Application of overexpression transcription factor PtoLBD1.2 gene in promoting growth and development of populus tomentosa and method
By overexpressing the transcription factor PtoLBD1.2 gene in poplar plants and regulating its expression with tissue-specific promoters, the problem of insufficient wood biomass in the growth and development of poplars was solved, and a significant increase in poplar growth rate and biomass was achieved.
Patent Information
- Application Number
- CN202510432876.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-08
- Publication Date
- 2025-07-08
AI Technical Summary
The prior art is difficult to effectively promote the growth and development of poplars, especially to improve the biomass and quality of wood, and the development and transportation function of the phloem are insufficient.
Through genetic engineering methods, the transcription factor PtoLBD1.2 gene was overexpressed, and tissue-specific promoters were used to regulate its expression in poplar plants, promoting the development of phloem and thickening of wood.
It significantly improves the growth rate and biomass of poplars, increases plant height, stem thickness and internode number, improves the quality of wood and the width of phloem, and promotes the acceleration of secondary growth.
Smart Images

Figure CN120272492A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, specifically to the application of overexpressing the transcription factor PtoLBD1.2 gene in promoting the growth and development of Populus tomentosa, and also relates to a method for promoting the growth and development of Populus tomentosa. Background Art
[0002] With the advancement of China's environmental protection strategy, improving the growth rate of forest trees and improving the quality of wood have become important goals of current forest tree breeding. Wood formation is based on the secondary growth of forest trees. Sufficient supply of nutrients to maintain secondary growth is the basis for obtaining excellent forest tree quality, and the phloem, which plays the role of transporting nutrients, is indispensable in this process. It not only plays a role in transmitting information and mechanical support together with other parts of the vascular tissue, but also transports carbohydrates, amino acids and other nutrients from the photosynthetic product formation site (source) to the nutrient storage and metabolism site (sink), playing an important role in the process of material transportation.
[0003] In recent years, the research on phloem development has mainly focused on the regulation of phloem differentiation by transcription factors and the regulation of phloem regeneration by cytokinins. The LBD (LATERAL ORGAN BOUNDARIES DOMAIN) gene is a plant-specific transcription factor family, which plays an important role in regulating plant organ development and growth and development. Existing literature shows that LBD1 is mainly expressed in the stems of secondary growth in poplar, and its expression is higher in the phloem of the stem. The transgenic phenotypes of function activation or function loss are mainly related to phloem-related changes.
[0004] By constructing a phylogenetic tree, analyzing the homologous relationship between Arabidopsis thaliana and poplar LBD1, and naming it PtoLBD1.2. Using tissue-specific promoters to overexpress related genes can accelerate the growth and development rate of wood, and thus increase the biomass of wood. The thickening of wood mainly comes from the secondary development of the plant stem. The vascular cambium differentiates outward to form phloem and inward to form xylem, making the stem further thicken. Therefore, overexpressing the PtoLBD1.2 gene through tissue-specific promoters can improve the growth and development rate of wood, laying a foundation for future molecular breeding to cultivate excellent poplars. Summary of the Invention
[0005] In view of this, one of the purposes of the present invention is to provide an application of overexpressing the transcription factor PtoLBD1.2 gene in promoting the growth and development of Populus tomentosa; the second purpose of the present invention is to provide a method for promoting the growth and development of Populus tomentosa; the third purpose of the present invention is to provide a tissue-specific promoter proPtoLBD1.2.
[0006] To achieve the above purposes, the present invention provides the following technical solutions:
[0007] 1. Application of overexpressing transcription factor PtoLBD1.2 gene in promoting the growth and development of Populus tomentosa, wherein the nucleic acid sequence of the transcription factor PtoLBD1.2 gene is as shown in SEQ ID NO.3.
[0008] Preferably, in the present invention, the overexpressing transcription factor PtoLBD1.2 gene is regulated and expressed using a tissue-specific promoter, and the sequence of the tissue-specific promoter is as shown in SEQ ID NO.8.
[0009] Preferably, in the present invention, the promotion of the growth and development of Populus tomentosa is to increase plant height, stem diameter, internode number or phloem width.
[0010] 2. A method for promoting the growth and development of Populus tomentosa, wherein the PtoLBD1.2 gene is introduced into Populus tomentosa plants by genetic engineering methods to obtain plants overexpressing the PtoLBD1.2 gene, which are Populus tomentosa with high growth and development.
[0011] Preferably, in the present invention, the PtoLBD1.2 gene is regulated and expressed using a tissue-specific promoter, and the sequence of the tissue-specific promoter is as shown in SEQ ID NO.8.
[0012] Preferably, in the present invention, the PtoLBD1.2 gene is ligated into a plant overexpression vector initiated by the tissue-specific promoter proPtoLBD1.2 shown in SEQ ID NO.3 through homologous recombination.
[0013] 3. Tissue-specific promoter proPtoLBD1.2, wherein the nucleic acid sequence of the tissue-specific promoter proPtoLBD1.2 is as shown in SEQ ID NO.8.
[0014] The beneficial effects of the present invention are as follows: The transcription factor PtoLBD1.2 gene was cloned from poplar in the present invention. By genetic engineering methods, tissue-specific PtoLBD1.2 overexpressing transgenic plants were obtained after transforming wild-type Populus tomentosa by Agrobacterium tumefaciens infection method. Plants with higher expression levels were screened through subsequent positive identification for phenotype observation. The results showed that compared with the wild-type at the same period, the transgenic plants of PtoLBD1.2 had increased plant height, thicker stems, and significantly increased above-ground biomass. The cultivation technology method provided by the present invention has cultivated high-quality poplar varieties with fast growth rate and high biomass. This invention has great significance for future molecular breeding of excellent poplars. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] In order to make the objectives, technical solutions and beneficial effects of the present invention clearer, the following drawings are provided by the present invention for illustration:
[0016] Figure 1Phylogenetic analysis of Populus and Arabidopsis LBD1
[0017] Figure 2 Macroscopic phenotypes of transgenic plants (A: Overall above-ground phenotypes of wild-type Populus tomentosa and overexpressing plants; B: Plant heights of wild-type Populus tomentosa and overexpressing plants; C: Comparison of LBD1.2 expression levels in wild-type Populus tomentosa and overexpressing plants).
[0018] Figure 3 Biomass analysis of overexpressing transgenic plants (A: Number of internodes of wild-type Populus tomentosa and overexpressing plants; B: Stem thickness of the 6th - 10th internodes of wild-type Populus tomentosa and overexpressing plants).
[0019] Figure 4 Analysis of phloem in overexpressing transgenic plants (A: Toluidine blue staining observation of transverse sections of the eighth internode tissues of three-month-old wild-type and proLBD1.2::LBD1.2-L1 / L2 transgenic Populus tomentosa plants; The red straight-line area represents the width of secondary phloem; Ph: Phloem; Scale bar: 50 μm; B: Statistical analysis of phloem width of wild-type Populus tomentosa and overexpressing plants).
[0020] Figure 5 Observation of LBD1.2 protein localization Detailed implementation methods
[0021] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the exemplified embodiments are not intended to limit the present invention.
[0022] According to the reported AtLBD1 gene in the model plant Arabidopsis thaliana, amino acid sequences with high similarity to the AtLBD1 sequence were found in Populus through BLAST alignment (https: / / phytozome.jgi.doe.gov). Using the MEGA7.0 software, a phylogenetic tree was constructed by the Neighbor-Joining method, and the results are as Figure 1 shown. The homologous relationship between LBD1 in Arabidopsis thaliana and Populus was analyzed, and they were named LBD1.1 and LBD1.2. LBD1.1 and LBD1.2 are homologous genes to each other, and LBD1.2 was selected to create transgenic materials in the follow-up.
[0023] Example 1: Extraction of total RNA from Populus and reverse transcription to synthesize cDNA
[0024] 1. Extraction of total RNA from Populus
[0025] First, prepare the materials before RNA extraction. Wash the medicine spoon, mortar, pestle, etc. with sterilized DEPC water and dry them in an oven for later use. Take out the prepared items such as the mortar the next day, add an appropriate amount of quartz sand, and burn 10 mL of absolute ethanol. After cooling, proceed with RNA extraction.
[0026] During the experiment, all operations were carried out using RNase-free pipette tips and 1.5 mL centrifuge tubes provided by AXYGEN. The specific operation steps for RNA extraction refer to the instructions of the plant total RNA extraction kit:
[0027] 1) First, add 500 μL of lysis buffer to a 1.5 mL RNase-free centrifuge tube, and at the same time add about 15 μL of β-mercaptoethanol and mix well.
[0028] 2) Weigh about 0.5 g - 2 g of the pre-prepared plant material in advance, quickly grind it into a powder under liquid nitrogen freezing conditions, and then transfer it to the above tube containing lysis buffer. Vigorously shake and mix well.
[0029] 3) Let it stand at room temperature for 5 min, then centrifuge at 12000 rpm for 10 min. The centrifuge needs to be pre-cooled to 4 °C in advance.
[0030] 4) After centrifugation, gently take out the tube, aspirate about 400 μL - 500 μL of the supernatant (try to aspirate it clean) and add it to a new 1.5 mL centrifuge tube, and then add half of the volume of absolute ethanol as above. Quickly invert and mix well. At this time, flocculent substances may be slightly visible.
[0031] 5) Transfer the mixed liquid into a 1.5 mL collection tube with an adsorption column, and centrifuge at 4 °C and 12000 rpm for 1 min.
[0032] 6) Pour out the liquid in the collection tube, add 600 μL of PG buffer to the adsorption column, and centrifuge at 4 °C and 12000 rpm for 1 min.
[0033] 7) Pour out the liquid in the collection tube again, and at the same time add 600 μL of Wash Buffer to the adsorption column to wash away impurities, and centrifuge at 4 °C and 12000 rpm for 1 min.
[0034] 8) Repeat step 7).
[0035] 9) Perform a blank centrifugation at 12000 rpm for 5 min to remove the Wash Buffer as much as possible to avoid the residue of Wash Buffer from inhibiting downstream reactions.
[0036] 10) Transfer the adsorption column into a new 1.5 mL centrifuge tube, add 30 μL - 50 μL of RElution Buffer or DEPC water with pH > 7.0 dropwise to the center of the adsorption column membrane, let it stand at room temperature for 2 min, then centrifuge at 4°C and 12,000 rpm for 1 min;
[0037] 11) Re-aspirate the eluate back into the adsorption column, centrifuge at 4°C and 12,000 r / min for 1 min. The product is the total RNA of the sample, and the RNA needs to be stored in an -80°C refrigerator for standby in time.
[0038] 2. Reverse transcription of total RNA from poplar to synthesize cDNA
[0039] Use the reverse transcription kit from TakaRa Company and perform experimental operations according to its instruction manual. This kit mainly consists of the following 7 components: ① gDNA Eraser, ② 5x gDNA Eraser Buffer, ③ PrimeScript RT Enzyme Mix I, ④ 5x PrimeScript Buffer 2 (for Real Time), ⑤ RT Primer Mix, ⑥ RNase Free dH2O, ⑦ EASY Dilution.
[0040] The total RNA extracted above is finally reverse-transcribed to obtain single-stranded cDNA, and the reaction product is stored in a -20°C refrigerator for standby. The specific reaction system is shown in Table 2:
[0041] Table 2. Reaction system
[0042]
[0043] Procedure: 37°C for 15 min; 85°C for 5 s; store at -20°C.
[0044] The single-stranded cDNA obtained by reverse transcription is used for amplification of the target gene, and can also be used for transcriptome sequencing analysis.
[0045] Example 2. Design of PCR primers and PCR amplification to obtain the target fragment
[0046] 1. Design of PCR primers
[0047] First, log in to PHYTOZOME (http: / / www.phytozome.com) to query the CDS sequence and promoter sequence of the poplar PtoLBD1.2 gene. Specific primers for the PtoLBD1.2-CDS sequence with homologous arms were designed. The upstream primer sequence for the PtoLBD1.2 fragment with homologous arms is: 5’-AACTAGCTCCTCCATTTCCCATGGATATGATTGAGCAATC-3’ (SEQ ID No.4), and the downstream primer sequence is: 5′-TCGCCCTTGCCCATggatccTGTCCAGAGAGGCTCCC-3’ (SEQ ID No.5) (the target fragment is 697bp). The primers were synthesized on behalf of the company by BGI (Beijing). All reaction reagents used for PCR are products of TaKaRa Company. Use HS high-fidelity enzyme for PCR amplification of the target fragment. The amplification system is as follows:
[0048] Table 1. Amplification system
[0049] <![CDATA[5×PrimeSTAR GXL Buffer (Enzyme + Mg 2 + Plus)]]> 5 μL F-Primer (10 μM) 0.25 μL R-Primer (10 μM) 0.25 μL Template DNA 0.5 μL <![CDATA[ddH2O]]> 4 μL Total 10 μL
[0050] The reaction system can be appropriately enlarged according to the amount of the desired product.
[0051] The reaction conditions are as follows: pre-denaturation at 98°C for 2 min; denaturation at 98°C for 10 s; annealing temperature at 58°C for 10 s; extension at 72°C for 20 s, for 36 cycles; finally, extension at 72°C for 10 min. Electrophoresis detection was performed using 1%-2% agarose gel according to the size of the PCR product bands.
[0052] After the electrophoresis detection, when the target band is observed and the band is clear and bright, the gel extraction of the target fragment can be carried out. The gel extraction kit of BioFlux company was selected. The kit mainly consists of the following 4 components, namely ① Extraction Buffer (yellow, PH <= 7.0), ② Wash Buffer, ③ Elution Buffer, ④ Spin Columns, etc. The specific steps are as follows.
[0053] 1) Use a clean and sharp blade to cut out the agarose gel containing the target DNA fragment and put it into a 1.5 or 2.0 mL centrifuge tube; (try to remove the gel as cleanly as possible during the gel cutting process)
[0054] 2) Add an appropriate volume of ① according to the ratio of 1:3 (mass number: volume in microliters);
[0055] 3) Place the centrifuge tube containing the gel and the mixture in step ① into a 50-60°C water bath until the gel melts (during the melting process, mix once every 2-3 minutes);
[0056] 4) When the recovered target gene fragment is less than 500 bp, an equal volume of isopropanol needs to be added in a 1:1 ratio and mixed evenly (if the fragment size is greater than 500 bp and less than 4 kb, no isopropanol needs to be added).
[0057] 5) After the agarose gel melts, transfer all the mixed liquid to medium (4), centrifuge at 12,000 rpm for 1 min, and discard the waste liquid in the collection tube;
[0058] 6) Then add 500 μL of ① to ④, centrifuge at 12000 rpm for 1 min, and discard the waste liquid in the collection tube;
[0059] 7) Add 750 μL of ② to ④, centrifuge at 12000 rpm for 1 min, and discard the waste liquid in the collection tube;
[0060] 8) Repeat step (7);
[0061] 9) Centrifuge again at 12000 rpm for 5 min to remove ② as much as possible to prevent ② from remaining and inhibiting downstream reactions;
[0062] 10) Add 30 μL-50 μL of ③, water or TE solution to ④ and let stand at room temperature for 1 min;
[0063] 11) Centrifuge at 12000rpm for 1min, collect and save the solution in the centrifuge tube; (repeat once②)
[0064] After gel recovery, take 1 μL of the product for electrophoresis detection to observe the band size and brightness. The recovered product was stored at -20°C.
[0065] The recovered product was sequenced to obtain the coding sequence of the gene PtoLBD1.2 (SEQ ID No. 1), and the amino acid sequence is shown in SEQ ID No. 2.
[0066] Poplar DNA was used as a template for amplifying the promoter proLBD1.2. The nucleotide sequence of the upstream primer with homology arms for amplifying the promoter proLBD1.2 is shown in SEQ ID No.6, and the nucleic acid sequence of the downstream primer with homology arms is shown in SEQ ID No.7.
[0067] Upstream primer sequence: proPtoLBD1.2-F: 5′-ccagtgccaagcttggatccTTCGGACAAATGTGTGGTTC-3′ (SEQ ID No. 6);
[0068] Downstream primer sequence: proPtoLBD1.2-R: 5'-GATTGCTCAATCATATCCATGGGAAATGGAGGAGCTAGTT-3' (SEQ ID No.7)
[0069] The obtained promoter sequence is as follows SEQ ID No.8:
[0070] TTCGGACAAATGTGTGGTTCTGATCGCTGGAACAAAGGTTTGAAAGTGATATTTATGAT
[0071] GACATAACAGAAGGTAGTTAATTTATTCCTAGAATTATAACTAATGTACGACTACTGCT
[0072] GGGGATTGTATAGTTCTGTGTTGGCATCAGCCTCGAAGCCAATTTTATCTCCCGAGTCC
[0073] GGAAAGGCATGTGTGATAGGACTAGTATTGGTATGGAGTTAGTGATGAGCAATACCTA
[0074] CTATATTTTGACGACTTACAAGCAATGATGGACACTACTTACCACCAAGGGTCCACGTA
[0075] GATGATCAGTCAAGTTCTGTAGTGAAGGAGGATGTGAAGCAGTTTTCCATGTCTTATTT
[0076] ATTATAAAATAATATAAATTATATTTCAATATTTTATTTAATAGTTTAAGGTTTGAGGTT
[0077] AAGATAATTCTTTAATATAGTATTAGAGGTTTGATAGCTAAACAGTCATTAATTTAAAT
[0078] CTCTTTATCTTTATTTATTTGATAAAAACTAAGTATAAAATAGTATGAATATGTGTAAA
[0079] TTTTAAATTTAAAGAGCTTTTATTTAAGAAGTTATTTGAGAAAAAAAATTTAATAAGAT
[0080] GATAAGATTGAGATGATTGAGTCATTACCTAATAGTTTAAGTTTTTAGATTGAGATGAT
[0081] TTTTTAAAAATATTGATGATTTTTATTTTATTTTTGTTATAAATCTAATGTATATTTCAAA
[0082] CTTTAGATAAGAAGTAAAAAATATTTTTTTATTACTTCATCAACTTCGACTAAACCTCT
[0083] ACTTTAAAGTGAGTCAGCTCTCAAAAGGTGCCGATTGTTGAACATTCATTTTAATGATT
[0084] TTTGAAGTAATTTGAATATGCTAGATAGTATTGCGCAACAAAATCATACGAGCGTTTGA
[0085] TTTCCTTACTCAGCAAAACTACTTTCCTTTTTTTTTTTTTTTTAATTTTAGAATATATTTA
[0086] AAAGTGTGATTGTAGTTGCTTTTTAAAATGCTTGTAATTGAAAATGCATTAAAATAACA
[0087] TATATTTTTTTATTTTTTTCAAAATTATTTTTAACATTAATATATCAAAATGATATAAAA
[0088] ACACTAAAAATTATTAATTTGAAACAAGAAAAATAAAAAAATTTAAATATTTTTAAAA
[0089] TATAAAAGTAAACAGAGTCCTAATCTATGCTCTGACCGAGTGATCAAGGTACACTAGT
[0090] GCTATCTTAATCAATTAGTTTTCGACATAATCGTGTTTAGTAGACCTTCTGGTAAAAAA
[0091] CTAATTAATTCTTTGCCCACTTTTCTATCGAATTCCTAGCTAGTGGGTTCTCTTTCCATC
[0092] TTGCTCTATGATGTCATCTACAGATCCCTGAAAAAGGTTTTTTTAATATATAGACAGTG
[0093] GAGGAAGAAAAAAGTTTCAACACACATATATATCGTGCTAAACTCAAATCTCCAGTCA
[0094] ACTATTTCTTCTATAGTGTATGATTAAGCACAAATTTGTTTATGCGGTTTAGCCTTGTTT
[0095] TTTTTTTATATATATATATATATTTTTCTAAATTATTTTTTTTATATTTTAGAATAGTTTT
[0096] AATATGATTATATCAAAAATAAATTTTAAAAATTAAAAAAATATTTTTTAAAATATATT
[0097] TCTAAGTAAAAAAGTACTTTTCAAAGTAACCCTACCACCATATAAAATACTATATAAAT
[0098] AAAGCTAATATCTTTATTATTATTTTAATTTTTACATTGACAAAAAATATTAAGACTTGT
[0099] TCAAAAATCTCTTGATTTTCTTTGTAGAAAATGCAATATATATATATATATATATATATT
[0100] ATTACCAGAATTAAAATGAGAAGAATTCAAGGTTAGGCATAATCAATTTGTTTGATAC
[0101] CTTGAAAACAAAATTAAGTATGCAACTAGAAATTTGGTAATTCATAGCCAGCACTGAA
[0102] AGAAACTTCTCTGAAATAATTTTGGCAGTACTGTATGACTCTTCCTAAGCTGTCCTGCC
[0103] CTGTACGAGCTGCCTTCCAACTGAAGACATGTGACGACTAGATCAACAAAAAAAATGT
[0104] AGTGCTTTGGAAGGAAGAAAAAAAAGTCCATATACCATTTTATTTTTAAATAATACAA
[0105] ACTTATTTTAAAAATAAATTTATTTTATATTTATATTCTTGCACCTTCTATTACGGACAT
[0106] TGTCAAACTAACCAAACGAAACGTGAGTGGTTTCAAATTGTGACATCATTAAAAGATT
[0107] AATGACATAAGCTTGACCTCATTAAAATAAATGCTTTCTTTCTCTATATATTCCCTCCTT
[0108] TTGGTTTCTGTGAAGTATACTCGCAAAGCAGCAGCAACTAGCTCCTCCATTTCCC
[0109] Subsequently, PCR amplification was performed again using the PCR amplification system in Table 1, and the gel extraction kit from BioFlux was used again to extract the proPtoLBD1.2 fragment from the gel.
[0110] Example 3: Construction of the proPtoLBD1.2 - PtoLBD1.2 - eYFP vector and transformation of Agrobacterium tumefaciens GV3101
[0111] 1. Construction of the proPtoLBD1.2 - PtoLBD1.2 - eYFP vector
[0112] Take 10 μL of the bacterial strain of the vector backbone (pCAMBIA1305 - eYFP) and inoculate it into the LB liquid medium containing the corresponding antibiotic, and place it in a shaker at 37°C with a shaking speed of 200 rpm for amplification culture. Plasmid extraction was performed on the overnight - cultured bacterial solution, and it was digested with BamH I, dephosphorylated, and the product was purified to obtain the vector backbone. The above - recovered fragment was ligated into the vector backbone using a homologous recombination kit. Finally, the ligation product was transformed into competent Escherichia coli DH5α cells. Through PCR amplification of the target gene fragment and enzyme digestion verification, transformants were obtained and the bacterial strains were preserved. The above completed the plant over - expression vector (SEQ ID No.3) driven by the tissue - specific promoter proPtoLBD1.2.
[0113] 1) First, pick a single colony that is positive for bacterial test and inoculate it into LB liquid culture medium containing the corresponding antibiotics, place it in a shaking incubator at 37°C and 200 rpm for amplification culture.
[0114] 2) The Escherichia coli plasmid extraction mainly uses the plasmid extraction kit of BioFlux, which mainly consists of the following 7 components: ① Resuspension buffer, ② Lysis buffer, ③ Neutralization Buffer, ④ Wash Buffer, ⑤ Elution Buffer, ⑥ RNase solution, and ⑦ Spin columns.
[0115] 3) Take 1 mL of overnight cultured bacterial solution and add it to a 1.5 mL centrifuge tube. Centrifuge at 12000 rpm for 1 min, discard the supernatant, and collect the bacteria (this process can be repeated multiple times to collect more bacteria as needed);
[0116] 4) Add 250 μL of ① to resuspend the bacterial pellet (resuspend until there are no bacterial clumps);
[0117] 5) Add 250 μL of ② and gently invert 4 to 6 times (do not shake violently to prevent genomic DNA breakage);
[0118] 6) Add 350 μL of ③, gently invert the centrifuge tube 4 to 6 times (at this time, flocculent precipitate should appear in the centrifuge tube), and centrifuge at room temperature, 12000 rpm, for 10 min;
[0119] 7) Transfer the supernatant from step 4) to step 7, centrifuge at 12000 rpm for 1 min, and discard the waste liquid in the collection tube;
[0120] 8) Add 650 μL of ④Wash Buffer to ⑦, centrifuge at 12000 rpm for 1 min, and discard the waste liquid in the collection tube;
[0121] 9) Repeat 8) once;
[0122] 10) Centrifuge at 12000 rpm / min for 5 min to remove ④ as much as possible to prevent the residue of ④ from inhibiting the downstream reaction;
[0123] 11) Transfer the above ⑦ to a new 1.5 mL centrifuge tube, add 30-50 μl ⑤, water or TE solution, etc., stand at room temperature for 1 min, and centrifuge at 12000 rpm for 1 min;
[0124] 12) The solution contains plasmid DNA, collect the solution in the centrifuge tube. Repeat step ⑦, centrifuge again at 12000 rpm for 1 min;
[0125] 13) The plasmid DNA can be directly used for various downstream molecular experiments and stored at -20°C.
[0126] Construction of the plant expression vector: The plasmid extracted from the positive monoclonal was digested with the pre-designed restriction enzyme. The large fragment backbone obtained by gel recovery was ligated with the recovered target fragment, and then transformed into Escherichia coli DH5α. The transformed cells were spread on the LB solid medium containing 50 mg / L kanamycin, and the positive monoclonal was screened by colony PCR and nucleic acid restriction enzyme digestion.
[0127] 2. Transformation of the proPtoLBD1.2-PtoLBD1.2-eYFP plasmid into Agrobacterium tumefaciens GV3101
[0128] Extract the proPtoLBD1.2-PtoLBD1.2-eYFP plasmid from the positive transformant Escherichia coli respectively. The extraction steps are according to the Plasmid Mini Kit kit, and the specific operations are as follows:
[0129] ① Take the bacterial liquid cultured to the logarithmic phase into an EP tube, centrifuge at 13400 rpm for 1 min to collect the bacteria, and discard the supernatant.
[0130] ② Add 250 μL of pre-cooled Solution I containing RNase A and vortex to resuspend the bacteria evenly.
[0131] ③ Add 250 μL of Solution II and gently invert the tube up and down 5 - 6 times. After mixing, let it stand for 2 min.
[0132] ④ Add 350 μL of Solution III, invert the tube up and down 5 - 6 times until a precipitate appears, and centrifuge at 13400 rpm for 10 min.
[0133] ⑤ Take the supernatant and add it to the adsorption column (about 700 μL of supernatant). Place the adsorption column in a 2 mL collection tube and centrifuge at 10000 rpm at room temperature for 1 min, then discard the liquid.
[0134] ⑥ Add 500 μL of HB Buffer and centrifuge at 10000 rpm at room temperature for 1 min, then discard the liquid.
[0135] ⑦ Add 700 μL of DNA Wash Buffer and centrifuge at 10000 rpm at room temperature for 1 min, then discard the liquid.
[0136] ⑧ Repeat step 7, add 700 μL of DNA Wash Buffer and centrifuge at 10000 rpm at room temperature for 1 min, then discard the liquid.
[0137] ⑨ Place the adsorption column in a collection tube and centrifuge at 13,400 rpm for 2 min with an empty tube.
[0138] ⑩ Place the adsorption column in another new centrifuge tube, add 30 - 50 μL of Elution Buffer, let it stand for 2 min, and centrifuge at 13,400 rpm for 1 min. Store it at -20 °C for later use.
[0139] The operation of transforming Agrobacterium is as follows:
[0140] ① Take 5 μL of the proPtoLBD1.2 - PtoLBD1.2 - eYFP plasmid and add it to 200 μL of Agrobacterium tumefaciens GV3101 competent cells respectively, and mix well.
[0141] ② Immediately place it on ice for 30 min, quickly put it into liquid nitrogen for 2 min, and then place it in a water bath at 37 °C for 5 min.
[0142] ③ Add 800 μL of empty YEP liquid medium, mix well, and then culture it at 28 °C and 200 rpm for 4 - 6 h.
[0143] ④ Centrifuge at 5000 rpm for 8 min, discard 900 μL of the supernatant, mix the remaining 100 μL of the bacterial solution, and use a sterilized and cooled spreading rod to evenly spread the 100 μL of the bacterial solution on the YEP + 40 mg / L Rif + 50 mg / L Kan solid medium, and culture it upside down at 28 °C for 2 d.
[0144] ⑤ Name the bacteria GV3101 - proPtoLBD1.2 - PtoLBD1.2 - eYFP, add 25% glycerol and store it at -80 °C for subsequent genetic transformation experiments.
[0145] Example 4, Genetic Transformation of Populus tomentosa
[0146] The transformation material is the leaves of wild - type Populus tomentosa, and the genetic transformation method mediated by Agrobacterium tumefaciens is adopted.
[0147] 1) Activation of Agrobacterium
[0148] Inoculate Agrobacterium tumefaciens GV3101 containing the recombinant plasmid onto the YEP solid medium (containing 50 mg / L Kan + 40 mg / L Rif), and culture it at 28 °C for 1 - 2 d; pick a single colony and inoculate it into the YEP liquid medium containing 50 mg / L Kan and 40 mg / L Rif, and culture it with shaking at 28 °C until the OD600 reaches 0.8 - 1.0; take 200 μL of the live bacterial solution and transfer it to a fresh YEP medium, culture it with shaking at 28 °C for 6 - 8 h, when the OD600 reaches 0.6 - 0.8, centrifuge to collect the bacteria, resuspend it with 30 ml of the WPM liquid medium added with AS, and then place it in a shaker at 28 °C and shake it for 1 - 2 h, then it can be used for transformation.
[0149] 2) Agrobacterium transformation
[0150] Select the sterile wild-type poplar materials in tissue culture bottles as the background for transformation. First, cut an appropriate amount of tender green leaves, and use a sterile scalpel to cut them into small pieces of leaves in an appropriate amount of sterile water (make sure to produce smooth cuts to facilitate transformation growth); transfer an appropriate amount of the cut leaves to the resuspended bacterial solution and infect for 10 minutes, shaking once every 5 minutes during this period to ensure that the cut wounds of the leaves are fully in contact with the resuspended bacterial solution.
[0151] 3) Co-culture of Populus tomentosa
[0152] Carefully pick out the infected leaf materials with forceps and blot dry the bacterial solution. Place the leaves face down on the WPM co-culture medium and culture them under dark conditions at room temperature of 25°C for 2 days.
[0153] 4) Selective culture of Populus tomentosa
[0154] After 2 days, transfer the transformed leaves to the WPM selective medium (place them in the corresponding resistant medium as required by the experiment), and culture them under dark conditions at room temperature of 25°C for 3 - 4 weeks. During this period, change the medium every 5 days (during the selective culture period, it is necessary to observe the degree of change of the leaves more).
[0155] 5) Bud induction culture of Populus tomentosa
[0156] When white dot-like loose callus appears around the leaves, transfer it to the WPM bud induction medium (place it in the corresponding resistant medium as required by the experiment), and induce bud formation on the light culture rack under the conditions of light intensity of 2000 - 10000 Lux and room temperature of 25°C for about 4 - 5 weeks. During the bud induction culture period, it is still necessary to observe the growth changes of the callus. If it is found that the callus does not grow or turns brown, the medium should be changed in time.
[0157] 6) Rooting culture of Populus tomentosa
[0158] When adventitious buds grow from the callus in the bud induction medium and the length is about 3 - 4 cm, cut them off and transfer them to the WPM rooting medium. Under normal circumstances, the rooting time of the wild type is about 7 days, while the rooting of those with resistance is slower.
[0159] 7) Transplanting of transgenic Populus tomentosa
[0160] When the rooted seedlings grow to about 10 cm and have well-developed roots, take out the seedlings, wash the agar on the roots with water, make marks, and transplant them to the greenhouse for cultivation (note that at this time, the seedlings taken out from the tissue culture bottles need a stage to adapt to the external environment, so they need to be sealed with plastic wrap and the film should be slowly removed after adaptation).
[0161] Example 5, DNA Extraction from Transgenic Plants and PCR Molecular Detection
[0162] 1. DNA Extraction from Poplar
[0163] The CTAB method was mainly used to extract the genomic DNA of poplar. The specific experimental method is as follows:
[0164] 1) Preparation before DNA extraction: First, prepare a sufficient number of 1.5 mL EP tubes and add 300 μL of preheated CTAB lysis buffer (containing 15 μL of β-mercaptoethanol) to each tube. At the same time, add 2 - 3 magnetic beads (the magnetic beads ensure sufficient tissue fragmentation);
[0165] 2) Use a tissue disruption instrument to disrupt for 10 min. After observing the disruption situation, add 200 μL of preheated CTAB lysis buffer (containing β-mercaptoethanol) and incubate in a water bath at 65 °C for 45 min, inverting and mixing every 10 min;
[0166] 3) After the water bath, centrifuge at 12000 rpm for 10 min at room temperature;
[0167] Aspirate the supernatant and transfer it to a new 1.5 mL EP tube. Add an equal volume of extraction solution (chloroform:isoamyl alcohol, 24:1, V / V) to the CTAB and shake vigorously, then lay the tube flat to emulsify for 10 min;
[0168] 4) Centrifuge at 12000 rpm for 10 min at room temperature;
[0169] 5) Aspirate the supernatant and transfer it to a new 1.5 mL EP tube. Repeat step 4 to remove protein and other impurities as much as possible;
[0170] 6) Aspirate the supernatant and transfer it to a new 1.5 mL EP tube. Then add an equal volume of pre-cooled isopropanol and mix well by inverting up and down. White flocculent precipitates will be observed;
[0171] 7) Carefully use a pipette to aspirate the supernatant in the EP tube, then add 1 mL of 75% alcohol to wash once. After centrifuging at 12000 rpm for 5 min, pour out the supernatant (note not to pour out the white precipitate);
[0172] 8) Repeat step 7;
[0173] 9) Dry in an oven at 37 °C;
[0174] 10) When the above white flocculent precipitate becomes transparent, add 50 μL of ddH2O (containing DNase), digest at 37 °C for 1 h, and store at -20 °C;
[0175] 11) The extracted DNA was detected by 1% agarose gel electrophoresis.
[0176] 2. PCR Molecular Detection
[0177] The template DNA was the genomic DNA of transgenic poplar, and screening was carried out by amplifying a segment of gene (687 bp) between the backbone and the fragment. Specific primers were designed with the following sequences:
[0178] proPtoLBD1.2-F: 5′-GCTGTCCTGCCCTGTACG-3′ (SEQ ID NO.9);
[0179] PtoLBD1.2-R: 5′-CTTGATGATGTTGCTGGCTC-3′ (SEQ ID NO.10);
[0180] The PCR reaction system was the same as in Table 1, and the amplification products were detected by 1% agarose gel electrophoresis.
[0181] Table 1. PCR Reaction System
[0182] Component Volume 10×PCR buffer 2.5 μL <![CDATA[MgCl2]]> 1.5 μL dNTP 0.5 μL F-primer 0.5 μL R-primer 0.5 μL Sample cDNA Monoclonal colony rTaq DNA polymerase 0.25 μL <![CDATA[ddH2O]]> 19.25 μL Total 25 μL
[0183] 94°C, 5 min (pre-denaturation); 94°C, 30 s (denaturation); according to the annealing temperature of the designed primers (generally 58°C), 30 s; 72°C, extension time (determined according to the fragment length, about 1 kb / min), for 36 cycles; 72°C, extension for 10 min; for the obtained PCR products, 2 μL was taken for detection by agarose gel electrophoresis.
[0184] Example 6. Analysis of Expression Levels of Transgenic Plants
[0185] First, the unidentifed transgenic plants obtained by Populus tomentosa genetic transformation were subjected to DNA-level detection, and the method was the same as in Example 1.
[0186] After PCR detection of the transgenic plants, it was found that 2 plants (L1, L2) successfully achieved the transformation of exogenous DNA.
[0187] Although the genetic transformation of Populus tomentosa was successfully carried out, due to the individual differences among different plants, the expression levels of the same gene were different. Therefore, it was necessary to detect the expression levels of the transgenic plants. In the present invention, L1 and L2, two transgenic plants, were selected for detection.
[0188] RNA was separately extracted from wild-type Populus tomentosa and the obtained transgenic positive plants and then reverse transcribed into cDNA, and the method was the same as in Example 2. Primers for the internal reference gene UBQ were designed:
[0189] qPCR-PtoLBD1.2-F: 5'-GTTGATTTTTGCTGGGAAGC-3' (SEQ ID No.11);
[0190] qPCR-PtoLBD1.2-R: 5'-GATCTTGGCCTTCACGTTGT-3' (SEQ ID No.12);
[0191] Design primers for detecting the target gene PtoLBD1.2:
[0192] qPCR-PtoLBD1.2-F: 5'-TCTAAGAGGCACGCTCTTACAC-3' (SEQ ID No.13);
[0193] qPCR-PtoLBD1.2-R: 5'-AGTACACAAGAGTTATGGGCA-3' (SEQ ID No.14);
[0194] Perform PCR amplification on the cDNA of wild-type and transgenic lines. The PCR reaction system is the same as the one in the table in Example 2. Use fluorescence quantitative PCR to detect the target gene PtoLBD1.2 in the cDNA of wild-type and overexpression lines at the same concentration, and then analyze the expression levels of the PtoLBD1.2 gene in different transgenic plants (the amplification products can be detected by electrophoresis on a 1% agarose gel).
[0195] The fluorescence quantitative reaction system is shown in Table 2 below:
[0196] Table 2. Fluorescence quantitative reaction system
[0197] Reaction Volume SYBR Premix ExTaqTM 5 μL 10 μmol / L F-primer 0.25 μL 10 μmol / L R-primer 0.25 μL cDNA 0.5 μL <![CDATA[ddH2O]]> 4 μL Total 10 μL
[0198] Its reaction conditions are:
[0199] 95°C, 30 s;
[0200] 95°C, 5 s;
[0201] 60°C, 1 min; 40 cycles
[0202] 95°C, 15 s;
[0203] 60°C, 30 s;
[0204] 95°C, 15 s.
[0205] The quantitative detection results are shown in Table 3 below:
[0206] Table 3. Quantitative detection results
[0207]
[0208] The analysis results of the above quantitative detection results are as Figure 2 shown in C below, and it was found that the expression levels of transgenic plants L1 and L2 were relatively high.
[0209] After 2 months of cultivation, the phenotypes of the above-ground parts (stems + leaves) of wild-type Populus tomentosa and transgenic plants L1 and L2 were observed and compared respectively. It was found that, compared with the wild-type, the transgenic plants grew better and the above-ground parts were more lush. As shown in Figure 2 , A.
[0210] Next, in order to highlight the importance of the PtoLBD1.2 gene, L1 and L2 lines with high expression levels were selected for subsequent phenotypic statistical analysis. This mainly included the plant height, stem diameter, number of internodes, phloem width, etc. of the transgenic plants.
[0211] The phenotypic statistical data are shown in Table 4:
[0212] Table 4. Phenotypic statistical data
[0213]
[0214] The results of the increase / decrease ratio of plant height and the number of internodes are shown in Table 5:
[0215] Table 5. Increase / decrease ratio of plant height and the number of internodes
[0216]
[0217] The results of the stem thickness (mm) are shown in Table 6:
[0218] Table 6. Stem thickness
[0219]
[0220] The results of the increase / decrease ratio of stem thickness are shown in Table 7:
[0221] Table 7. Increase / decrease ratio of stem thickness
[0222]
[0223] According to the above data, it can be seen that, compared with wild-type Populus tomentosa, overexpression of PtoLBD1.2 caused an increase in the plant height of transgenic plants, with the plant height increasing by more than 8.52%, the change in the number of internodes being relatively small, and the stem thickness increasing by 2 - 11%. As shown in Figure 2 B, Figure 3 A, B.
[0224] The increase in stem thickness, combined with the more vigorous growth of the transgenic whole plants observed previously, implies an increase in the above-ground biomass of the transgenic plants. To explore the effect of overexpressing PtoLBD1.2 on plant biomass, under the same cultivation time and conditions, the reasons for the rapid growth and thicker stems of the transgenic plants were further analyzed. The results of the phloem width statistics of wild-type and transgenic plants are shown in Table 8.
[0225] Table 8. Phloem width (μm)
[0226]
[0227]
[0228] The increase / decrease ratio of phloem width is shown in Table 9:
[0229]
[0230] As mentioned above, compared with the wild-type Populus tomentosa, the plant height and stem diameter of the transgenic plants increased significantly, which implies that the transgene promoted the secondary development of the plant stem. The vascular cambium differentiated outward to form phloem and inward to form xylem, resulting in further thickening of the stem. The transgenic material (the 8th internode) was transversely sectioned using a vibratome for preliminary observation. The width of the transgenic phloem region was greater than that of the wild-type. At the same time, through the observation of the LBD1.2 protein localization of the transgenic material, it was found that LBD1.2 was specifically expressed in the phloem, as Figure 5 . The above results confirmed that PtoLBD1.2 regulated the development of secondary phloem, resulting in a significant increase in the plant height and stem diameter of the transgenic plants compared with the wild-type lines, and a significant increase in the comprehensive above-ground biomass, laying a foundation for the future molecular breeding of excellent poplars.
[0231] The above-described embodiments are merely preferred embodiments cited to fully illustrate the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or transformations made by those skilled in the art on the basis of the present invention are all within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.
Claims
1. Application of overexpressing transcription factor PtoLBD1.2 gene in promoting the growth and development of Populus tomentosa, characterized in that: The nucleic acid sequence of the transcription factor PtoLBD1.2 gene is shown in SEQ ID NO.
3.
2. Use of the overexpressed transcription factor PtoLBD1.2 gene according to claim 1 in promoting the growth and development of Populus tomentosa, characterized in that: The overexpressed transcription factor PtoLBD1.2 gene is regulated by a tissue-specific promoter, and the sequence of the tissue-specific promoter is shown in SEQ ID NO.
8.
3. Use of the overexpressed transcription factor PtoLBD1.2 gene according to claim 1 in promoting the growth and development of Populus tomentosa, characterized in that: The promotion of the growth and development of Populus tomentosa is to increase plant height, stem diameter, internode number or phloem width.
4. A method for promoting the growth and development of Populus tomentosa, characterized in that: The PtoLBD1.2 gene is introduced into Populus tomentosa plants by genetic engineering methods to obtain plants overexpressing the PtoLBD1.2 gene, which are Populus tomentosa with high growth and development.
5. The method for promoting the growth and development of Populus tomentosa according to claim 4, characterized in that: The PtoLBD1.2 gene is regulated by a tissue-specific promoter, and the sequence of the tissue-specific promoter is shown in SEQ ID NO.
8.
6. The method for promoting the growth and development of Populus tomentosa according to claim 4, wherein: The PtoLBD1.2 gene is ligated into a plant overexpression vector initiated by the tissue-specific promoter proPtoLBD1.2 shown in SEQ ID NO.3 through homologous recombination.
7. Tissue-specific promoter proPtoLBD1.2, characterized in that: The nucleic acid sequence of the tissue-specific promoter proPtoLBD1.2 is shown in SEQ ID NO.8.
Citation Information
Cited By
Application of PagLBD16.2 gene in regulation and control of plant type development of poplar
CN120683165A