Rice OsATG4b gene and application thereof

By targeted knockout or overexpressing the rice OsATG4b gene, the chalky traits of rice are regulated, and the problem of rice quality is solved, new gene resources are provided for rice variety improvement, and rice quality is improved.

CN120272495AActive Publication Date: 2025-07-08YANGZHOU UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510463314.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-14
Publication Date
2025-07-08
Estimated Expiration
2045-04-14

AI Technical Summary

Technical Problem

The prior art is difficult to effectively improve the chalky traits of rice, resulting in the rice quality not meeting the standards and affecting market competitiveness.

Method used

By mining and utilizing the autophagy-related gene OsATG4b, and using the CRISPR/Cas9 system to target knockout or overexpress the OsATG4b gene, rice mutants with high chalky or low chalky phenotype are created to regulate rice chalky traits.

Benefits of technology

It has achieved significant regulation of the chalkyness and chalky grain rate in rice, provided new genetic resources for rice variety improvement and improved rice quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120272495A_ABST
    Figure CN120272495A_ABST
Patent Text Reader

Abstract

The invention discloses a rice OsATG4b gene and application thereof. A nucleotide sequence of a coding region of the gene is shown as SEQ ID No.1, and a coded amino acid sequence is shown as SEQ ID No.2. It is found for the first time that an autophagy pathway core gene OsATG4b affects chalkiness formation by regulating grain filling, an OsATG4b gene knockout mutant is created through a gene editing technology, an OsATG4b gene overexpression strain is obtained through a transgenic technology, it is verified that the OsATG4b gene is a new gene for regulating rice chalkiness, and a new gene resource is provided for rice quality improvement.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of rice molecular breeding and gene editing. Specifically, it relates to a rice OsATG4b gene and its application. Background Art

[0002] In recent years, remarkable achievements have been made in rice breeding in China in terms of increasing yield. The progress from high-yield breeding to the breeding technology of green super rice has made important contributions to ensuring national food security. However, the problem of rice quality, especially the optimization of chalkiness traits, remains a key bottleneck in current rice breeding. Chalkiness is the opaque part in the rice endosperm, which seriously affects the appearance quality, processing quality and eating quality of rice, and thus reduces its market competitiveness (Fitzgerald et al., 2009).

[0003] Existing studies show that the chalkiness level of rice varieties popularized in China is still relatively high. The average chalky grain rate of indica rice and japonica rice is 23.2% and 16.2% respectively, and the average chalkiness degree is 4.6% and 2.9% respectively (Chen et al., 2024). According to the national high-quality rice standard (GB / T 17891-2017), the chalkiness degree of first-class indica rice and japonica rice should be lower than 2.0%, and the secondary standard only allows the chalkiness degree of indica rice ≤ 5.0% and japonica rice ≤ 4.0%. At present, the chalkiness degree of most popularized varieties still fails to reach the secondary standard of high-quality rice, which seriously restricts the quality improvement and international competitiveness of rice in China.

[0004] Although there have been reports on the research of genes related to the regulation of chalkiness, there is still a lack of efficient and stable technical means for effectively improving chalkiness traits. The reason is that the existing rice chalkiness regulation gene resources are insufficient, and little is known about its molecular regulation mechanism. Therefore, exploring new gene resources that can precisely regulate chalkiness formation and using new breeding methods or molecular technologies of new genes are of great significance for promoting rice quality breeding in China.

[0005] Autophagy is a highly conserved intracellular degradation mechanism in eukaryotes. Through the autophagosome with a double-membrane structure to wrap cytoplasmic substances, it finally fuses with lysosomes (in animals) or vacuoles (in plants) to achieve the degradation and recycling of the contents. In the 1990s, Japanese scientist Yoshinori Ohsumi identified the first autophagy-related gene (autophgy-related gene, ATG1) using a yeast model and systematically analyzed the key steps of autophagosome formation. More than 40 ATG proteins in yeast cooperate to participate in the processes of autophagy induction, membrane nucleation, phagocytic vesicle expansion, autophagosome closure and degradation, and these core mechanisms are highly conserved in plants.

[0006] Although the functions of autophagy in yeast, animals, and model plants have been extensively studied, its role in rice quality regulation (such as chalkiness formation, starch metabolism, protein accumulation, etc.) remains unclear. Therefore, exploring the regulatory mechanism of the autophagy pathway on rice quality and developing molecular breeding techniques based on key autophagy genes are expected to provide new strategies for the cultivation of high-quality rice varieties. Summary of the Invention

[0007] Aiming at the problem that the genetic basis and molecular mechanism of chalkiness traits are still not well understood, leading to the difficulty in breaking through the yield-quality trade-off in chalkiness improvement, the present invention provides a rice OsATG4b gene and its application. By mining and utilizing autophagy-related genes and studying their potential role in regulating rice chalkiness, targeting the regulation of rice quality-related metabolic pathways, it provides new gene resources for solving the current industrial problems of high chalkiness rate and substandard quality of rice.

[0008] To achieve the above object, on the one hand, the present invention provides a rice OsATG4b gene, the nucleotide sequence of its coding region is shown in SEQ ID No.1, and the amino acid sequence encoded is shown in SEQ ID No.2.

[0009] On the second aspect, the present invention provides any one of the following applications of the above-mentioned rice OsATG4b gene: (1) Regulating rice chalkiness traits; specifically involving using the CRISPR / Cas9 system to target and knockout autophagy-related genes in rice OsATG4b , creating rice mutants with a high chalkiness phenotype; at the same time, overexpressing OsATG4b , creating transgenic rice lines with a low chalkiness phenotype, and revealing the OsATG4b regulatory effect on rice chalkiness.

[0010] (2) For improving rice varieties; (3) For preparing transgenic rice.

[0011] Preferably, the rice chalkiness traits include chalkiness degree and chalkiness grain rate.

[0012] On the third aspect, the present invention provides a method for increasing the chalkiness degree and chalkiness grain rate of rice, which includes: using genetic engineering means to knockout the OsATG4b gene in rice.

[0013] Specifically, taking the OsATG4b gene as a target, designing a CRISPR / Cas9-based sgRNA primer sequence, ligating the DNA fragment encoding the sgRNA primer sequence into a vector carrying CRISPR / Cas, transforming rice, and further obtaining OsATG4b transgenic rice with a loss-of-function of the

[0014] Specifically, OsATG4b the target of

[0015] is located in exon 1, and the sequence is shown in SEQ ID No. 3. OsATG4b Specifically, the sgRNA primers include: OsATG4b the gRT1 primer sequence of the gene is shown in SEQ ID NO. 4,

[0016] The fourth aspect of the present invention provides a method for reducing the chalkiness degree and chalky grain rate of rice, which includes: by means of genetic engineering, enhancing OsATG4b in rice.

[0017] Preferably, the enhancing pathway is selected from one or any combination of the following (1)-(5): (1) enhancing by introducing a plasmid with the gene; (2) enhancing by increasing the copy number of the gene on the rice chromosome; (3) enhancing by changing the promoter sequence of the gene on the rice chromosome; (4) enhancing by operably linking a strong promoter to the gene; (5) enhancing by introducing an enhancer.

[0018] The fifth aspect of the present invention provides the application of the transgenic rice obtained by the above method in plant breeding.

[0019] Through the above technical solutions, the present invention achieves the following beneficial effects: The present invention discovers for the first time that the core gene OsATG4b of the autophagy pathway affects the formation of rice chalkiness. By gene editing technology, OsATG4b gene knockout mutants are created, and OsATG4b gene overexpression lines are obtained by transgenic technology to verify that OsATG4b is a new gene regulating rice chalkiness, providing a new gene resource for improving rice quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 is OsATG4b the genotype identification of the osatg4b-1 and osatg4b-2 knockout mutants, where A is the osatg4b-1 and osatg4b-2 target mutation modes of the mutants, and B is the corresponding mutant protein coding sequence of the Figure 2 is osatg4b-1 and osatg4b-2Comparison of the main agronomic traits of mutants, where A - H are heading date, tiller number, seed setting rate, number of grains per panicle, 1000-grain weight, plant height, number of primary branches, and number of secondary branches in sequence; Figure 3 is osatg4b-1 and osatg4b-2 The chalky phenotypes of mutants, where A is the wild type WT, osatg4b-1 and osatg4b-2 The photos of chalky rice of mutants, B is the wild type WT, osatg4b-1 and osatg4b-2 The statistics of chalky rice degree of mutants, C is the wild type WT, osatg4b-1 and osatg4b-2 The statistics of chalky rice grain rate of mutants; Figure 4 is the wild type WT, OsATG4b-OE1 and OsATG4b-OE2 The gene expression analysis of overexpression plants; Figure 5 is the wild type WT, OsATG4b-OE1 and OsATG4b-OE2 The main agronomic traits of overexpression plants, where A - F are tiller number, seed setting rate, grain length, grain width, 1000-grain weight, and plant height in sequence; Figure 6 is the wild type WT, OsATG4b-OE1 and OsATG4b-OE2 The chalky phenotypes of overexpression plants, where A is the wild type WT, OsATG4b-OE1 and OsATG4b-OE2 The photos of chalky rice of overexpression plants, B is the wild type WT, OsATG4b- OE1 and OsATG4b-OE2 The statistics of chalky rice degree of overexpression plants, C is the wild type WT, OsATG4b-OE1 and OsATG4b- OE2 The statistics of chalky rice grain rate of overexpression plants. Detailed implementation manners

[0021] The following details the specific implementation manners of the present invention. It should be understood that the specific implementation manners described herein are only for explaining and interpreting the present invention, and are not used to limit the present invention.

[0022] Example 1 Target gene analysis and sgRNA design 1.1 Gene sequence acquisition: OsATG4b The gene is distributed on chromosome 4 of the rice genome, and the gene number is Os04g0682000 (RAP-DB naming rule), or LOC_Os04g58560 (MSU naming rule). OsATG4bThe nucleotide sequence of the gene coding region is 1437 bp in length, and the sequence is as shown in SEQ ID No. 1. The OsATG4b amino acid sequence encoded by the gene is 479 amino acids in length, and the amino acid sequence is as shown in SEQ ID No. 2. The protein size is approximately 52.5 kDa.

[0023] SEQ ID NO.1: SEQ ID NO.2: MTSLPDRGVSSSSSDPLCEGNIAPCSSSSEQKEDCSLKQSKTSILSCVFNSPFNIFEAHQDSSANKSPKSSSGSYDWSRVLRRIVCSGSMWRFLGTSKVLTSSDVWFLGKCYKLSSEESSSDSDSESGHATFLEDFSSRIWITYRRGFDAISDSKYTSDVNWGCMVRSSQMLVAQALIFHHLGRSWRRPLEKPYNPEYIGILHMFGDSEACAFSIHNLLQAGNSYGLAAGSWVGPYAMCRAWQTLVRTNREQHEVVDGNESFPMALYVVSGDEDGERGGAPVVCIDVAAQLCCDFNKGQSTWSPILLLVPLVLGLDKINPRYIPLLKETFTFPQSLGILGGKPGTSTYIAGVQDDRALYLDPHEVQMAVDIAADNIEADTSSYHCSTVRDLALDLIDPSLAIGFYCRDKDDFDDFCSRATELVDKANGAPLFTVVQSVQPSKQMYNQDDVLGISGDGNINVEDLDASGETGEEEWQIL*。

[0024] Note: * represents the stop codon.

[0025] 1.2 Target selection: Use the CRISPR target prediction website (http: / / crispr.dbcls.jp / ) to screen for targets, ensuring that the targets are located in conserved functional domains and have a low off-target risk. According to the prediction results of the website, select appropriate target sequences. OsATG4b Target 1 is located in exon 1, and the sequence SEQ ID No.3 is, for example, GGAGCCGAGCTGGTCCACGG.

[0026] Example 2 OsATG4b Knockout vector construction and rice transformation 2.1 Primer design: Synthesize sgRNA primers through the CRISPR primer design platform (http: / / skl.scau.edu.cn / primerdesign / vector / ). OsATG4b The primer sequence of gRT1, SEQ ID No.4, is, for example, GAGCCGAGCTGGTCCACGGgttttagagctagaaat. OsATG4bThe primer sequence SEQ ID No.5 of OsU3T1 is as follows: CCGTGGACCAGCTCGGCTCCggcagccaagccagca.

[0027] 2.2 Vector construction: First, perform the first round of PCR amplification. Using the U3 vector as a template respectively, PCR amplification is carried out with OsATG4b-gRT1 and B1' primers to obtain DNA fragment a, and PCR amplification is carried out with OsATG4b-OsU3T1 and B2 primers to obtain DNA fragment b. The PCR amplification reaction system includes the following components: template DNA, 0.2 μM primers, 0.2 mM dNTPs, Taq DNA polymerase, and PCR buffer, etc. The amplification program is as follows: (1) Initial denaturation: 95°C, 5 minutes; (2) Cycle amplification (35 cycles): Denaturation: 95°C, 30 seconds. Annealing: 55°C, 30 seconds. Extension: 72°C, 30 seconds.

[0028] The above PCR products are recovered by agarose gel electrophoresis for DNA fragments. The primer sequence SEQ ID NO.6 of B1' is as follows: TTCAGAggtctcTctcgACTAGTGGAATCGGCAGCAAAGG, and the primer sequence SEQ ID NO.7 of B2 is as follows: AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC.

[0029] Then, perform the second round of PCR amplification. Using the first-round amplification product as a template, mix DNA fragments a and b as a template, and perform PCR amplification with B1' and B2 primers to obtain DNA fragment A. The above PCR product A is recovered by agarose gel electrophoresis for DNA fragments.

[0030] Using the Golden Gate cloning method, DNA fragment A was inserted into the pYLCRISPR / Cas9-MH vector. First, the circular pYLCRISPR / Cas9-MH plasmid vector was digested with BstB1, and the linearized pYLCRISPR / Cas9-MH vector was recovered by agarose gel electrophoresis. Then, DNA fragment A was ligated to the linearized vector using T4 DNA ligase. The above reaction product was transformed into competent Escherichia coli, and positive colonies were screened by kanamycin resistance. Then, single colonies were picked for shaking culture and verified by Sanger sequencing. The sequencing process was as follows: The plasmid to be tested was extracted and sent to a biological company for sequencing. The sequencing results were compared with the expected sequence using the DNAMAN tool. A 100% match in the comparison results indicated successful vector construction. The sequencing primer MH-F sequence SEQ ID NO.8 was, for example, CGGTGTCATCTATGTTACTAG, and the sequencing primer MH-R sequence SEQ ID NO.9 was, for example, CCGACATAGATGCAATAACTTC. Finally, it was confirmed that DNA fragment A was correctly constructed into the pYLCRISPR / Cas9-MH vector.

[0031] 2.3 Rice transformation: Using the japonica rice variety Nipponbare as the recipient, the constructed pYLCRISPR / Cas9-MH vector above was transformed into rice callus by Agrobacterium-mediated method (strain EHA105). Positive transgenic plants were screened using hygromycin (50 mg / L), and finally 20 T0 generation transgenic plants were obtained. The rice transformation was completed by Boyuan Company in Wuhan. The pYLCRISPR / Cas9-MH vector was preliminarily detected by PCR. The experimental procedure was as follows: Leaf DNA was extracted using the CTAB method, and the specific sequence on the vector was amplified by PCR reaction. The PCR reaction system and program were the same as above. The PCR products were detected by agarose gel electrophoresis. The target band was consistent with the expected size, indicating that the plant contained the pYLCRISPR / Cas9-MH vector and was preliminarily determined to be a transgenic positive plant. The detection primer Cas9-F sequence SEQ ID NO.10 was, for example, GTCGCCTACCACGAGAAGTA, and the Cas9-R sequence SEQ ID NO.11 was, for example, GTGAGGTCCTGGTGGTGCTC. It was confirmed that the vector was successfully transferred into the transgenic plants.

[0032] Example 3 OsATG4b Mutant identification and phenotype analysis 3.1 Gene editing detection: Genomic DNA of T0 generation transgenic plants was extracted, and PCR amplification and sequencing were performed using primers near the target site. OsATG4bThe sequencing primers for OsATG4b-F sequence SEQ ID NO.12 are as follows: AGGAGACCCAATTGCGGATG, and the OsATG4b-R sequence SEQ ID NO.13 is as follows: AAGTCGACAAGCACCTGAGC. Through PCR sequencing, the results showed that osatg4b-1 The target site of the mutant contained a 1 bp base insertion ( Figure 1 A), resulting in premature termination at the 76th position ( Figure 1 B). osatg4b-2 The target site of the mutant contained a 2 bp base deletion ( Figure 1 A), resulting in premature termination at the 75th position ( Figure 1 B). The T0 generation transgenic mutants were self-crossed to obtain the T1 generation, and the gene knockout was continuously verified by sequencing OsATG4b to obtain homozygous mutant lines.

[0033] 3.2 OsATG4b Phenotype determination of gene knockout mutants: The wild-type Nipponbare and OsATG4b knockout mutants were planted under field conditions in Yangzhou in summer with normal water and fertilizer management. Observing the agronomic traits, it was found that compared with the wild type, OsATG4b there were no obvious differences in 1000-grain weight, grain shape, plant height, tiller number, etc. of the knockout mutants ( Figure 2 ).

[0034] Furthermore, the seeds of the wild type and OsATG4b knockout mutants were ground into polished rice, and observing the chalky phenotype, it was found that compared with the wild-type Nipponbare, OsATG4b the chalkiness degree and chalky grain rate of the knockout mutants increased extremely significantly, with an increase of up to 50% ( Figure 3 ).

[0035] Example 4 OsATG4b Construction of overexpression vector and rice transformation According to OsATG4b the coding region sequence, primers for the overexpression vector were designed. The OE-F primer sequence SEQ ID NO.14 is as follows: ACGGGGGACGAGCTCGGTACCATGACGAGCTTGCCTGATAGG, and the OE-R primer sequence SEQ ID NO.15 is as follows: ATGGTCTTTGTAGTCTTCGAACTAAAGAATCTGCCATTCCT. PCR amplification OsATG4b the coding region sequence and gel recovery were performed to obtain OsATG4b the DNA fragment. The pCAMBIA1300 vector was digested with Kpn1 and BamH1 enzymes, and the linearized pCAMBIA1300 vector was obtained by gel recovery and purification. Using homologous recombinase, OsATG4bThe gene fragment was homologously recombined into the overexpression vector pCAMBIA1300. The above reaction product was transformed into competent Escherichia coli, and positive colonies were screened by kanamycin resistance. Then, single colonies were picked for shaking culture and verified by Sanger sequencing. Finally, it was confirmed that OsATG4b was correctly constructed onto the pCAMBIA1300 vector.

[0036] Using the japonica rice variety Nipponbare as the recipient, the above constructed pCAMBIA1300 vector was transformed into rice callus by Agrobacterium-mediated method. Positive transgenic plants were screened using hygromycin, and finally 20 T0 generation transgenic plants were obtained. The rice transformation was completed by Boyuan Company in Wuhan.

[0037] Example 5 OsATG4b Identification and phenotypic analysis of overexpression plants 5.1 OsATG4b Detection of gene expression level: RNA was extracted from the leaves of wild-type and transgenic plants and reverse transcribed into cDNA. The sequences of the fluorescence quantitative PCR primers qRT-PCR-F SEQ ID NO.16 were as follows: ATGACGAGCTTGCCTGATAG, and the sequences of qRT-PCR-R SEQ ID NO.17 were as follows: GGCTACAATCCTCCTTCTGT. The results of the qRT-PCR experiment showed that OsATG4b-OE1 and OsATG4b-OE2 the OsATG4b expression level of the overexpression plants was significantly increased compared with that of the wild type ( Figure 4 ).

[0038] 5.2 OsATG4b Phenotypic determination of gene overexpression plants: Wild-type Nipponbare and OsATG4b overexpression plants were planted under field conditions in Yangzhou in summer with normal water and fertilizer management. By observing the agronomic traits, it was found that there were no obvious differences in 1000-grain weight, grain shape, plant height, tiller number, etc. between the gene overexpression plants and the wild type ( OsATG4b ). Figure 5 ).

[0039] Furthermore, the seeds of wild-type and overexpression plants were ground into polished rice, and by observing the chalkiness phenotype, it was found that the chalkiness degree and chalky grain rate of the overexpression plants were extremely significantly reduced compared with those of wild-type Nipponbare ( Figure 6 ), with a reduction amplitude of up to 30%.

[0040] The above research shows that OsATG4b is a new gene regulating chalkiness. Overexpression of this gene can significantly reduce the occurrence of rice chalkiness and plays an important role in improving rice quality.

[0041] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0042] In addition, it should be noted that, in the above specific embodiments, the various specific technical features described can be combined in any appropriate manner without conflict. To avoid unnecessary repetition, the present invention will not separately describe various possible combination methods.

[0043] Furthermore, any combination can be made between various different embodiments of the present invention, as long as it does not violate the idea of the present invention, and it should also be regarded as the content disclosed by the present invention.

Claims

1. A kind of rice OsATG4b gene, characterized in that The nucleotide sequence of its coding region is shown in SEQ ID No. 1, and the encoded amino acid sequence is shown in SEQ ID No.

2.

2. The rice according to claim 1 OsATG4b Any of the following applications of the gene: (1) Regulating the chalkiness trait of rice; (2) For improving rice varieties; (3) For preparing transgenic rice.

3. The application according to claim 2, characterized in that, The rice chalkiness trait includes chalkiness degree and chalky grain rate.

4. A method for improving the chalkiness degree and chalky rice rate of rice, characterized in that, Comprising: By means of genetic engineering, knockout the OsATG4b gene in rice.

5. The method according to claim 4, characterized in that, Using OsATG4b the gene as a target, designing sgRNA primer sequences based on CRISPR / Cas9, ligating the DNA fragment encoding the sgRNA primer sequences into a vector carrying CRISPR / Cas9, transforming rice, and further obtaining OsATG4b transgenic rice with gene function deficiency.

6. The method according to claim 5, wherein OsATG4b The target point is located in exon 1, and the sequence is as shown in SEQ ID No.

6.

7. The method according to claim 5, wherein The sgRNA primers include: OsATG4b The gRT1 primer sequence of the gene is shown in SEQ ID NO.4, OsATG4b The OsU3T1 primer sequence of the gene is shown in SEQ ID NO.

5.

8. Method for reducing chalkiness degree and chalky grain rate of rice, characterized in that, Comprising: By means of genetic engineering, enhance the OsATG4b gene in rice.

9. The method according to claim 8, characterized in that The enhanced pathway is selected from one or any optional combination of the following (1)-(5): (1) Enhanced by introducing a plasmid with the said gene; (2) Enhanced by increasing the copy number of the said gene on the rice chromosome; (3) Enhanced by changing the promoter sequence of the said gene on the rice chromosome; (4) Enhanced by operably linking a strong promoter to the said gene; (5) Enhanced by introducing an enhancer.

10. Use of the transgenic rice obtained by the method according to any one of claims 4 to 9 in plant breeding.

Citation Information

Patent Citations

  • Transcription factor Osmyb4 for regulating and controlling rice yield quality character and application of transcription factor Osmyb4

    CN118108820A

  • Application of OsATG8b gene and encoded protein thereof in regulation and control of plant virus resistance of rice

    CN119119224A

  • Application of multidrug resistance efflux transporter gene OsMRET1 in regulation and control of chalkiness character of rice

    CN120843537A