[0038] 4. sgRNA Activity Verification: The synthesized sgRNA (60 pmol) was transfected into primary bovine fetal fibroblasts together with purified Cas9 protein (20 pmol). Genomic DNA was extracted after 72 h for PCR amplification. The PCR primers for H11 were F2: ccagagtcttgagggaagttc (SEQ ID NO.4) and R2: ggtgtggtctgcgttatgat (SEQ ID NO.5). The PCR primers for Rosa26 were F1: TCCCAAATGAGCGAAACCAC (SEQ ID NO.6) and R1: GGAACTCAAGAGAGCATGCC (SEQ ID NO.7). Part of the PCR products were subjected to T7E1 digestion at 37°C, and the sizes of the cleaved bands were detected by agarose gel electrophoresis. The PCR products that matched the theoretical size were subjected to Sanger sequencing. As Figure 1 and Figure 2 shown, according to the agarose gel electrophoresis pattern and sequencing results, the sgRNA with the highest activity was selected for the subsequent KI experiment. The cleavage efficiency TIDE of the sequencing peak map was quantitatively analyzed. The activity of the H11 sgRNA reached 96.4%, which was suitable as the material for the knock-in experiment.

[0039] 5. Design and Synthesis of Donor ssDNA: For the design and synthesis of donor ssDNA, 300 bp before and after the H11 sgRNA were selected as the front and back homologous arms. The mammalian universal CMV promoter was inserted between the two arms, and the coding sequence (CDS region) of the target gene Ufc1 was ligated, followed by the puromycin resistance gene. The 2A self-cleaving peptides (P2A) were used to co-express the target gene and the resistance gene. This ssDNA was synthesized by Nanjing Genscript Biotech Corporation. To improve the transfection efficiency, the CTS sequence targeted by Cas9 at the H11 cleavage site was also synthesized to promote the binding of the donor template to the CRISPR-Cas9 complex. Some studies have shown that the knock-in efficiency of ssCTS can be increased by up to 5 times and the number of live cells can be increased by up to 7 times.

[0040] To compare the electroporation success rates of the two donor templates of ssDNA and circular plasmid, a fragment with the same sequence as ssDNA was designed and inserted into the pcDNA3.1 vector, that is, 300 bp left homologous arm - CMV promoter - Ufc1 (CDS region) - P2A - puromycin - 300 bp right homologous arm, and a comparative experiment was carried out under the same transfection conditions. The same number of cells were electroporated, and after 24 h, trypan blue staining and a hemocytometer were used to observe the proportion of live cells of the two donor templates of ssDNA and plasmid, as Figure 3As shown in A of [reference], the proportion of living cells in the ssDNA group is close to that in the template-free group (WT), and the survival rate is twice that of the plasmid group. Figure 3 As shown in B of [reference], the cell status at 24 h and 48 h after transfection and the CCK8 cell viability assay also reflect the low toxicity of ssDNA during electroporation. For transfection with the same fragment, the cell survival rate is twice that of double-stranded plasmids. To observe the transfection efficiency of the two donor templates, immunofluorescence staining was performed on the cells 48 h after transfection, and it was found that the proportion of green positive cells in the ssDNA group was more than 4 times that of the plasmid group. In summary, compared with traditional double-stranded plasmid DNA, electroporation using ssDNA as a template greatly improves the electroporation efficiency, reduces cell toxicity, and increases cell survival rate. Single-stranded ssDNA does not require a complex structure, only a single-stranded DNA fragment as a template. Fewer base numbers result in a significant increase in the fragments entering the cells, reducing the cytotoxic effect on cells, and at the same time, the target region can be designed and modified more flexibly.

[0041] 6. Obtaining positive cells: Prepare the transfection system. Pipette 4 μL of electroporation BufferR (Invitrogen MPK1025), 60 pmol of sgRNA, and 20 pmol of Cas9 protein, incubate at 37 °C for 15 min. After that, mix with 5 μL of resuspension solution containing half of the cell amount in a six-well plate, add 2 μg of the above-mentioned donor ssDNA, and use Neon TM transfection system for transfection at 1350 V, 30 ms, and 1 pulse, and inoculate into a 10 cm cell culture dish. After the cell status recovers, perform primary screening with 2 μg / mL of puromycin and continuous screening with low-concentration drugs. After one week, use a cloning ring to pick out the clustered monoclonal colonies for expansion culture. Perform PCR amplification and Sanger sequencing on the obtained cells. The PCR fragment conforms to the expected size (as Figure 4 shown), indicating that the edited cells have successfully overexpressed the Ufc1 gene. Part of the edited cells were cryopreserved for later use, and part were subjected to Western blot and qPCR detection, showing a 3.6-fold increase at the mRNA level and an 11.7-fold increase at the protein level, with a relatively high overexpression efficiency (as Figure 5 , Figure 6 and Figure 7 shown). There are enough overexpressed proteins, which can be used for downstream experiments such as cloning embryos and transplantation to examine the muscle rate of cattle.

[0042] Example 2 1. Research findings: During the growth process of bovine hindlimb muscles, the expression level of the Ufl1 gene increases (as shown in A of Figure 14 ), and the trend is the same in mouse hindlimb muscles (as shown in B of Figure 14 ). Similarly, during the proliferation of mouse myoblast C2C12 cells, the Ufl1 gene increases significantly (as shown in Figure 14As shown by C in [Figure 0], when the Ufl1 gene was knocked down, within the same growth time, the crystal violet staining of the KD group was lighter than that of the control CON group, the growth curve increased more slowly, and the cell proliferation ability detected by EdU staining (5-ethynyl-2’-deoxyuridine, EdU) also showed the same proliferation trend (as shown in Figure 15 and 16 ), indicating that Ufl1 plays an essential and upregulated role in cell proliferation. Based on the premise that knocking down the Ufl1 gene reduces the cell proliferation efficiency to a certain extent and on the basis of other experiments in this research group, in this example, bovine fetal fibroblasts stably knocked in with a myoblast proliferation gene were constructed by CRISPR / Cas9 technology.

[0043] 2. Design and synthesis of the donor plasmid: Using pcDNA3.1 as the backbone of the donor plasmid, 1000 bp before and after the H11 sgRNA were selected as the front and back homologous arms, and the CMV promoter, the Ufl1 target gene, and the puromycin resistance gene were inserted between the two arms to obtain the donor plasmid: 5’ homologous sequence + CMV + Ufl1 + SV40 promoter + PuroR + 3’ homologous arm. This plasmid was synthesized by Nanjing Zebrafish Company.

[0044] 3. In this example, the Ufl1 gene-knocked-in bovine primary fetal fibroblasts promoting myoblast proliferation were constructed by the same method as in Example 1. The results are as shown in Figure 10 , the positive fragment was consistent with the expected size, indicating that the long fragment Ufl1 gene was successfully knocked into the primary fibroblasts. Subsequently, the detection of the positive cells showed that the mRNA of Ufl1 increased nearly 2-fold ( Figure 11 ), the protein level increased significantly by nearly 3-fold ( Figure 12 ), and the fluorescence of immunofluorescence staining also showed stronger brightness ( Figure 13 ), indicating that the Ufl1 gene was overexpressed in fibroblasts.

[0045] In addition to the above embodiments, the present invention may have other embodiments. All technical solutions formed by equivalent replacement or equivalent transformation fall within the protection scope required by the present invention.

Claims

1. A bovine primary cell with gene knock-in for promoting rapid proliferation of myocytes, characterized in that: the preservation number of the cell line is CCTCC NO: C202520, and the knocked-in genes are Ufc1 and Ufl1 genes. The left and right homologous arms of the two gene knock-in donor fragments are 300 bp and 1000 bp respectively.

2. The bovine primary cell with muscle cell-promoting rapid proliferation gene knock-in according to claim 1, characterized in that: The sgRNA specifically targets the reverse transcription junction region of the Drg1 gene (GeneID: 540161) and the Eif4enif1 gene (GeneID: 514108) on bovine chromosome 17. This junction region is the targeting site H11, and the nucleotide sequence of the sgRNA is as shown in SEQ ID NO.

1.

3. A method for preparing a bovine primary cell with gene knock-in for promoting rapid proliferation of myocytes, comprising the following steps: Step 1: Locate the bovine safe site H11, design sgRNA targeting H11, and compare it with the sgRNA of Rosa26 to screen the sgRNA with high T7 enzyme cleavage band activity for standby. Step 2: Transfect the high-activity sgRNA, Cas9 protein, and the donor plasmid or donor ssDNA containing the gene for promoting myocyte proliferation into bovine fetal fibroblasts. Through drug screening, monoclonal culture, Sanger sequencing to identify positive cells, and detecting the mRNA and protein expression efficiency of the target gene, finally obtain positive fetal fibroblasts with high proliferation efficiency gene knock-in.

4. The method for preparing bovine primary cells with muscle cell rapid proliferation gene knock-in according to claim 3, characterized in that: In Step 1, the constructed H11sgRNA and Rosa 26sgRNA are transfected into primary bovine fetal fibroblasts together with Cas9 protein respectively. The transfection conditions are 1350V, 30ms, 1pulse. After PCR amplification, the sgRNA activity is verified by T7E1 enzyme digestion and Sanger sequencing methods. The upstream and downstream primer sequences of H11 for PCR are as shown in SEQ ID NO.4 and SEQ ID NO.5 respectively, and the upstream and downstream primers of Rosa26 are as shown in SEQ ID NO.6 and SEQ ID NO.7 respectively.

5. The preparation method of the bovine primary cell with gene knock-in for promoting rapid proliferation of myocytes according to claim 4, characterized in that: In Step 2, design for 300 bp before and after the H11 sgRNA, and merge the target gene Ufc1 for promoting myocyte proliferation to construct the donor ssDNA. Using the pcDNA3.1 vector as the backbone, design for 1000 bp before and after the H11sgRNA, and merge the target gene Ufl1 with high myocyte proliferation rate to construct the donor plasmid.

6. The preparation method of the bovine primary cell with muscle cell rapid proliferation gene knock-in according to claim 4, characterized in that: The electroporation system used for constructing positive cells in Step 2 is 20 pmol Cas9 protein, 60 pmol of H11sgRNA, and 2 μg of the homologous arm plasmid or ssDNA containing the gene for promoting myocyte proliferation. The transfection conditions are 1350V, 30ms, 1pulse.

Images