Pyruvate decarboxylase mutant and application thereof in synthesis of phenylacetylmethanol

By developing efficient pyruvate decarboxylase mutants, the catalytic efficiency and substrate tolerance problems in the biological synthesis of chiral phenylacetylmethanol were solved, and efficient part-cell catalysis was achieved, which was suitable for industrial production.

CN120272465APending Publication Date: 2025-07-08杭州微远生物科技有限公司
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510350167.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-24
Publication Date
2025-07-08

AI Technical Summary

Technical Problem

The existing biological methods of synthesis of chiral phenylacetylmethanol (R-PAC) has problems such as low catalytic efficiency, poor substrate tolerance and product concentration limitation, which is difficult to meet industrial needs.

Method used

Develop pyruvate decarboxylase mutants to form mutants with high catalytic activity through amino acid replacement, deletion or addition, achieving extracellular catalysis and efficient conversion of benzaldehyde to R-PAC in a high concentration substrate environment.

Benefits of technology

It improves the conversion rate of R-PAC, reduces production costs, and achieves efficient part-cell catalysis, which is suitable for industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005325824500000191
    Figure BDA0005325824500000191
  • Figure BDA0005325824500000201
    Figure BDA0005325824500000201
  • Figure HDA0005325824510000011
    Figure HDA0005325824510000011
Patent Text Reader

Abstract

The invention discloses a pyruvate decarboxylase mutant and an application of the pyruvate decarboxylase mutant in synthesis of phenylacetylmethanol. The pyruvate decarboxylase mutant disclosed by the invention can realize catalytic synthesis in an extracellular environment, so that catalysis can be carried out under a non-whole-cell condition. Moreover, normal catalysis can be carried out in a high benzaldehyde substrate environment, and the R-PAC conversion rate is extremely high, so that the problem of tolerance to benzaldehyde and the technical defect of product concentration limitation in the prior art are overcome.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of biosynthesis, and particularly relates to a pyruvate decarboxylase mutant and its application in the synthesis of phenylacetyl carbinol. Background Art

[0002] Ephedrine is a commonly used clinical drug. At present, the methods for preparing ephedrine generally include extraction from natural ephedra plants, or preparation by chemical or biological synthesis methods. However, for these methods, there are more or less difficulties. For example, for natural extraction, ephedra plants generally grow in deserts, making them difficult to pick, and picking ephedra plants is also likely to damage the fragile desert ecosystem. The difficulty in chemically synthesizing ephedrine lies in that ephedrine has two chiral centers at the molecular structure level, which greatly increases the synthesis difficulty of ephedrine and raises the synthesis cost. Currently, in industry, yeast is generally used to catalyze benzaldehyde to synthesize chiral phenylacetyl carbinol (R-phenylacetylcarbinol, R-PAC). And R-PAC is a key chiral intermediate for synthesizing L-ephedrine and D-pseudophedrine, and this intermediate can be further chemically synthesized to obtain the target product ephedrine. However, the main difficulties in preparing R-PAC by this biological method are as follows: (1) Catalysis must be carried out using live cells. However, the intracellular pyruvate content of the currently used cells is limited, which greatly restricts the catalytic efficiency of the biological method for preparing R-PAC. (2) Due to the extremely complex metabolic network in cells, various side reactions will occur, resulting in more by-products, affecting the product concentration, and also requiring a certain cost for purification and impurity removal. (3) The currently used cells themselves have relatively low tolerance to the substrate benzaldehyde. When the concentration of the substrate benzaldehyde is relatively high, this reaction is extremely likely to terminate due to inactivation, thus restricting its large-scale application and also affecting the efficiency. Therefore, due to the above disadvantages of the biological method, the biological method (yeast-catalyzed synthesis) is difficult to meet the industrial requirements.

[0003] In view of this, there is an urgent need to develop a new biological synthesis method to achieve the industrial production requirements of multiple objectives such as (1) being able to carry out normal catalysis in a high benzaldehyde substrate environment; and (2) increasing the accumulation amount of the target product R-PAC. Summary of the Invention

[0004] The present invention aims to solve at least one of the above technical problems existing in the prior art. To this end, the object of the present invention is to provide a pyruvate decarboxylase mutant and its application in the synthesis of phenylacetyl methanol. In the present invention, a variety of pyruvate decarboxylase mutants have been developed, which can achieve catalytic synthesis in the extracellular environment, and thus can be catalyzed under non-whole cell conditions. Moreover, it can also carry out normal catalysis in a relatively high benzaldehyde substrate environment, and has an extremely high R-PAC conversion rate, overcoming the technical defects of the tolerance problem of benzaldehyde and the limitation of product concentration in the prior art.

[0005] In a first aspect of the present invention, there is provided a pyruvate decarboxylase mutant, which comprises:

[0006] A mutant that retains catalytic activity after amino acid substitution, deletion or addition on the basis of the pyruvate decarboxylase having the sequence shown in SEQ ID NO:3.

[0007] In the present invention, the pyruvate decarboxylase with the sequence shown in SEQ ID NO:3 is a wild-type pyruvate decarboxylase, which corresponds to the pyruvate decarboxylase sequence shown in NCBI number: NP_013145.1.

[0008] MSEITLGKYLFERLKQVNVNTVFGLPGDFNLSLLDKIYEVEGMRWAGNANELNAAYAADGYARIKGMSCIITTFGVGELSALNGIAGSYAEHVGVLHVVGVPSISAQAKQLLLHHTLGNGDFTVFHRMSANISETTAMITDIATAPAEIDRCIRTTYVTQRPVYLGLPANLVDLNVPAKLLQTPIDMSLKPNDAESEKEVIDTILALVKDAKNPVILADACCSRHDVKAETKKLIDLTQFPAFVTPMGKGSIDEQHPRYGGVYVGTLSKPEVKEAVESADLILSVGALLSDFNTGSFSYSYKTKNIVEFHSDHMKIRNATFPGVQMKFVLQKLLTTIADAAKGYKPVAVPARTPANAAVPASTPLKQEWMWNQLGNFLQEGDVVIAETGTSAFGINQTTFPNNTYGISQVLWGSIGFTTGATLGAAFAAEEIDPKKRVILFIGDGSLQLTVQEISTMIRWGLKPYLFVLNNDGYTIEKLIHGPKAQYNEIQGWDHLSLLPTFGAKDYETHRVATTGEWDKLTQDKSFNDNSKIRMIEIMLPVFDAPQNLVEQAKLTAATNAKQ(SEQ ID NO:3).

[0009] In some embodiments of the present invention, the conversion rate of the mutant to benzaldehyde is greater than or equal to 50%.

[0010] In some embodiments of the present invention, the conversion rate of the mutant to benzaldehyde is greater than or equal to 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

[0011] In some embodiments of the present invention, the pyruvate decarboxylase mutant includes: a mutant that retains catalytic activity after 1-20 amino acid substitutions, deletions or additions based on the pyruvate decarboxylase having the sequence shown in SEQ ID NO:3.

[0012] In some embodiments of the present invention, the pyruvate decarboxylase mutant includes: a mutant that retains catalytic activity after 13-17 amino acid substitutions, deletions or additions based on the pyruvate decarboxylase having the sequence shown in SEQ ID NO:3.

[0013] In some embodiments of the present invention, the pyruvate decarboxylase mutant includes: a mutant that retains catalytic activity after 13-17 amino acid substitutions based on the pyruvate decarboxylase having the sequence shown in SEQ ID NO:3.

[0014] In some embodiments of the present invention, the pyruvate decarboxylase mutant includes: at least one amino acid substitution occurs at the position of phenylalanine (F) at the 297th position, lysine (K) at the 345th position, tryptophan (W) at the 371st position, threonine (T) at the 266th position, glutamine (Q) at the 397th position, glutamine (Q) at the 379th position, glycine (G) at the 420th position, aspartic acid (D) at the 444th position, aspartic acid (D) at the 280th position, phenylalanine (F) at the 292nd position, asparagine (N) at the 30th position, asparagine (N) at the 305th position, proline (P) at the 354th position, valine (V) at the 262nd position, glutamic acid (E) at the 387th position, isoleucine (I) at the 432nd position, lysine (K) at the 302nd position in the pyruvate decarboxylase having the sequence shown in SEQ ID NO:3.

[0015] In some embodiments of the present invention, the pyruvate decarboxylase mutant includes: 1-17 amino acid substitutions occur at the above substitution positions.

[0016] In some embodiments of the present invention, the pyruvate decarboxylase mutant includes: amino acid substitutions occur at the 1st, 2nd, 3rd, 5th, 7th, 10th, 13th or 17th positions among the above substitution positions.

[0017] In some embodiments of the present invention, the corresponding substitution relationships are as follows: (1) phenylalanine (F) at position 297 of pyruvate decarboxylase is replaced with alanine (A); (2) lysine (K) at position 345 of pyruvate decarboxylase is replaced with arginine (R); (3) tryptophan (W) at position 371 of pyruvate decarboxylase is replaced with methionine (M); (4) threonine (T) at position 266 of pyruvate decarboxylase is replaced with serine (S); (5) glutamine (Q) at position 397 of pyruvate decarboxylase is replaced with cysteine (C); (6) glutamine (Q) at position 379 of pyruvate decarboxylase is replaced with cysteine (C); (7) glycine (G) at position 420 of pyruvate decarboxylase is replaced with valine (V); (8) aspartic acid (D) at position 444 of pyruvate decarboxylase is replaced with tyrosine (Y); (9) aspartic acid (D) at position 280 of pyruvate decarboxylase is replaced with valine (V); (10) phenylalanine (F) at position 292 of pyruvate decarboxylase is replaced with leucine (L); (11) asparagine (N) at position 30 of pyruvate decarboxylase is replaced with leucine (L); (12) asparagine (N) at position 305 of pyruvate decarboxylase is replaced with leucine (L); (13) proline (P) at position 354 of pyruvate decarboxylase is replaced with alanine (A); (14) valine (V) at position 262 of pyruvate decarboxylase is replaced with alanine (A); (15) glutamic acid (E) at position 387 of pyruvate decarboxylase is replaced with serine (S); (16) isoleucine (I) at position 432 of pyruvate decarboxylase is replaced with tryptophan (W); (17) lysine (K) at position 302 of pyruvate decarboxylase is replaced with tryptophan (W).

[0018] In some embodiments of the present invention, the pyruvate decarboxylase mutant comprises: 13 amino acid substitutions based on the sequence shown in SEQ ID NO:3, specifically: (1) the phenylalanine (F) at position 297 of pyruvate decarboxylase is replaced with alanine (A); (2) the lysine (K) at position 345 of pyruvate decarboxylase is replaced with arginine (R); (3) the tryptophan at position 371 of pyruvate decarboxylase is replaced with methionine (M); (4) the threonine (T) at position 266 of pyruvate decarboxylase is replaced with serine (S); (5) the glutamine (Q) at position 397 of pyruvate decarboxylase is replaced with cysteine (C); (6) the glutamine (Q) at position 379 of pyruvate decarboxylase is replaced with cysteine (C); (7) the glycine (G) at position 420 of pyruvate decarboxylase is replaced with valine (V); (8) the aspartic acid (D) at position 444 of pyruvate decarboxylase is replaced with tyrosine (Y); (9) the aspartic acid (D) at position 280 of pyruvate decarboxylase is replaced with valine (V); (10) the phenylalanine (F) at position 292 of pyruvate decarboxylase is replaced with leucine (L); (11) the asparagine (N) at position 30 of pyruvate decarboxylase is replaced with leucine (L); (12) the asparagine (N) at position 305 of pyruvate decarboxylase is replaced with leucine (L); (13) the proline (P) at position 354 of pyruvate decarboxylase is replaced with alanine (A).

[0019] In some embodiments of the present invention, the pyruvate decarboxylase mutant comprises: 17 amino acid substitutions based on the sequence shown in SEQ ID NO:3, and the pyruvate decarboxylase mutant is as shown in SEQ ID NO:2.

[0020] In some embodiments of the present invention, the pyruvate decarboxylase mutant is further modified, and the modifications include but are not limited to: glycosylation, phosphorylation, acetylation, methylation, ubiquitination or lipidation; or the introduction of non-natural amino acids (such as α-aminoketone or β-aminoketone).

[0021] In the second aspect of the present invention, a biological product is provided, and the biological product comprises:

[0022] (1) a nucleic acid molecule encoding the pyruvate decarboxylase mutant according to any one of claims 1-2;

[0023] (2) an expression vector containing the nucleic acid molecule in (1);

[0024] (3) a transformant containing the nucleic acid molecule in (1);

[0025] (4) a transformant containing the expression vector in (2);

[0026] In some embodiments of the present invention, the expression vector includes viruses, plasmids, and bacteriophages.

[0027] In the present invention, the term "expression vector" refers to a vector or expression system for integrating or inserting a foreign gene of interest.

[0028] In some embodiments of the present invention, the transformant includes bacteria, fungi, and animal and plant cells.

[0029] In the present invention, the term "transformant" refers to a recipient cell that has acquired a new genetic marker after incorporating or introducing a foreign gene.

[0030] In some embodiments of the present invention, the transformant does not involve animal and plant reproductive materials.

[0031] In some embodiments of the present invention, the transformant is Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, and Pichia pastoris.

[0032] In some embodiments of the present invention, the construction of the expression vector and the transformant can be achieved based on any conventional technical means in the art.

[0033] In some embodiments of the present invention, the nucleic acid molecule is also linked to a modifying sequence and / or a functional sequence.

[0034] In some embodiments of the present invention, the modifying sequence and / or the functional sequence includes at least one of a signal peptide, a promoter, an enhancer, a terminator, a recognition site for a tool enzyme, a ribozyme, a self-cleaving intron, an miRNA binding site, or a ribosome binding site (RBS).

[0035] In some embodiments of the present invention, the modifying sequence and / or the functional sequence is a signal peptide.

[0036] In some embodiments of the present invention, the signal peptide is as shown in SEQ ID NO: 1.

[0037] In the third aspect of the present invention, there is provided the use of the pyruvate decarboxylase mutant or the biological product described in the above aspect in an enzyme-catalyzed reaction.

[0038] In some embodiments of the present invention, the enzyme-catalyzed reaction includes a catalytic reduction reaction of a carbonyl group.

[0039] In the fourth aspect of the present invention, there is provided the use of the pyruvate decarboxylase mutant or the biological product described in the above aspect in the preparation of ephedrine and / or pseudoephedrine intermediates, ephedrine, and / or pseudoephedrine.

[0040] In some embodiments of the present invention, the intermediate is a chiral intermediate.

[0041] In some embodiments of the present invention, the intermediate is chiral phenylacetyl methanol.

[0042] A fourth aspect of the present invention provides a method for preparing chiral phenylacetyl methanol, comprising the following steps:

[0043] Using benzaldehyde as a substrate, adding the pyruvate decarboxylase mutant or biological product described in the above aspect, then adding pyruvate and cofactors, and reacting at 10 - 35 °C for 5 - 20 h to obtain chiral phenylacetyl methanol.

[0044] In some embodiments of the present invention, the cofactors include Mg 2+ reagent and thiamine diphosphate.

[0045] In some embodiments of the present invention, the cofactor is Mg 2+ reagent and thiamine diphosphate.

[0046] In some embodiments of the present invention, the Mg 2+ reagent includes but is not limited to magnesium sulfate.

[0047] In some embodiments of the present invention, the method further includes adding a buffer solution, including but not limited to a phosphate buffer solution.

[0048] In some embodiments of the present invention, the temperature is 10 - 25 °C. In some embodiments of the present invention, the temperature is 20 °C.

[0049] In some embodiments of the present invention, the pH is 5 - 7. In some embodiments of the present invention, the pH is 6.5.

[0050] In some embodiments of the present invention, the substrate pyruvate concentration is 1 - 40 mM, the substrate benzaldehyde concentration is 1 - 40 mM, the cofactor ThDP concentration is 0.1 - 1 mM, and the cofactor MgSO4 concentration is 1 - 10 mM.

[0051] In some embodiments of the present invention, the specific component contents used in the method are: 100 mM phosphate buffer, pH 6.5, 10 mM pyruvate, 30 mM benzaldehyde, 5 mM MgSO4, and 0.1 mM ThDP.

[0052] In some embodiments of the present invention, the method further includes immobilizing the pyruvate decarboxylase mutant or biological product described in the above aspect.

[0053] In some embodiments of the present invention, the immobilization includes cell immobilization and enzyme immobilization.

[0054] In some embodiments of the present invention, the immobilization includes one of the following methods:

[0055] (1) Entrapping the pyruvate decarboxylase mutant or biopreparation described in the above aspect with an entrapment agent;

[0056] (2) Immobilizing the pyruvate decarboxylase mutant or biopreparation described in the above aspect on a carrier based on physical adsorption or chemical bonds; or

[0057] (3) Crosslinking the pyruvate decarboxylase mutant or biopreparation described in the above aspect with a coupling agent.

[0058] In some embodiments of the present invention, the entrapment agent, carrier or coupling agent used are all the entrapment agent, carrier or coupling agent commonly used in conventional cell immobilization and enzyme immobilization methods, and are operated by conventional technical means.

[0059] In some embodiments of the present invention, the entrapment agent used includes sodium alginate and calcium chloride.

[0060] In some embodiments of the present invention, in the method, the content of benzaldehyde is greater than or equal to 1 millimole per liter (mM), or 1 - 60 mM, or 1 - 40 mM.

[0061] In some embodiments of the present invention, in the method, the content of pyruvate is greater than or equal to 1 millimole per liter (mM), or 1 - 60 mM, or 1 - 40 mM.

[0062] In the present invention, the pyruvate decarboxylase mutant can be used in the form of a free enzyme (for example, used in the form of enzyme powder), or in the form of cells expressing the pyruvate decarboxylase mutant (for example, wet bacterial cells). Or other forms, such as the cell lysate supernatant expressing the pyruvate decarboxylase mutant or whole cell immobilization, or the immobilization of free enzyme powder.

[0063] In some embodiments of the present invention, the molecular biology operations involved in the operation steps are all conventional experimental operation methods well-known in the biological field, including gene acquisition (PCR), splicing of plasmid and target gene (i.e., vector construction), introduction of the plasmid containing the target gene fragment into bacterial cells (i.e., transformation), culturing of the bacteria in a medium and enzyme production (i.e., fermentation).

[0064] The fifth aspect of the present invention provides a method for preparing ephedrine and / or pseudoephedrine, including: preparing chiral phenylacetyl methanol using the method described in the above aspect, and then preparing ephedrine and / or pseudoephedrine.

[0065] The beneficial effects of the present invention are:

[0066] 1. The present invention has developed a variety of pyruvate decarboxylase mutants, which can tolerate high concentrations of substrates and product concentrations, so as to achieve the goal of producing high-concentration R-PAC in the whole enzyme-catalyzed process (including but not limited to in vitro enzyme catalysis, immobilization, whole-cell catalysis, etc.).

[0067] 2. The pyruvate decarboxylase mutants in the present invention can be used to efficiently catalyze the substrates of benzaldehyde and pyruvate to generate the target product R-PAC in vitro, so as to carry out catalysis under non-whole-cell conditions and reduce the production cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] Figure 1 It is the plasmid map of pyruvate decarboxylase.

[0069] Figure 2 It is the HPLC detection spectrum of L-PAC. DETAILED DESCRIPTION OF THE INVENTION

[0070] The content of the present invention will be further described in detail through specific examples below. The raw materials, reagents or devices used in the examples and comparative examples can be obtained from conventional commercial channels or can be obtained by existing technical methods without special instructions. Unless otherwise specified, the test or testing methods are all conventional methods in the art.

[0071] Example 1

[0072] In this example, an Escherichia coli recombinant bacterium expressing a pyruvate decarboxylase mutant containing 3 mutation sites was provided for the biosynthesis of phenylacetyl carbinol.

[0073] The specific steps are as follows:

[0074] (1) Preparation of pyruvate decarboxylase plasmid vector:

[0075] Using the commercial plasmid pET28a (purchased from Tsingke), according to the conventional operations in the art, the corresponding target gene fragment (the nucleotide sequence of pyruvate decarboxylase, referring to the wild-type pyruvate decarboxylase nucleotide sequence with NCBI number KJ496413, and its amino acid sequence referring to NCBI number: NP_013145.1) and the signal peptide (so that the expressed enzyme protein can be excreted outside the cell) were inserted into pET28a to obtain the pyruvate decarboxylase plasmid vector (the plasmid map is as Figure 1 shown).

[0076] Among them, the specific sequence information of the signal peptide is: 5’-ATGATTCAAAAACGAAAGCGGACAGTTTCGTT CAGACTTGTGCTTATGTGCACGCTGTTATTTGTCAGTTTGCCGATTACAAAAACATCAGC C-3’ (SEQ ID NO:1).

[0077] The successfully constructed pyruvate decarboxylase plasmid vector was transfected into Escherichia coli BL21(DE3), and spread on an LB plate medium (added with 50 mg / L kanamycin) and cultured at 37 °C for 12 hours. Then, single colonies were picked and transferred into an LB liquid medium (added with 50 mg / L kanamycin), cultured at 37 °C for 12 hours, positive bacteria were harvested, and plasmids were extracted. The plasmids were transformed into competent cells (Escherichia coli), then spread on an LB plate medium (added with 50 mg / L kanamycin), and cultured at 37 °C for 12 hours to obtain wild-type recombinant bacteria.

[0078] Among them, the composition of the LB plate medium is: 10 g / L tryptone, 5 g / L yeast extract, 5 g / L NaCl, 15 g / L agar. The LB liquid medium correspondingly removes agar.

[0079] Using the method of iterative mutation (PCR), with the plasmid obtained from wild-type recombinant bacteria as the vector, directed site-directed mutagenesis was carried out, and the following mutations were carried out in sequence: (1) Phenylalanine (F) at the 297th position of pyruvate decarboxylase was replaced with alanine (A); (2) Lysine (K) at the 345th position of pyruvate decarboxylase was replaced with arginine (R); (3) Tryptophan at the 371st position of pyruvate decarboxylase was replaced with methionine (M). Then, 3 mutant recombinant bacteria were prepared according to the above method.

[0080] The 3 mutant recombinant bacteria were inoculated into 1 L of LB liquid medium (containing kanamycin with a final concentration of 50 mg / L), cultured at 37 °C for 12 hours, then transferred to 1 L of fermentation medium (added with 50 mg / L kanamycin) according to an inoculation amount of 1%, cultured at 37 °C and 220 rpm until the OD value reached 0.8, 0.5 mM IPTG (isopropyl-β-D-thiogalactoside) was added for inducing protein expression, and the culture was continued for 20 hours. Centrifugation was carried out at 12000 rpm for 10 min, and the supernatant was retained as the crude enzyme solution. The crude enzyme solution was sterilized using a 0.22 μm aqueous filter membrane and then stored for later use.

[0081] Among them, the composition of the fermentation medium is: 10 g / L peptone, 15 g / L yeast powder, 2 g / L K2HPO4.

[0082] Construct a phenylacetylcarbinol biosynthesis system: Based on a 1 L reaction system, it includes: based on the final concentration, 100 mL of the crude enzyme solution obtained in the above step, 100 mM phosphate buffer (pH 5), 1 mM pyruvic acid, 1 mM benzaldehyde, 1 mM MgSO4, 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 10 °C and the reaction time is 10 hours.

[0083] After the reaction, add 16% (v / v) perchloric acid to terminate the reaction, centrifuge to obtain the supernatant, which is the R-PAC solution, and perform product verification detection by HPLC and calculate the conversion rate.

[0084] Among them, the HPLC detection conditions for pyruvic acid are: Aminex HPX-87H column, the eluent is 5 mM H2SO4, and the flow rate is 0.6 mL / min.

[0085] The detection conditions for benzaldehyde (substrate) and L-PAC (product) are: C18 column, the eluent is acetonitrile: pure water = 85:15 (v / v), and the flow rate is 1 mL / min.

[0086] Example 2

[0087] In this example, a recombinant Bacillus subtilis expressing a pyruvate decarboxylase mutant containing 5 mutation sites is provided for the biosynthesis of phenylacetylcarbinol.

[0088] The construction steps of the recombinant bacterium are the same as those in Example 1, except that: in this example, the following mutations are performed in sequence: (1) replacing phenylalanine (F) at position 297 of pyruvate decarboxylase with alanine (A); (2) replacing lysine (K) at position 345 of pyruvate decarboxylase with arginine (R); (3) replacing tryptophan at position 371 of pyruvate decarboxylase with methionine (M); (4) replacing threonine (T) at position 266 of pyruvate decarboxylase with serine (S); (5) replacing glutamine (Q) at position 397 of pyruvate decarboxylase with cysteine (C). At the same time, use Bacillus subtilis 168 (purchased from Miaoling Biology) as the vector, and correspondingly, use 20 mg / L chloramphenicol for screening positive clones.

[0089] In this example, the phenylacetylcarbinol biosynthesis system is: based on a 1 L reaction system, it includes: based on the final concentration, 100 mL of the crude enzyme solution obtained in the above step, 100 mM phosphate buffer (pH 5), 1 mM pyruvic acid, 1 mM benzaldehyde, 1 mM MgSO4, 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 10 °C and the reaction time is 10 hours.

[0090] The product was verified by HPLC, and the conversion rate was calculated.

[0091] Example 3

[0092] In this example, a recombinant Saccharomyces cerevisiae strain expressing a pyruvate decarboxylase mutant containing 7 mutation sites was provided for the biosynthesis of phenylacetyl methanol.

[0093] The construction steps of the recombinant strain were the same as those in Example 1, except that: in this example, the commercial plasmid pRS425 (purchased from Miaoling Bio) was used, and the following mutations were carried out in sequence: (1) Phenylalanine (F) at position 297 of pyruvate decarboxylase was replaced with alanine (A); (2) Lysine (K) at position 345 of pyruvate decarboxylase was replaced with arginine (R); (3) Tryptophan at position 371 of pyruvate decarboxylase was replaced with methionine (M); (4) Threonine (T) at position 266 of pyruvate decarboxylase was replaced with serine (S). (5) Glutamine (Q) at position 397 of pyruvate decarboxylase was replaced with cysteine (C); (6) Glutamine (Q) at position 379 of pyruvate decarboxylase was replaced with cysteine (C); (7) Glycine (G) at position 420 of pyruvate decarboxylase was replaced with valine (V). Meanwhile, Saccharomyces cerevisiae (purchased from Miaoling Bio) was used as the vector. Correspondingly, the medium was changed to YPD plate medium, cultured at 30 °C for 48 h, and PCR was used to screen for positive clones.

[0094] Among them, the composition of the YPD plate medium was: 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, 20 g / L agar. When the YPD liquid medium was needed, the agar was removed correspondingly.

[0095] In this example, the phenylacetyl methanol biosynthesis system was: based on a 1 L reaction system, including: at a final concentration, 100 mL of the crude enzyme solution obtained in the above steps, 100 mM phosphate buffer (pH 5), 1 mM pyruvate, 1 mM benzaldehyde, 1 mM MgSO4, 0.1 mM thiamine diphosphate (ThDP). The reaction temperature was 10 °C, and the reaction time was 10 hours.

[0096] The product was verified by HPLC, and the conversion rate was calculated.

[0097] Example 4

[0098] In this example, a recombinant Pichia pastoris strain expressing a pyruvate decarboxylase mutant containing 10 mutation sites was provided for the biosynthesis of phenylacetyl methanol.

[0099] The construction steps of the recombinant strain were the same as those in Example 1, except that: in this example, the commercial plasmid pPIC9K (purchased from Miaoling Biology) was used, and the following mutations were carried out in sequence: (1) Phenylalanine (F) at position 297 of pyruvate decarboxylase was replaced with alanine (A); (2) Lysine (K) at position 345 of pyruvate decarboxylase was replaced with arginine (R); (3) Tryptophan at position 371 of pyruvate decarboxylase was replaced with methionine (M); (4) Threonine (T) at position 266 of pyruvate decarboxylase was replaced with serine (S); (5) Glutamine (Q) at position 397 of pyruvate decarboxylase was replaced with cysteine (C); (6) Glutamine (Q) at position 379 of pyruvate decarboxylase was replaced with cysteine (C); (7) Glycine (G) at position 420 of pyruvate decarboxylase was replaced with valine (V); (8) Aspartic acid (D) at position 444 of pyruvate decarboxylase was replaced with tyrosine (Y); (9) Aspartic acid (D) at position 280 of pyruvate decarboxylase was replaced with valine (V); (10) Phenylalanine (F) at position 292 of pyruvate decarboxylase was replaced with leucine (L). Meanwhile, Pichia pastoris (purchased from Miaoling Biology) was used as the vector. Correspondingly, the medium was changed to MD plate medium, and it was cultured at 28 °C for 30 h. Colony PCR was used for single colony verification, and agarose gel electrophoresis was carried out. The single colonies showing two bands in the gel picture were selected for enzyme production culture. During the culture process, the temperature was strictly controlled at 28 °C (not exceeding 30 °C), the shaker speed was 300 rpm, and the enzyme production culture time was 48 hours. Methanol (added additionally to a final concentration of 10 mL / L) needed to be supplemented once every 24 hours for induction.

[0100] Among them, the composition of the MD plate medium was: 13.4 g / L YNB (yeast nitrogen base, containing ammonium sulfate without amino acids), 4 × 10 -4 g / L biotin, 20 g / L glucose, 15 g / L agar.

[0101] In this example, the phenylacetyl carbinol biosynthesis system was: based on a 1 L reaction system, it included: based on the final concentration, 100 mL of the crude enzyme solution obtained in the above steps, 100 mM phosphate buffer (pH 5), 1 mM pyruvate, 1 mM benzaldehyde, 1 mM MgSO4, 0.1 mM thiamine diphosphate (ThDP). The reaction temperature was 10 °C, and the reaction time was 10 hours.

[0102] HPLC was used for product verification detection and the conversion rate was calculated.

[0103] Example 5

[0104] In this example, an Escherichia coli recombinant bacterium expressing a pyruvate decarboxylase mutant containing 13 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0105] The construction steps of the recombinant bacterium were the same as those in Example 1, except that in this example, the following mutations were carried out in sequence: (1) phenylalanine (F) at position 297 of pyruvate decarboxylase was replaced with alanine (A); (2) lysine (K) at position 345 of pyruvate decarboxylase was replaced with arginine (R); (3) tryptophan at position 371 of pyruvate decarboxylase was replaced with methionine (M); (4) threonine (T) at position 266 of pyruvate decarboxylase was replaced with serine (S); (5) glutamine (Q) at position 397 of pyruvate decarboxylase was replaced with cysteine (C); (6) glutamine (Q) at position 379 of pyruvate decarboxylase was replaced with cysteine (C); (7) glycine (G) at position 420 of pyruvate decarboxylase was replaced with valine (V); (8) aspartic acid (D) at position 444 of pyruvate decarboxylase was replaced with tyrosine (Y); (9) aspartic acid (D) at position 280 of pyruvate decarboxylase was replaced with valine (V); (10) phenylalanine (F) at position 292 of pyruvate decarboxylase was replaced with leucine (L); (11) asparagine (N) at position 30 of pyruvate decarboxylase was replaced with leucine (L); (12) asparagine (N) at position 305 of pyruvate decarboxylase was replaced with leucine (L); (13) proline (P) at position 354 of pyruvate decarboxylase was replaced with alanine (A).

[0106] In this example, the phenylacetylcarbinol biosynthesis system was as follows: based on a 1 L reaction system, it included: based on the final concentration, 100 mL of the crude enzyme solution obtained in the above steps, 100 mM phosphate buffer (pH 5), 1 mM pyruvate, 1 mM benzaldehyde, 1 mM MgSO4, 0.1 mM thiamine diphosphate (ThDP). The reaction temperature was 25 °C and the reaction time was 10 hours.

[0107] HPLC was used for product verification detection and the conversion rate was calculated.

[0108] Example 6

[0109] In this example, an Escherichia coli recombinant bacterium expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0110] The construction steps of the recombinant bacterium were the same as those in Example 1, except that: in this example, the following mutations were carried out in sequence: (1) the phenylalanine (F) at position 297 of pyruvate decarboxylase was replaced with alanine (A); (2) the lysine (K) at position 345 of pyruvate decarboxylase was replaced with arginine (R); (3) the tryptophan (W) at position 371 of pyruvate decarboxylase was replaced with methionine (M); (4) the threonine (T) at position 266 of pyruvate decarboxylase was replaced with serine (S); (5) the glutamine (Q) at position 397 of pyruvate decarboxylase was replaced with cysteine (C); (6) the glutamine (Q) at position 379 of pyruvate decarboxylase was replaced with cysteine (C); (7) the glycine (G) at position 420 of pyruvate decarboxylase was replaced with valine (V); (8) the aspartic acid (D) at position 444 of pyruvate decarboxylase was replaced with tyrosine (Y); (9) the aspartic acid (D) at position 280 of pyruvate decarboxylase was replaced with valine (V); (10) the phenylalanine (F) at position 292 of pyruvate decarboxylase was replaced with leucine (L); (11) the asparagine (N) at position 30 of pyruvate decarboxylase was replaced with leucine (L); (12) the asparagine (N) at position 305 of pyruvate decarboxylase was replaced with leucine (L); (13) the proline (P) at position 354 of pyruvate decarboxylase was replaced with alanine (A); (14) the valine (V) at position 262 of pyruvate decarboxylase was replaced with alanine (A); (15) the glutamic acid (E) at position 387 of pyruvate decarboxylase was replaced with serine (S); (16) the isoleucine (I) at position 432 of pyruvate decarboxylase was replaced with tryptophan (W); (17) the lysine (K) at position 302 of pyruvate decarboxylase was replaced with tryptophan (W).

[0111] Among them, the amino acid sequence of the pyruvate decarboxylase mutant containing 17 mutation sites is specifically:

[0112] MSEITLGKYLFERLKQVNVNTVFGLPGDFLLSLLDKIYEVEGMRWAGNANELNAAYAADGYARIKGMSCIITTFGVGELSALNGIAGSYAEHVGVLHVVGVPSISAQAKQLLLHHTLGNGDFTVFHRMSANISETTAMITDIATAPAEIDRCIRTTYVTQRPVYLGLPANLVDLNVPAKLLQTPIDMSLKPNDAESEKEVIDTILALVKDAKNPVILADACCSRHDVKAETKKLIDLTQFPAFVTPMGKGSIDEQHPRYGGAYVGSLSKPEVKEAVESADLILSVGALLSDLNTGSASYSYWTKLIVEFHSDHMKIRNATFPGVQMKFVLQKLLTTIADAARGYKPVAVPARTAANAAVPASTPLKQEWMMNQLGNFLCEGDVVIASTGTSAFGINQTTFPNNTYGISQVLWGSIGFTTVATLGAAFAAEEWDPKKRVILFIGYGSLQLTVQEISTMIRWGLKPYLFVLNNDGYTIEKLIHGPKAQYNEIQGWDHLSLLPTFGAKDYETHRVATTGEWDKLTQDKSFNDNSKIRMIEIMLPVFDAPQNLVEQAKLTAATNAKQ(SEQ ID NO: 2).

[0113] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes: based on the final concentration, 100 mL of the crude enzyme solution obtained in the above step, 100 mM phosphate buffer (pH 7), 1 mM pyruvic acid, 1 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 25 °C and the reaction time is 10 hours.

[0114] Product verification detection is carried out by HPLC, and the conversion rate is calculated.

[0115] Example 7

[0116] In this example, a recombinant Bacillus subtilis strain expressing a pyruvate decarboxylase mutant containing 17 mutation sites is provided for the biosynthesis of phenylacetylcarbinol.

[0117] The construction steps of the recombinant strain are the same as those in Example 2, with the difference that: in this example, the mutation sites are the same as those in Example 6.

[0118] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes: at a final concentration, 100 mL of the crude enzyme solution obtained in the above steps, 100 mM phosphate buffer (pH 5), 1 mM pyruvate, 1 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 25 °C and the reaction time is 10 hours.

[0119] Product verification testing was carried out using HPLC, and the conversion rate was calculated.

[0120] Example 8

[0121] In this example, a recombinant Bacillus subtilis strain expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0122] The construction steps of the recombinant strain were the same as those in Example 7.

[0123] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes: at a final concentration, 100 mL of the crude enzyme solution obtained in the above steps, 100 mM phosphate buffer (pH 7), 1 mM pyruvate, 1 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 25 °C and the reaction time is 10 hours.

[0124] Product verification testing was carried out using HPLC, and the conversion rate was calculated.

[0125] Example 9

[0126] In this example, a recombinant Saccharomyces cerevisiae strain expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0127] The construction steps of the recombinant strain were the same as those in Example 3, with the difference that: in this example, the mutation sites were the same as those in Example 6.

[0128] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes: at a final concentration, 100 mL of the crude enzyme solution obtained in the above steps, 100 mM phosphate buffer (pH 5), 1 mM pyruvate, 1 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 25 °C and the reaction time is 10 hours.

[0129] Product verification testing was carried out using HPLC, and the conversion rate was calculated.

[0130] Example 10

[0131] In this example, a recombinant Saccharomyces cerevisiae strain expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0132] The construction steps of the recombinant strain were the same as those in Example 9.

[0133] In this example, the phenylacetylcarbinol biosynthesis system was as follows: based on a 1 L reaction system, it included: at a final concentration, 100 mL of the crude enzyme solution obtained in the above steps, 100 mM phosphate buffer (pH 7), 1 mM pyruvate, 1 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature was 25 °C, and the reaction time was 10 hours.

[0134] Product verification detection was carried out by HPLC, and the conversion rate was calculated.

[0135] Example 11

[0136] In this example, a recombinant Pichia pastoris strain expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0137] The construction steps of the recombinant strain were the same as those in Example 4, with the difference that: in this example, the mutation sites were the same as those in Example 6.

[0138] In this example, the phenylacetylcarbinol biosynthesis system was as follows: based on a 1 L reaction system, it included: at a final concentration, 100 mL of the crude enzyme solution obtained in the above steps, 100 mM phosphate buffer (pH 5), 1 mM pyruvate, 1 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature was 25 °C, and the reaction time was 10 hours.

[0139] Product verification detection was carried out by HPLC, and the conversion rate was calculated.

[0140] Example 12

[0141] In this example, a recombinant Pichia pastoris strain expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0142] The construction steps of the recombinant strain were the same as those in Example 11.

[0143] In this example, the phenylacetylcarbinol biosynthesis system was as follows: based on a 1 L reaction system, it included: at a final concentration, 100 mL of the crude enzyme solution obtained in the above steps, 100 mM phosphate buffer (pH 7), 1 mM pyruvate, 1 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature was 25 °C, and the reaction time was 10 hours.

[0144] The product was verified by HPLC, and the conversion rate was calculated.

[0145] Example 13

[0146] In this example, an Escherichia coli recombinant bacterium expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0147] The construction steps of the recombinant bacterium were the same as those in Example 6, except that: in this example, no signal peptide was inserted when constructing the plasmid. At the same time, after the recombinant bacterium was constructed, the recombinant bacterium was immobilized.

[0148] Among them, the specific steps of immobilizing the recombinant bacterium were as follows:

[0149] At 25 °C, 50 mL of the resuspended recombinant bacterium was mixed with 50 mL of sodium alginate solution with a concentration of 20 g / L and stirred for 20 min, then dropped into 1% sterile CaCl2 solution and fixed at room temperature for 1 h under stirring conditions, filtered, washed, dried to obtain spherical immobilized cells, and the immobilized cells were stored in Tris-HCl buffer (pH = 7.1) for standby.

[0150] In this example, the phenylacetylcarbinol biosynthesis system was as follows: based on a 1 L reaction system, it included: based on the final concentration, 100 mg of the immobilized cells obtained in the above steps, 100 mM phosphate buffer (pH 5), 1 mM pyruvate, 1 mM benzaldehyde, 1 mM MgSO4, 0.1 mM thiamine diphosphate (ThDP). The reaction temperature was 10 °C and the reaction time was 10 hours.

[0151] The product was verified by HPLC, and the conversion rate was calculated.

[0152] Example 14

[0153] In this example, an Escherichia coli recombinant bacterium expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0154] The construction steps of the recombinant bacterium were the same as those in Example 13, except that: in this example, no signal peptide was inserted when constructing the plasmid. At the same time, after obtaining the crude enzyme solution, the enzyme was immobilized.

[0155] Among them, the specific steps of enzyme immobilization were as follows:

[0156] At 25 °C, 50 mL of crude enzyme solution was mixed with 50 mL of sodium alginate solution with a concentration of 20 g / L and stirred for 20 min, then dropped into a 1% sterile CaCl2 solution, and immobilized at room temperature for 1 h under stirring conditions, filtered, washed, and dried to obtain spherical immobilized enzyme. The immobilized enzyme was stored in Tris-HCl buffer (pH = 7.1) for later use.

[0157] In this example, the phenylacetylcarbinol biosynthesis system was as follows: based on a 1 L reaction system, it included: at the final concentration, 100 mg of the immobilized enzyme obtained in the above step, 100 mM phosphate buffer (pH 5), 1 mM pyruvate, 1 mM benzaldehyde, 1 mM MgSO4, 0.1 mM thiamine diphosphate (ThDP). The reaction temperature was 10 °C, and the reaction time was 10 hours.

[0158] Product verification detection was carried out by HPLC, and the conversion rate was calculated.

[0159] Example 15

[0160] In this example, a recombinant Bacillus subtilis strain expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0161] The construction steps of the recombinant strain were the same as those in Example 7, except that: in this example, when constructing the plasmid, no signal peptide was inserted. At the same time, after the recombinant strain was constructed, the recombinant strain was immobilized.

[0162] Among them, the steps for immobilizing the recombinant strain were the same as those in Example 13.

[0163] In this example, the phenylacetylcarbinol biosynthesis system was as follows: based on a 1 L reaction system, it included: at the final concentration, 100 mg of the immobilized cells obtained in the above step, 100 mM phosphate buffer (pH 5), 1 mM pyruvate, 1 mM benzaldehyde, 1 mM MgSO4, 0.1 mM thiamine diphosphate (ThDP). The reaction temperature was 10 °C, and the reaction time was 10 hours.

[0164] Product verification detection was carried out by HPLC, and the conversion rate was calculated.

[0165] Example 16

[0166] In this example, a recombinant Bacillus subtilis strain expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0167] The construction steps of the recombinant strain were the same as those in Example 15, except that: in this example, when constructing the plasmid, no signal peptide was inserted. At the same time, after the crude enzyme solution was obtained, enzyme immobilization was carried out.

[0168] Among them, the steps of enzyme immobilization are the same as those in Example 14.

[0169] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes: at a final concentration, 100 mg of the immobilized enzyme obtained in the above steps, 100 mM phosphate buffer (pH 5), 1 mM pyruvic acid, 1 mM benzaldehyde, 1 mM MgSO4, 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 10 °C and the reaction time is 10 hours.

[0170] Product verification detection is carried out by HPLC, and the conversion rate is calculated.

[0171] Example 17

[0172] In this example, a recombinant Saccharomyces cerevisiae strain expressing a pyruvate decarboxylase mutant containing 17 mutation sites is provided for the biosynthesis of phenylacetylcarbinol.

[0173] The construction steps of the recombinant strain are the same as those in Example 9, with the difference that: in this example, when constructing the plasmid, no signal peptide is inserted. At the same time, after the recombinant strain is constructed, the recombinant strain is immobilized.

[0174] Among them, the steps of recombinant strain immobilization are the same as those in Example 13.

[0175] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes: at a final concentration, 100 mg of the immobilized cells obtained in the above steps, 100 mM phosphate buffer (pH 5), 1 mM pyruvic acid, 1 mM benzaldehyde, 1 mM MgSO4, 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 10 °C and the reaction time is 10 hours.

[0176] Product verification detection is carried out by HPLC, and the conversion rate is calculated.

[0177] Example 18

[0178] In this example, a recombinant Saccharomyces cerevisiae strain expressing a pyruvate decarboxylase mutant containing 17 mutation sites is provided for the biosynthesis of phenylacetylcarbinol.

[0179] The construction steps of the recombinant strain are the same as those in Example 17, with the difference that: in this example, when constructing the plasmid, no signal peptide is inserted. At the same time, after obtaining the crude enzyme solution, enzyme immobilization is carried out.

[0180] Among them, the steps of enzyme immobilization are the same as those in Example 14.

[0181] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1L reaction system, it includes: at a final concentration, 100 mg of the immobilized enzyme obtained in the above step, 100 mM phosphate buffer (pH 5), 1 mM pyruvic acid, 1 mM benzaldehyde, 1 mM MgSO4, 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 10 °C and the reaction time is 10 hours.

[0182] Product verification testing was carried out using HPLC, and the conversion rate was calculated.

[0183] Example 19

[0184] In this example, a Pichia pastoris recombinant bacterium expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0185] The construction steps of the recombinant bacterium were the same as those in Example 11, with the difference that: in this example, when constructing the plasmid, no signal peptide was inserted. At the same time, after the recombinant bacterium was constructed, the recombinant bacterium was immobilized.

[0186] Among them, the steps for immobilizing the recombinant bacterium were the same as those in Example 13.

[0187] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1L reaction system, it includes: at a final concentration, 100 mg of the immobilized cells obtained in the above step, 100 mM phosphate buffer (pH 5), 1 mM pyruvic acid, 1 mM benzaldehyde, 1 mM MgSO4, 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 10 °C and the reaction time is 10 hours.

[0188] Product verification testing was carried out using HPLC, and the conversion rate was calculated.

[0189] Example 20

[0190] In this example, a Pichia pastoris recombinant bacterium expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0191] The construction steps of the recombinant bacterium were the same as those in Example 20, with the difference that: in this example, when constructing the plasmid, no signal peptide was inserted. At the same time, after the crude enzyme solution was obtained, enzyme immobilization was carried out.

[0192] Among them, the steps for enzyme immobilization were the same as those in Example 14.

[0193] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes: at a final concentration, 100 mg of the immobilized enzyme obtained in the above step, 100 mM phosphate buffer (pH 5), 1 mM pyruvic acid, 1 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 10 °C and the reaction time is 10 hours.

[0194] Product verification testing was carried out using HPLC, and the conversion rate was calculated.

[0195] Example 21

[0196] In this example, a recombinant Saccharomyces cerevisiae expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0197] The construction steps of the recombinant bacterium were the same as those in Example 17, with the difference that: in this example, when constructing the plasmid, no signal peptide was inserted. At the same time, after obtaining the crude enzyme solution, enzyme immobilization was carried out.

[0198] Among them, the steps of enzyme immobilization were the same as those in Example 14.

[0199] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes: at a final concentration, 100 mg of the immobilized enzyme obtained in the above step, 100 mM phosphate buffer (pH 5), 20 mM pyruvic acid, 20 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 10 °C and the reaction time is 10 hours.

[0200] Product verification testing was carried out using HPLC, and the conversion rate was calculated.

[0201] Example 22

[0202] In this example, a recombinant Saccharomyces cerevisiae expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0203] The construction steps of the recombinant bacterium were the same as those in Example 9, with the difference that: in this example, when constructing the plasmid, no signal peptide was inserted. At the same time, after the recombinant bacterium was constructed, recombinant bacterium immobilization was carried out.

[0204] Among them, the steps of recombinant bacterium immobilization were the same as those in Example 13.

[0205] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes: at a final concentration, 100 mg of the immobilized cells obtained in the above steps, 100 mM phosphate buffer (pH 5), 20 mM pyruvic acid, 20 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 10 °C and the reaction time is 10 hours.

[0206] Product verification testing was carried out using HPLC, and the conversion rate was calculated.

[0207] Example 23

[0208] In this example, a recombinant Bacillus subtilis strain expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0209] The construction steps of the recombinant strain were the same as those in Example 15, except that: in this example, when constructing the plasmid, no signal peptide was inserted. At the same time, after obtaining the crude enzyme solution, enzyme immobilization was carried out.

[0210] Among them, the steps of enzyme immobilization were the same as those in Example 14.

[0211] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes: at a final concentration, 100 mg of the immobilized enzyme obtained in the above steps, 100 mM phosphate buffer (pH 5), 20 mM pyruvic acid, 40 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 10 °C and the reaction time is 10 hours.

[0212] Product verification testing was carried out using HPLC, and the conversion rate was calculated.

[0213] Example 24

[0214] In this example, a recombinant Bacillus subtilis strain expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0215] The construction steps of the recombinant strain were the same as those in Example 7, except that: in this example, when constructing the plasmid, no signal peptide was inserted. At the same time, after the recombinant strain was constructed, recombinant strain immobilization was carried out.

[0216] Among them, the steps of recombinant strain immobilization were the same as those in Example 13.

[0217] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1L reaction system, it includes: at a final concentration, 100 mg of the immobilized cells obtained in the above steps, 100 mM phosphate buffer (pH 5), 40 mM pyruvate, 40 mM benzaldehyde, 1 mM MgSO4, 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 10 °C and the reaction time is 10 hours.

[0218] Product verification testing was carried out using HPLC, and the conversion rate was calculated.

[0219] Example 25

[0220] In this example, an Escherichia coli recombinant bacterium expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0221] The construction steps of the recombinant bacterium were the same as those in Example 13, except that: in this example, when constructing the plasmid, no signal peptide was inserted. At the same time, after obtaining the crude enzyme solution, enzyme immobilization was carried out.

[0222] Among them, the steps of enzyme immobilization were the same as those in Example 14.

[0223] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1L reaction system, it includes: at a final concentration, 100 mg of the immobilized enzyme obtained in the above steps, 100 mM phosphate buffer (pH 5), 40 mM pyruvate, 40 mM benzaldehyde, 1 mM MgSO4, 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 10 °C and the reaction time is 10 hours.

[0224] Product verification testing was carried out using HPLC, and the conversion rate was calculated.

[0225] Example 26

[0226] In this example, an Escherichia coli recombinant bacterium expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0227] The construction steps of the recombinant bacterium were the same as those in Example 6, except that: in this example, when constructing the plasmid, no signal peptide was inserted. At the same time, after the construction of the recombinant bacterium was completed, the recombinant bacterium was immobilized.

[0228] Among them, the steps of immobilizing the recombinant bacterium were the same as those in Example 15.

[0229] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes: at a final concentration, 100 mg of the immobilized cells obtained in the above step, 100 mM phosphate buffer (pH 5), 40 mM pyruvate, 40 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 10 °C and the reaction time is 10 hours.

[0230] Product verification detection was carried out by HPLC, and the conversion rate was calculated.

[0231] Example 27

[0232] In this example, an Escherichia coli recombinant bacterium expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0233] The construction steps of the recombinant bacterium were the same as those in Example 6.

[0234] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes: at a final concentration, 100 mL of the crude enzyme solution obtained in the above step, 100 mM phosphate buffer (pH 7), 15 mM pyruvate, 15 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 25 °C and the reaction time is 10 hours.

[0235] Product verification detection was carried out by HPLC, and the conversion rate was calculated.

[0236] Comparative Example 1

[0237] In this comparative example, an Escherichia coli recombinant bacterium expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0238] The construction steps of the recombinant bacterium were the same as those in Example 6.

[0239] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes: at a final concentration, 100 mL of the crude enzyme solution obtained in the above step, 100 mM phosphate buffer (pH 7), 1 mM pyruvate, 1 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 35 °C and the reaction time is 10 hours.

[0240] Product verification detection was carried out by HPLC, and the conversion rate was calculated.

[0241] Comparative Example 2

[0242] In this comparative example, a recombinant Escherichia coli strain expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0243] The construction steps of the recombinant strain were the same as those in Example 6.

[0244] In this example, the phenylacetylcarbinol biosynthesis system was as follows: based on a 1 L reaction system, it included: at a final concentration, 100 mL of the crude enzyme solution obtained in the above steps, 100 mM phosphate buffer (pH 8), 1 mM pyruvate, 1 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature was 20 °C, and the reaction time was 10 hours.

[0245] Product verification detection was performed by HPLC, and the conversion rate was calculated.

[0246] Comparative Example 3

[0247] In this comparative example, a recombinant Escherichia coli strain expressing a pyruvate decarboxylase mutant containing 17 mutation sites was provided for the biosynthesis of phenylacetylcarbinol.

[0248] The construction steps of the recombinant strain were the same as those in Example 6.

[0249] In this example, the phenylacetylcarbinol biosynthesis system was as follows: based on a 1 L reaction system, it included: at a final concentration, 100 mL of the crude enzyme solution obtained in the above steps, 100 mM phosphate buffer (pH 8), 60 mM pyruvate, 60 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature was 20 °C, and the reaction time was 10 hours.

[0250] Product verification detection was performed by HPLC, and the conversion rate was calculated.

[0251] Comparative Example 4

[0252] In this comparative example, a recombinant Saccharomyces cerevisiae strain expressing wild-type pyruvate decarboxylase was provided for the biosynthesis of phenylacetylcarbinol.

[0253] The construction steps of the recombinant strain were the same as those in Example 1, with the following differences: in this example, the commercial plasmid pRS425 (purchased from Miaoling Biology...) was used without performing site-directed mutagenesis. At the same time, Saccharomyces cerevisiae (purchased from Miaoling Biology) was used as the vector. Correspondingly, the medium was changed to YPD plate medium, cultured at 30 °C for 48 h, and PCR positive clone screening was used.

[0254] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes, at the final concentration, 100 mL of the crude enzyme solution obtained in the above step, 100 mM phosphate buffer (pH 5), 60 mM pyruvic acid, 60 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 10 °C and the reaction time is 10 hours.

[0255] Product verification testing was carried out using HPLC, and the conversion rate was calculated.

[0256] Comparative Example 5

[0257] In this comparative example, a recombinant Saccharomyces cerevisiae expressing wild-type pyruvate decarboxylase was provided for the biosynthesis of phenylacetylcarbinol.

[0258] The steps for constructing the recombinant bacterium were the same as in Comparative Example 4, except that: in this comparative example, when constructing the plasmid, no signal peptide was inserted. At the same time, after the recombinant bacterium was constructed, the recombinant bacterium was immobilized.

[0259] Among them, the steps for immobilizing the recombinant bacterium were the same as in Example 13.

[0260] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes, at the final concentration, 100 mg of the immobilized cells obtained in the above step, 100 mM phosphate buffer (pH 5), 1 mM pyruvic acid, 1 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 10 °C and the reaction time is 10 hours.

[0261] Product verification testing was carried out using HPLC, and the conversion rate was calculated.

[0262] Comparative Example 6

[0263] In this comparative example, a recombinant Escherichia coli expressing wild-type pyruvate decarboxylase was provided for the biosynthesis of phenylacetylcarbinol.

[0264] The steps for constructing the recombinant bacterium were the same as in Example 1.

[0265] In this example, the phenylacetylcarbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes, at the final concentration, 100 mL of the crude enzyme solution obtained in the above step, 100 mM phosphate buffer (pH 8), 60 mM pyruvic acid, 60 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 20 °C and the reaction time is 10 hours.

[0266] Product verification testing was carried out using HPLC, and the conversion rate was calculated.

[0267] Comparative Example 7

[0268] In this comparative example, an Escherichia coli recombinant bacterium expressing wild-type pyruvate decarboxylase was provided for the biosynthesis of phenylacetylcarbinol.

[0269] The construction steps of the recombinant bacterium were the same as those in Comparative Example 6, except that: after obtaining the crude enzyme solution, enzyme immobilization was carried out.

[0270] Among them, the steps of enzyme immobilization were the same as those in Example 14.

[0271] In this example, the phenylacetylcarbinol biosynthesis system was: based on a 1 L reaction system, it included: at a final concentration, 100 mg of the immobilized enzyme obtained in the above steps, 100 mM phosphate buffer (pH 5), 1 mM pyruvate, 1 mM benzaldehyde, 1 mM MgSO4, 0.1 mM thiamine diphosphate (ThDP). The reaction temperature was 10 °C and the reaction time was 10 hours.

[0272] HPLC was used for product verification detection and the conversion rate was calculated.

[0273] Comparative Example 8

[0274] In this comparative example, a Bacillus subtilis recombinant bacterium expressing wild-type pyruvate decarboxylase was provided for the biosynthesis of phenylacetylcarbinol.

[0275] The construction steps of the recombinant bacterium were the same as those in Example 1, except that: in this example, directed mutagenesis was not carried out. At the same time, Bacillus subtilis 168 (purchased from Miaoling Biology) was used as a vector, and correspondingly, 20 mg / L chloramphenicol was used for screening positive clones.

[0276] In this example, the phenylacetylcarbinol biosynthesis system was: based on a 1 L reaction system, it included: at a final concentration, 100 mL of the crude enzyme solution obtained in the above steps, 100 mM phosphate buffer (pH 7), 1 mM pyruvate, 1 mM benzaldehyde, 1 mM MgSO4, 0.1 mM thiamine diphosphate (ThDP). The reaction temperature was 25 °C and the reaction time was 10 hours.

[0277] HPLC was used for product verification detection and the conversion rate was calculated.

[0278] Comparative Example 9

[0279] In this comparative example, a Bacillus subtilis recombinant bacterium expressing wild-type pyruvate decarboxylase was provided for the biosynthesis of phenylacetylcarbinol.

[0280] The construction steps of the recombinant bacterium are the same as those in Comparative Example 8, except that: in this Example, after obtaining the crude enzyme solution, enzyme immobilization is carried out.

[0281] In this Example, the phenylacetyl methanol biosynthesis system is as follows: based on a 1 L reaction system, it includes: at a final concentration, 100 mg of the immobilized enzyme obtained in the above steps, 100 mM phosphate buffer (pH 7), 20 mM pyruvic acid, 20 mM benzaldehyde, 10 mM MgSO4, 1 mM thiamine diphosphate (ThDP). The reaction temperature is 25 °C and the reaction time is 10 hours.

[0282] HPLC is used for product verification detection and the conversion rate is calculated.

[0283] Comparative Example 10

[0284] In this Comparative Example, a Pichia pastoris recombinant bacterium expressing wild-type pyruvate decarboxylase is provided for the biosynthesis of phenylacetyl methanol.

[0285] The construction steps of the recombinant bacterium are the same as those in Example 1, except that: in this Example, directed mutagenesis is not carried out. Meanwhile, Pichia pastoris (purchased from Miaoling Biology) is used as the vector. Correspondingly, the medium is changed to MD plate medium and cultured at 28 °C for 30 h. Colony PCR is used for single colony verification, and agarose gel electrophoresis is carried out. Single colonies showing two bands in the gel diagram are selected for enzyme production culture. During the culture process, the temperature is strictly controlled at 28 °C (not exceeding 30 °C), the shaker speed is 300 rpm, and the enzyme production culture time is 48 hours. Methanol needs to be supplemented once every 24 hours (added additionally to a final concentration of 10 mL / L) for induction.

[0286] In this Example, the phenylacetyl methanol biosynthesis system is as follows: based on a 1 L reaction system, it includes: at a final concentration, 100 mL of the crude enzyme solution obtained in the above steps, 100 mM phosphate buffer (pH 7), 20 mM pyruvic acid, 20 mM benzaldehyde, 10 mM MgSO4, 1 mM thiamine diphosphate (ThDP). The reaction temperature is 25 °C and the reaction time is 10 hours.

[0287] HPLC is used for product verification detection and the conversion rate is calculated.

[0288] Comparative Example 11

[0289] In this Comparative Example, a Pichia pastoris recombinant bacterium expressing wild-type pyruvate decarboxylase is provided for the biosynthesis of phenylacetyl methanol.

[0290] The construction steps of the recombinant bacterium are the same as those in Comparative Example 10, except that: in this Example, after obtaining the crude enzyme solution, enzyme immobilization is carried out.

[0291] In this example, the phenylacetyl carbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes: at a final concentration, 100 mg of the immobilized enzyme obtained in the above step, 100 mM phosphate buffer (pH 7), 20 mM pyruvic acid, 20 mM benzaldehyde, 10 mM MgSO4, and 1 mM thiamine diphosphate (ThDP). The reaction temperature is 25 °C and the reaction time is 10 hours.

[0292] Product verification testing was performed using HPLC, and the conversion rate was calculated.

[0293] Comparative Example 12

[0294] In this comparative example, an Escherichia coli recombinant bacterium expressing a pyruvate decarboxylase mutant containing 1 mutation site was provided for the biosynthesis of phenylacetyl carbinol.

[0295] The construction steps of the recombinant bacterium were the same as in Example 1, except that: in this example, the following mutation was performed: the phenylalanine (F) at position 297 of pyruvate decarboxylase was replaced with alanine (A).

[0296] In this example, the phenylacetyl carbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes: at a final concentration, 100 mL of the crude enzyme solution obtained in the above step, 100 mM phosphate buffer (pH 5), 1 mM pyruvic acid, 1 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 10 °C and the reaction time is 10 hours.

[0297] Product verification testing was performed using HPLC, and the conversion rate was calculated.

[0298] Comparative Example 13

[0299] In this comparative example, an Escherichia coli recombinant bacterium expressing a pyruvate decarboxylase mutant containing 2 mutation sites was provided for the biosynthesis of phenylacetyl carbinol.

[0300] The construction steps of the recombinant bacterium were the same as in Example 1, except that: in this example, the following mutations were performed: (1) the phenylalanine (F) at position 297 of pyruvate decarboxylase was replaced with alanine (A); (2) the lysine (K) at position 345 of pyruvate decarboxylase was replaced with arginine (R).

[0301] In this example, the phenylacetyl carbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes: based on the final concentration, 100 mL of the crude enzyme solution obtained in the above steps, 100 mM phosphate buffer (pH 5), 1 mM pyruvic acid, 1 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 10 °C and the reaction time is 10 hours.

[0302] Product verification testing was carried out using HPLC, and the conversion rate was calculated.

[0303] Comparative Example 14

[0304] In this comparative example, a recombinant Bacillus subtilis strain expressing a pyruvate decarboxylase mutant containing 2 mutation sites was provided for the biosynthesis of phenylacetyl carbinol.

[0305] The construction steps of the recombinant strain were the same as in Example 2, with the difference that: in this example, the following mutations were made: (1) the phenylalanine (F) at position 297 of pyruvate decarboxylase was replaced with alanine (A), and (2) the lysine (K) at position 345 of pyruvate decarboxylase was replaced with arginine (R).

[0306] In this example, the phenylacetyl carbinol biosynthesis system is as follows: based on a 1 L reaction system, it includes: based on the final concentration, 100 mL of the crude enzyme solution obtained in the above steps, 100 mM phosphate buffer (pH 5), 1 mM pyruvic acid, 1 mM benzaldehyde, 1 mM MgSO4, and 0.1 mM thiamine diphosphate (ThDP). The reaction temperature is 25 °C and the reaction time is 10 hours.

[0307] Product verification testing was carried out using HPLC, and the conversion rate was calculated.

[0308] The results of each example are shown in Table 1. An exemplary HPLC detection chart is as Figure 2 shown.

[0309] Table 1 Conversion rates of each example and comparative example

[0310]

[0311]

[0312] From the above results, it can be seen that the pyruvate decarboxylase mutant in the examples of the present invention has a better catalytic effect compared to the wild-type pyruvate decarboxylase. Moreover, the conditional factors in the catalytic system also have an impact on the conversion rate, but this impact is much smaller than that brought about by the enzyme itself. In addition, based on the above results, it can also be seen that the pyruvate decarboxylase mutant in the examples of the present invention can tolerate high concentrations of substrates, and thus can be effectively used for large-scale production.

[0313] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. A pyruvate decarboxylase mutant, characterized in that, The pyruvate decarboxylase mutant includes: A mutant that retains catalytic activity after amino acid substitution, deletion, or addition based on the pyruvate decarboxylase having the sequence shown in SEQ ID NO: 3; Preferably, the conversion rate of the mutant to benzaldehyde is greater than or equal to 50%, preferably greater than or equal to 90%.

2. The pyruvate decarboxylase mutant according to claim 1, wherein The pyruvate decarboxylase mutant includes: a mutant that retains catalytic activity after 1 - 20 amino acid substitutions, deletions, or additions based on the pyruvate decarboxylase having the sequence shown in SEQ ID NO: 3; Preferably, the pyruvate decarboxylase mutant includes: a mutant that retains catalytic activity after 13 - 17 amino acid substitutions, deletions, or additions based on the pyruvate decarboxylase having the sequence shown in SEQ ID NO: 3; Preferably, the pyruvate decarboxylase mutant includes: at least one amino acid substitution occurs at the positions of phenylalanine (F) at the 297th position, lysine (K) at the 345th position, tryptophan (W) at the 371st position, threonine (T) at the 266th position, glutamine (Q) at the 397th position, glutamine (Q) at the 379th position, glycine (G) at the 420th position, aspartic acid (D) at the 444th position, aspartic acid (D) at the 280th position, phenylalanine (F) at the 292nd position, asparagine (N) at the 30th position, asparagine (N) at the 305th position, proline (P) at the 354th position, valine (V) at the 262nd position, glutamic acid (E) at the 387th position, isoleucine (I) at the 432nd position, lysine (K) at the 302nd position in the pyruvate decarboxylase having the sequence shown in SEQ ID NO:

3.

3. A biological product, characterized in that, The biological product includes: (1) A nucleic acid molecule encoding the pyruvate decarboxylase mutant according to any one of claims 1 - 2; (2) An expression vector containing the nucleic acid molecule described in (1); (3) A transformant containing the nucleic acid molecule described in (1); (4) A transformant containing the expression vector described in (2); wherein, the transformant does not involve animal and plant reproductive materials; Preferably, the expression vector includes viruses, plasmids, and phages; Preferably, the transformant includes bacteria, fungi, and animal and plant cells; Preferably, the transformant is Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, and Pichia pastoris.

4. The biological product according to claim 3, characterized in that, The nucleic acid molecule is further linked with a modification sequence and / or a functional sequence; Preferably, the modification sequence and / or the functional sequence includes at least one of a signal peptide, a promoter, an enhancer, a terminator, a recognition site for a tool enzyme, a ribozyme, a self - splicing intron, an miRNA binding site, or a ribosome binding site (RBS).

5. Use of the pyruvate decarboxylase mutant according to any one of claims 1 - 2, or the biological product according to any one of claims 3 - 4 in an enzyme - catalyzed reaction; Preferably, the enzyme - catalyzed reaction includes a catalytic reduction reaction of a carbonyl group.

6. Use of the pyruvate decarboxylase mutant according to any one of claims 1 - 2, or the biological product according to any one of claims 3 - 4 in the preparation of ephedrine and / or pseudoephedrine intermediates, ephedrine and / or pseudoephedrine; Preferably, the intermediate is a chiral intermediate; Preferably, the intermediate is chiral phenylacetylcarbinol.

7. A method for preparing chiral phenylacetylcarbinol, comprising the following steps: Using benzaldehyde as a substrate, adding the pyruvate decarboxylase mutant according to any one of claims 1-2, or the biological product according to any one of claims 3-4, then adding pyruvic acid and cofactors, and reacting at 10-35 °C for 5-20 h to obtain chiral phenylacetylcarbinol; Preferably, the cofactor includes Mg 2+ reagent and thiamine diphosphate.

8. The method according to claim 7, wherein The method further comprises: immobilizing the pyruvate decarboxylase mutant according to any one of claims 1-2, or the biological product according to any one of claims 3-4; Preferably, the immobilization comprises one of the following methods: (1) Using an embedding agent to embed the pyruvate decarboxylase mutant according to any one of claims 1-2, or the biological product according to any one of claims 3-4; (2) Immobilizing the pyruvate decarboxylase mutant according to any one of claims 1-2, or the biological product according to any one of claims 3-4 on a carrier based on physical adsorption or chemical bonds; or (3) Using a coupling agent to crosslink the pyruvate decarboxylase mutant according to any one of claims 1-2, or the biological product according to any one of claims 3-4.

9. The method according to claim 7, wherein In the method, the content of the benzaldehyde is greater than or equal to 1 millimole per liter (mM), preferably 1-60 mM; and / or The content of pyruvic acid is greater than or equal to 1 millimole per liter (mM), preferably 1-60 mM.

10. A method for preparing ephedrine and / or pseudoephedrine, comprising: Using the method according to any one of claims 7-9 to prepare chiral phenylacetylcarbinol, and then preparing ephedrine and / or pseudoephedrine.