Gamma-glutamylformamide synthetase mutant and application thereof in production of L-theanine
By performing specific amino acid mutations on γ-glutarformamide synthetase, the enzyme activity and stability are improved, and the problem of low activity and yield in L-theanine synthesis method is solved. It is suitable for industrial production in the food and health products industry.
Patent Information
- Application Number
- CN202510342177.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-21
- Publication Date
- 2025-07-08
AI Technical Summary
In the prior art, the chemical synthesis method of L-theanine has many by-products, high racemic cost, poor safety, and low synthesis activity and yield of microbial methods, making it difficult to meet the needs of industrial production.
By mutation of the γ-glutarformamide synthase from Paracoccus ammonia-derived ammonia, the amino acids at specific locations are mutated into leucine and lysine, the γ-glutarformamide synthase mutant is constructed and expressed in E. coli, improving enzyme activity and catalytic ability.
The enzyme activity and thermal stability of γ-glutaratemide synthetase were enhanced, the L-theanine synthesis ability in E. coli was enhanced, the enzyme activity was increased by 25.0%, the affinity for substrates was enhanced, the catalytic efficiency was improved, and the stability was improved, which was suitable for industrial production.
Smart Images
Figure CN120272443A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a gamma-glutamylformamide synthetase mutant and application thereof in L-theanine production, belonging to the technical field of enzyme engineering. Background Art
[0002] L-theanine is a natural, non-protein amino acid with stress-relieving, antioxidant, anti-tumor, memory-enhancing, and immune-boosting properties. It is widely used in the food and health supplement industries. Its chemical structure is similar to the active substances L-glutamine and L-glutamic acid, and it is a key component of tea that contributes to its sweetening properties. L-theanine can relieve nervous tension and anxiety, improve and repair autonomic nervous system disorders, and enhance immunity. L-theanine can be prepared by chemical synthesis, extraction, enzymatic synthesis, and fermentation. Chemical synthesis is limited to large-scale production due to the production of byproducts, high racemization costs, poor safety, and consumer resistance. Extraction yields low L-theanine yields, and the isolation and purification process is difficult and expensive, making it unsuitable for industrial production. Microbial synthesis involves extracting enzymes from microorganisms as catalysts to convert specific substrates into products. However, reported microbial methods have shown low activity and yield. Therefore, improving the enzymatic activity of γ-glutamylformamide synthase is crucial for the industrial production of L-theanine. Summary of the Invention
[0003] To address the above technical problems, the present invention provides a γ-glutamylformamide synthetase mutant and its use in L-theanine production. The present invention uses γ-glutamylformamide synthetase from Paracoccus ammoniaphilus as a parent, and mutates to obtain a γ-glutamylformamide synthetase mutant. The γ-glutamylformamide synthetase mutant of the present invention has improved enzymatic activity and catalytic ability. When constructed into Escherichia coli, it has high enzyme conversion efficiency and good industrial prospects.
[0004] The first object of the present invention is to provide a γ-glutamylformamide synthetase mutant, which uses the amino acid sequence shown in SEQ ID NO.3 as a parent, and mutates the 236th alanine to leucine and / or the 314th isoleucine to lysine.
[0005] In one embodiment, the amino acid sequence shown in SEQ ID NO.3 is used as the parent, the alanine at position 236 of the parent is mutated to leucine, and the isoleucine at position 314 is mutated to lysine to obtain a γ-glutamylformamide synthetase mutant as shown in the amino acid sequence of SEQ ID NO.1.
[0006] The second object of the present invention is to provide a gene encoding the γ-glutamylformamide synthetase.
[0007] In one embodiment, the nucleotide sequence of the gene is shown as SEQ ID NO.2.
[0008] The third object of the present invention is to provide a vector containing the gene.
[0009] In one embodiment, the vector includes but is not limited to any vector such as a plasmid, a phage, a cosmid, a virus, a YAC vector, and a shuttle vector.
[0010] In one embodiment, the vector can be plasmid pET28a.
[0011] The fourth object of the present invention is to provide a recombinant cell, which contains the gene or the vector.
[0012] In one embodiment, the recombinant cell of the present invention can be obtained by introducing the gene or the vector into a host.
[0013] In one embodiment, the host can be selected from microorganisms such as bacteria and fungi.
[0014] In one embodiment, the bacteria include but are not limited to Escherichia coli or Bacillus subtilis.
[0015] In one embodiment, the fungus includes but is not limited to Pichia pastoris and Saccharomyces cerevisiae.
[0016] In one embodiment, the E. coli is E. coli BL21 (DE3).
[0017] A fifth object of the present invention is to provide an enzyme preparation comprising the γ-glutamylformamide synthetase mutant or the recombinant cell.
[0018] The present invention also provides a method for preparing L-theanine, which uses the γ-glutamylformamide synthetase mutant or the recombinant cell as a catalyst, and carries out a catalytic reaction in the presence of a coenzyme with glutamate and ethylamine salt as substrates.
[0019] In one embodiment, the coenzyme includes but is not limited to adenosine triphosphate.
[0020] In one embodiment, the concentration of ethylamine is 50-250 mM.
[0021] In one embodiment, the concentration of ethylamine is 150 mM.
[0022] In one embodiment, the molar ratio of sodium glutamate to ethylamine hydrochloride substrates in the reaction system is 1:0.8 to 1:1.8 mM.
[0023] In one embodiment, the molar ratio of sodium glutamate to ethylamine hydrochloride substrates in the reaction system is 1:1.2 mM.
[0024] In one embodiment, the wet weight of the recombinant cells in the reaction system is 20-90 g / L.
[0025] In one embodiment, the wet weight of the recombinant cells in the reaction system is 80 g / L.
[0026] In one embodiment, the reaction temperature is 24-40°C, preferably 32°C.
[0027] In one embodiment, the pH of the reaction is 5.5 to 9.0, preferably pH 7.5.
[0028] The present invention also provides application of the γ-glutamylformamide synthetase or the recombinant cell in the food field.
[0029] In one embodiment, the use comprises using the γ-glutamylformamide synthetase or the recombinant cell for the production of L-theanine or a product containing L-theanine.
[0030] Beneficial effects:
[0031] The present invention obtains a γ-glutamylformamide synthetase mutant by mutating the 236th alanine residue of the γ-glutamylformamide synthetase from Paracoccus ammoniaphilus to leucine and the 314th isoleucine residue to lysine. This not only improves the enzyme activity and thermal stability of the γ-glutamylformamide synthetase, but also enhances the enzyme's ability to synthesize L-theanine in Escherichia coli, making it more suitable for industrial production. Compared with the wild-type enzyme, the mutant has the following improvements:
[0032] (1) The enzyme activity was increased by 25.0%;
[0033] (2) It showed stronger affinity for substrates: the kinetic constant Km value for L-glutamate decreased from 23.31 to 18.36 mM, and the kinetic constant Km value for ethylamine decreased from 64.48 mM to 50.28 mM;
[0034] (3) The catalytic efficiency was significantly improved: the turnover number Kcat / Km for the substrates L-glutamic acid and ethylamine increased from 0.48s to - 1 mM -1 and 0.24S -1 mM -1 Improved to 0.60S -1 mM -1 and 0.30S -1 mM -1 ;
[0035] (4) Improved stability: After incubation at 34°C and pH 7.5 for 24 h, the residual enzyme activity of the wild-type enzyme was 44.1% of the initial level, while the residual enzyme activity of the mutant was 62.2% of the initial level. BRIEF DESCRIPTION OF THE DRAWINGS
[0036] Figure 1 The enzymatic properties of the wild-type enzyme and the double mutant enzyme; (a) the effect of pH on the activity of the double mutant enzyme; (b) the effect of temperature on the activity of the double mutant enzyme; (c) the temperature stability of the wild-type enzyme and the double mutant enzyme; (d) the temperature stability of the wild-type enzyme and the double mutant enzyme.
[0037] Figure 2 This is the SDS-PAGE protein gel image of the double mutant enzyme and ppk enzyme, where M is the protein marker, lane 2 is the wild enzyme, and lane 3 is the double mutant enzyme.
[0038] Figure 3 Liquid phase detection diagram of L-theanine prepared by engineered bacteria. DETAILED DESCRIPTION
[0039] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.
[0040] The culture medium involved in the following examples is as follows:
[0041] LB liquid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L.
[0042] LB solid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 20 g / L.
[0043] TB medium: yeast extract 24 g / L, peptone 12 g / L, glycerol 4 g / L, KH2PO4 2.3 g / L, K2HPO4 16.4 g / L.
[0044] Enzyme activity assay: 1 mL of the reaction system contains 20 mM Tris-HCl buffer (pH 7.0), 150 mM glutamic acid, 150 mM ethylamine hydrochloride, 50 mM MgSO4·7H2O, 100 mM ATP, and 50 μL of enzyme sample. The reaction mixture without enzyme sample was preheated in a 30°C constant temperature water bath for 2 minutes, and then 50 μL of enzyme solution was added to start the reaction. After reacting at 30°C for 30 minutes, 100 μL of stop solution (30 g·L -1The supernatant obtained by centrifugation was used to detect the production of L-theanine by liquid chromatography to characterize the activity of gmas.
[0045] Definition of enzyme activity: The amount of enzyme required to catalyze the production of 1 μmol L-theanine per minute is defined as one enzyme activity unit (U).
[0046] Example 1 Construction and expression of wild γ-glutamylformamide synthetase
[0047] The nucleotide sequence of the wild-type γ-glutamylformamide synthetase gene, Pagmas, is shown in SEQ ID NO. 4. The expression plasmid pET28a was digested with the restriction endonucleases HindIII / EcoRI to obtain a linearized vector. The Pagmas gene and pET28a were ligated to obtain the recombinant plasmid pET28a-Pagmas. The recombinant plasmid was chemically transformed into Escherichia coli BL21(DE3), plated on kanamycin-resistant LB plates, and cultured overnight at 37°C. Randomly selected colonies were identified by colony PCR and sequence verification. The results showed that the recombinant expression vector pET28a-Pagmas, containing the γ-glutamylformamide synthetase gene, was successfully transformed into E. coli BL21(DE3). The successfully transformed recombinant bacteria were named E. coliBL21 / pET28a-Pagmas. The recombinant plasmid was extracted from the sequencing-verified bacterial culture and stored in a -20°C freezer. Sequencing was performed by Suzhou Jinweizhi Co., Ltd.
[0048] The recombinant E. coli BL21 / pET28a-Pagmas was inoculated into 10 mL of LB medium and cultured at 37°C and 200 r / min for 10 h. Then, the culture was transferred to 50 ml of LB medium at a 1% inoculum volume and cultured at 37°C and 200 r / min for 2 h. Isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.5 mM. The cells were induced at 16°C and 200 r / min for 12 h. The bacterial cells were collected by centrifugation and washed with PBS solution. After centrifugation, the supernatant was discarded and the cells were resuspended in 5 mL of PBS buffer and then cell disruption was performed: disruption for 1 s, pause for 3 s, 15 min, and then centrifuged at 4°C and 12000 rpm for 20 min. The supernatant and precipitate were separated. The expression level of γ-glutamylformamide synthase was verified by SDS-PAGE (such as Figure 2 As shown, lane 2 is the wild-type supernatant), the crude enzyme was purified using Ni-NTA affinity chromatography to obtain a pure wild-type γ-glutamylformamide synthetase enzyme solution with a specific enzyme activity of 2.4 U / mg. The purified enzyme was added with 10% glycerol and stored at 4°C until use.
[0049] Example 2 Construction and expression of γ-glutamylformamide synthetase mutants
[0050] Primers P1 / P2 and P3 / P4 were designed to amplify gene sequences with A236L and I314K mutations using pET28a-Pagmas as template. A236L indicates that the 236th alanine is mutated to leucine, and the same is true for I314K, where I and K represent isoleucine and lysine, respectively.
[0051] The recombinant plasmid was constructed in the same manner as in Example 1 and expressed in Escherichia coli BL21 (DE3), thereby obtaining a recombinant plasmid carrying the mutant gene Pagmas shown in SEQ ID NO. 2. A236L / I314K and recombinant strain E. coli BL21 / pET28a-Pagmas A236L / I314K .
[0052] P1:GGCTCGGGCATGCACCTGCATATCTCGGGCTGG;
[0053] P2: CCAGCCCGAGATATGCAGGTGCATGCCCGAGCC;
[0054] P3: TGGTCGGGCGACAACAAGACCCACCTGGTCCGC;
[0055] P4: GCGGACCAGGTGGGTCTTGTTGTCGCCCGACCA.
[0056] Recombinant strain E. coli BL21 / pET28a-Pagmas A236L / I314K The fermentation induction method was the same as in Example 1 to obtain a pure enzyme solution of the γ-glutamylformamide synthetase mutant with a specific enzyme activity of 3.7 U / mg.
[0057] Example 3 Determination of enzymatic properties of wild-type enzymes and mutant enzymes
[0058] (1) Determination of optimal reaction temperature and optimal reaction pH
[0059] The activity of the double mutant A236L / I314K was measured at 22-42℃, and the results showed that the optimal temperature was 32℃.
[0060] The activity of the double mutant A236L / I314K was determined using various buffer systems in the pH range of 4.0 to 9.0, including: acetate buffer (pH 4.0 to 6.0), PB buffer (pH 6.0 to 7.0), Tris-HCl buffer (pH 7.0 to 8.0), and glycine NaOH buffer (pH 8.0 to 10.0). The results showed that the most suitable pH was 7.5.
[0061] (2) Determination of enzyme kinetic parameters
[0062] The reaction kinetic parameters of the wild-type enzyme and the mutant enzyme for the substrates L-glutamate and ethylamine were measured respectively. The results showed that the catalytic efficiency constant of the double mutant for glutamate was 1.27 times that of the wild-type, and the catalytic efficiency constant for ethylamine was 1.28 times that of the wild-type. The Km values of the wild-type for L-glutamate and ethylamine were 23.31mM and 64.48mM, respectively, while the Km values of the double mutant for L-glutamate and ethylamine were 18.36mM and 50.28mM, respectively. For the substrates L-glutamate and ethylamine, the Kcat / Km value of the double mutant for the substrates glutamate and ethylamine was 0.60S. -1 mM -1 and 0.3S -1 mM -1 , relative to the wild type 0.48S -1 mM -1 and 0.24S - 1 mM -1 , there is a certain improvement.
[0063] (3) Stability test
[0064] The wild type and mutants were incubated for 24 h under the same pH 7 condition at 30°C and 32°C, respectively;
[0065] The wild type and mutants were incubated at the same temperature of 30°C for 24 h, with the pH controlled at 7 and 7.5, respectively;
[0066] The residual enzyme activities of the wild type and mutants were measured after incubation for 1, 4, 8, 12, 24, 36, and 48 h under the above conditions, with the incubation time of 0 h being set as 100%.
[0067] like Figure 1 As shown in the results, the relative enzyme activity of the double mutant was higher than that of the wild type at both 30°C and 32°C, and the half-life at both temperatures increased from approximately 21h to 48h, a 2.2-fold increase. The half-life at pH 7 and 7.5 also increased by 20h, an 83% improvement.
[0068] Example 4 E. coli BL21 / pET28a-Pagmas A236L / I314K Production of L-theanine by engineered bacteria
[0069] The strain E. coli BL21 / pET28a-Pagmas constructed in Example 1 and the strain E. coli BL21 / pET28a-Pagmas constructed in Example 2 were respectively A236L / I314KFor the conversion of L-theanine: In a 50 mL system with a 50 mM Tris-HCl buffer solution and a bacterial cell volume of 80 g / L, add 150 mM glutamate, 180 mM ethylamine hydrochloride, 5 mM ATP, and 75 mM sodium hexametaphosphate to the buffer solution. Incubate at 32°C for 24 hours.
[0070] HPLC was used to detect glutamic acid, ethylamine hydrochloride and L-theanine (such as Figure 3 As shown). The reaction solution was boiled in a water bath for 10 minutes, and then centrifuged at 12,000 rpm for 20 minutes at 4°C. The supernatant was diluted 100 times with ultrapure water and filtered through a 0.22μ membrane. It was then derivatized with o-phthalaldehyde and injected. Chromatographic column: Agilent C18 column (250×4.6mm, 5μm, mobile phase: A: 10mmol / L disodium hydrogen phosphate and 10mM sodium borate solution, pH adjusted to 8.2 with hydrochloric acid; B: methanol: acetonitrile: water, 45:45:10 (v:v:v). Detector: UV Detector, detection wavelength: 338nm, column temperature: 40°C, injection volume: 20μL, flow rate: gradient elution.
[0071] The results showed that the strain E. coli BL21 / pET28a-Pagmas A236L / I314K The yield is as high as 26.41 g·L -1 The substrate molar ratio was 73.7%, and the final yield was 1.56 times that of E. coli BL21 / pET28a-Pagmas. These results indicate that the catalytic efficiency of this mutant enzyme, based on E. coli, is significantly improved, suggesting broad prospects for industrial application.
[0072] Comparative Example 1:
[0073] The specific implementation method is the same as Example 2, except that mutants E186Q, I238V, and E327V were also constructed. The results showed that the specific enzyme activities of the mutants were shown in Table 1, which were significantly lower than those of the wild type (2.4 U / mg).
[0074] Table 1 Specific enzyme activities of different mutants
[0075] mutant Specific enzyme activity (u / mg) E186Q 2.2 I238V 1.9 E327V 1.7
[0076] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.
Claims
1. A γ-glutamylformamide synthetase mutant, characterized in that, Using the amino acid sequence shown in SEQ ID NO.3 as the parent, alanine at position 236 was mutated to leucine and / or isoleucine at position 314 was mutated to lysine.
2. A gene encoding the γ-glutamylformamide synthetase according to claim 1.
3. A vector containing the gene according to claim 2.
4. Recombinant microbial cells, characterized in that, Containing the gene according to claim 2, or containing the vector according to claim 3.
5. Recombinant Escherichia coli, characterized in that, Using Escherichia coli BL21(DE3) as the host, expressing the γ-glutamylformamide synthetase mutant according to claim 1.
6. Enzyme preparation, characterized in that, Containing the γ-glutamylformamide synthetase mutant according to claim 1 or the recombinant Escherichia coli according to claim 5.
7. A method for preparing L-theanine, characterized in that, Using the γ-glutamylformamide synthetase mutant according to claim 1 or the recombinant Escherichia coli according to claim 5 as a catalyst, in the presence of a coenzyme, using glutamate and ethylamine salt as substrates for a catalytic reaction.
8. The method according to claim 7, wherein The coenzyme includes but is not limited to adenosine triphosphate.
9. The method according to claim 7 or 8, characterized in that, The molar ratio of sodium glutamate and ethylamine hydrochloride substrates is 1:0.8 to 1:1.8 mM, and the reaction temperature is 24 to 40 °C.
10. Use of the γ-glutamylformamide synthetase according to claim 1, or the recombinant microbial cell according to claim 4, or the enzyme preparation according to claim 6, or any one of the methods according to claims 7 to 9 in the food field.