Pseudo-ginseng MYB transcription factor gene PnMYB8 and application thereof
By cloning the MYB transcription factor gene PnMYB8 of Panax notoginseng and overexpressing it in tobacco, the breeding problem of Panax notoginseng anti-fungal diseases was solved, efficient and environmentally friendly fungal disease prevention and control was achieved, and the development of resistant plant varieties was promoted.
Patent Information
- Application Number
- CN202510658855.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-21
- Publication Date
- 2025-07-08
AI Technical Summary
The prior art lacks efficient and stable varieties that are anti-fungal diseases in Panax notoginseng. Traditional breeding cycles are long and the use of chemical agents leads to environmental pollution and food safety problems, making it difficult to effectively control fungal diseases.
The MYB transcription factor gene PnMYB8 was obtained from Panax notoginseng and introduced it into tobacco with genetic engineering technology overexpression, which enhanced the resistance of tobacco to Columnsporidium, Fusarium brilliensis, Fusarium thirst and Tarium thorny.
Shorten the breeding cycle, simplify operations, obtain new tobacco varieties with high antifungal diseases, reduce the use of chemical pesticides, reduce the risk of environmental pollution, and provide broad market application prospects.
Smart Images

Figure CN120272497A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical fields related to molecular biology and genetic engineering, and particularly relates to a Panax notoginseng MYB transcription factor gene with the ability to resist fungal infection PnMYB8 and its application. Background Art
[0002] The infection of pathogenic bacteria has a serious impact on the growth and development of plants. Plant diseases can occur throughout the plant production chain and are one of the greatest threats to social sustainable development. Among them, fungal diseases are the most numerous type of plant diseases, accounting for about 80%-90% of the disease types. The traditional methods for controlling plant diseases mainly include using chemical agents, improving cultivation management measures, and breeding new resistant varieties. Although these methods have achieved certain results, the traditional breeding cycle is relatively long, the cultivation measures have poor effects, and chemical agents are prone to cause environmental pollution and food safety problems, and still cannot completely solve the disease problem.
[0003] Transcription factors play an important role in regulating the expression of plant functional genes (Hrmova M, Hussain SS. Plant transcription factors involved in drought and associated stresses. International of Journal Molecular Sciences, 2021, 22 (11): 5662). MYB is one of the largest transcription factor families in plants and is widely involved in plant growth and development, biological and abiotic stress responses, and the synthesis of secondary metabolites (Li P, Xia E, Fu J, et al. Diverse roles of MYB transcription factors in regulating secondary metabolite biosynthesis, shoot development, and stress responses in tea plants ( Camellia sinensis). The Plant Journal, 2022, 110 (4): 1144 - 1165). MYB transcription factors are divided into four types according to the different numbers of R conserved domains composed of 52 amino acid residues in their structures: 1R - MYB, R2R3 - MYB, 3R - MYB, and 4R - MYB (Dubos C, Stracke R, Grotewold E, et al. MYB transcription factors in Arabidopsis. Trends in Plant Science, 2010, 15 (10): 573 - 581). Among them, R2R3 - MYB transcription factors are the most widely studied transcription factors so far and have been identified in many plant species. A total of 103 members of the R2R3 - MYB gene family have been identified in quinoa (Ding P, Tang P, Li X, et al. Genome - wide identification, phylogeny and expression analysis of the R2R3-MYB gene family in quinoa ( Chenopodium quinoa ) under abiotic stress. Functional Plant Biology, 2024, 51: FP23261); 122 members of the R2R3 - MYB gene family have been identified in pear trees (Li Y, Zhang J, Wang S, et al. Genome - wide identification of the Pyrus R2R3 - MYB gene family and PhMYB62 regulation analysis in Pyrus hopeiensis flowers at low temperature. International Journal of Biological Macromolecules, 2024, 257 (Pt 2): 128611). Members of the MYB family, especially the R2R3 - MYB subgroup in Arabidopsis, are related to disease resistance (Li Y, Lv Y, Wei X. The MYB transcription factor TaMYB30enhances wheat resistanceto sharp eyespot disease by scavenging ROS accumulation. Plant PhysiologyBiochemistry, 2025, 221: 109648).
[0004] Transcription factors play crucial roles in regulating stress response networks during plant - plant pathogen interactions and are candidate genes for enhancing crop stress resistance using genetic engineering techniques (Liu F, Xie M, Liu T, et al. The central role of transcription factors in bridging biotic and abioticstress responses for plants’ resilience. New crops, 2024, 100005). In rice, OsMYB30 、 OsMYB55 and OsMYB110 can enhance resistance to Magnaporthe oryzae and Xanthomonas oryzae pv. oryzae (Li W, Wang K,Chern M, et al. Sclerenchyma cell thickening through enhanced lignificationinduced by OsMYB30 prevents fungal penetration of rice leaves. NewPhytologist, 2020, 226 (6): 1850 - 1863; Kishi - Kaboshi M, Seo S, Takahashi A,et al. The MAMP - responsive MYB transcription factors MYB30, MYB55 and MYB110activate the HCAA synthesis pathway and enhance immunity in rice. Plant andCell Physiology, 2018, 59 (5): 903 - 915). MdMYB54 directly binds to the promoters of MdCesA6 、 MdPLL8 and MdPLL12 and activates the expression of these genes; after inoculation with Fusarium solani, apple MdMYB54The cellulose content and pectin lyase activity in the roots of overexpressing plants were significantly increased; the deposition of cellulose enhanced the physical barrier of the plant cell wall, while the activation of pectin lyase promoted the formation of oligogalacturonides (OGs) and the production of reactive oxygen species; the direct interaction between MdMYB54 and MdERF114 conferred resistance to Fusarium solani on apple plants ( Liu Q, Chen X, Li S, et al. MdMYB54 reduces disease severity caused by Fusarium solani in apple by modulating cell wall cellulose and pectate lyase-dependent defense. Plant Journal. 2025, 121 (2): e17206 ).
[0005] Panax notoginseng Panax notoginseng (Burk.) F.H. Chen] is a perennial herb of the Araliaceae family ( Araliaceae) the genus Panax ( Panax ), a traditional precious medicinal material in China, with the effects of promoting blood circulation to remove blood stasis, anti-inflammatory and analgesic (Xie W, Meng X, Zhai Y, et al. Panax Notoginseng saponins: A review of its mechanisms of antidepressant or anxiolytic effects and network analysis on phytochemistry and pharmacology. Molecules, 2018, 23 (4)). The growth cycle of Panax notoginseng is long, and it needs to be cultivated under a shading net. The warm and humid environment is prone to induce the occurrence of various diseases. Especially the root rot caused by fungal diseases such as Fusarium solani ( Fusarium solani ), which seriously reduces the yield and quality of Panax notoginseng medicinal materials (Fan ZY, Miao CP, Qiao XG, et al. Diversity, distribution, and antagonistic activities of rhizobacteria of Panax notoginseng . Journal Of Ginseng Research, 2016, 40(2): 97-104). However, there is a lack of Panax notoginseng varieties with high and stable disease resistance in production. Summary of the Invention
[0006] The present invention provides a Panax notoginseng MYB transcription factor gene PnMYB8 and its application in improving the resistance of tobacco to Cylindrocladium destructans ( Cylindrocarpon destructans ), Fusarium lateritium ( Fusarium lateritium ), Fusarium equiseti ( Fusarium equiseti ), and Phoma herbarum ( Phoma herbarum ).
[0007] The transcription factor gene was cloned from Panax notoginseng in the present invention PnMYB8 , PnMYB8 and its nucleotide sequence is shown as SEQ ID NO:1. The open reading frame of this gene is 576bp, encoding a protein with the amino acid sequence shown as SEQ ID NO:2
[0008] The present invention isolated and cloned the complete cDNA fragment of the transcription factor gene of Panax notoginseng PnMYB8 , and transferred the target gene into the receptor plant through the mediation of Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) for overexpression. Through further experiments, it was verified whether this gene has the activity of improving plant antifungal ability, laying a foundation for later using this gene to improve the ability of tobacco and other plants to resist fungal diseases. The inventor named this gene PnMYB8 .
[0009] The above PnMYB8 gene was applied to improve the resistance of tobacco to Cylindrocladium destructans, Fusarium lateritium, Fusarium equiseti and Phoma herbarum, and the specific operation is as follows: (1) Specific primers for amplifying PnMYB8 were used to extract total RNA from the roots of Panax notoginseng, and the coding region of PnMYB8 was amplified by reverse transcription-polymerase chain reaction (RT-PCR), and then it was ligated to the pGEM-T vector. After sequencing, a clone with the target gene was obtained (2) The pGEM-T- Eco RI and Bam HI were used to digest the pGEM-T- PnMYB8 vector, and the target gene fragment was obtained by gel recovery. The plant expression vector pCAMBIA2300S was digested with the same restriction enzymes, and the large fragment of the required vector was obtained by gel recovery. Then the obtained PnMYB8 gene fragment was ligated to the pCAMBIA2300S fragment to construct a plant overexpression vector, and then the constructed recombinant vector was transferred into tobacco for expression through the mediation of Agrobacterium tumefaciens (3) The transformants were screened with the resistance marker on the recombinant vector T-DNA, and the true transgenic plants were obtained by PCR detection. The ability of the transgenic plants to resist fungal infection was analyzed, and finally the transgenic plants with significantly enhanced fungal resistance were screened out
[0010] The present invention provides a new method for improving the resistance of plants to fungal diseases. Cultivating disease-resistant plants by genetic engineering means can overcome the deficiencies of traditional breeding. Not only the breeding cycle is shortened, but also the operation is simple and it is easy to obtain highly resistant materials. The PnMYB8The gene can enhance the resistance of plants to fungi such as *Cylindrocladium destruens*, *Fusarium lateritium*, *Fusarium equiseti* and *Phoma herbarum*. Introducing this gene into tobacco can produce new varieties and new materials with fungal resistance. Cultivating resistant plant varieties and materials using genetic engineering technology has obvious advantages and irreplaceable importance; it can not only facilitate the large-scale production of crops, medicinal materials, horticultural plants, etc., significantly reduce the use of chemical pesticides, but also save costs for agricultural production and reduce environmental pollution. Therefore, the present invention has broad market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0011] Figure 1 is the present invention PnMYB8 PCR detection result diagram of the transgenic tobacco genomic DNA. In the figure, Marker is DL2000 DNA Marker (Takara Bio Inc. (Dalian), China), which consists of five DNA fragments of 2,000 bp, 1,000 bp, 750 bp, 500 bp and 250 bp; the positive control is the PCR product using plasmid pGEM-T- PnMYB8 as the template; the negative control is the PCR product using sterile water as the template; WT is the PCR product using the total DNA of non-transgenic tobacco (wild type) as the template; Figure 2 is part of the positive PnMYB8 in the transgenic tobacco PnMYB8 expression analysis result diagram at the transcriptional level. Among them, WT is non-transgenic tobacco (wild type), and 8-2, 8-3, 8-7, 8-9, 8-10, 8-11, 8-13, 8-14, 8-15, 8-16, 8-17, 8-20 are PnMYB8 transgenic tobacco; Figure 3 is the present invention PnMYB8 result diagram of the disease resistance identification of transgenic tobacco plants. Figure a is the tobacco leaf inoculated with *Cylindrocladium destruens*; Figure b is the tobacco leaf inoculated with *Fusarium lateritium*; Figure c is the tobacco leaf inoculated with *Fusarium equiseti*; Figure d is the tobacco leaf inoculated with *Phoma herbarum*; among them, WT is the wild type tobacco plant; 8-7, 8-11, 8-14 are respectively PnMYB8 transgenic tobacco lines. DETAILED DESCRIPTION OF THE INVENTION
[0012] The present invention will be further described in detail below with reference to the drawings and examples. However, the protection scope of the present invention is not limited to the content described. In the examples, the methods are conventional methods unless otherwise specified, and the reagents used are conventional commercially available reagents or reagents prepared according to conventional methods unless otherwise specified.
[0013] Example 1: PnMYB8 Gene cloning and sequence analysis The Panax notoginseng roots inoculated with Fusarium solani for 12 h were ground into powder with liquid nitrogen, then transferred into centrifuge tubes, and total RNA was extracted by the guanidine isothiocyanate method. Go Script TM Reverse Transcriptase System was used to synthesize the first strand of cDNA using total RNA as the template. The reaction system and operation process were as follows: Take 5 μg of total RNA, and sequentially add 1 μL of Oligo dT15primer and 1 μL of Random primer, and make up the reaction volume to 10 μL with Nuclease-Free Water; mix well, heat and denature at 70°C for 5 min, then quickly cool on ice for 5 min, and then sequentially add 4 μL of 5×Reaction Buffer, 4 μL of MgCl2 (25 mM), 1 μL of PCR Nucleotide Mix, 0.4 μL of Recombinant RNasin® Ribonuclease Inhibitor, 0.4 μL of Reverse Transcriptase, and 1.2 μL of Nuclease-Free Water, mix well and briefly centrifuge, let stand at 25°C for 5 min, incubate at 42°C for 1.5 h, take out and heat at 70°C for 10 min to terminate the reaction; after the synthesis of the first strand of cDNA, store it at -20°C for standby.
[0014] Using the synthesized first strand of cDNA as the template, the target gene was amplified PnMYB8 , and the upstream and downstream primer sequences used were 5’ATGACAGCCCATGAAGAACGCA3’ and 5’GCCAGTTAAAAACGCGCTCTCTT3’ respectively. The target gene was amplified using TAKARA Ex Taq®. The PCR reaction conditions were 94°C for 5 min, 94°C for 30 s, 61°C for 30 s, 72°C for 40 s (32 cycles), and 72°C for 5 min; the reaction system (50 μL) was 2 μL of cDNA, 5 μL of 10×Ex Taq Buffer (containing Mg 2+ 20 mM), 4 μL of dNTP Mix (2.5 mM each), 1 μL of upstream primer (5 μM), 1 μL of downstream primer (5 μM), 0.25 μL of TaKaRa Ex Taq (5 U / μL), and 36.75 μL of ddH2O. After PCR, take 8 μL for 1.2% agarose gel electrophoresis to detect the specificity and size of the amplification product.
[0015] The obtained PCR product had only one DNA band. The PCR amplification product was recovered by cutting the gel using the SanPrep Column PCR Product Purification Kit (Sangon Biotech, Shanghai). TA cloning was performed, and the reagent used was pGEM-T Vector System Ⅰ (TaKaRa). The reaction system and operation process were as follows: Take 4 μL of the PCR product, and successively add 0.7 μL of pGEM-T vector, 0.9 μL of T4 DNA Ligase, and 5 μL of 2×Rapid Ligation Buffer. After mixing, place it at 4°C for overnight reaction. The ligation product was transformed into Escherichia coli DH5α by heat shock transformation. Positive clones were screened using LB solid medium containing ampicillin (Amp), and several single colonies were selected. After shaking the bacteria, amplification PnMYB8 with specific primers identified the clones into which PnMYB8 was inserted. The identified clones were sequenced, and the finally obtained PnMYB8 full-length cDNA was 576 bp, encoding a protein containing 191 amino acids, with a molecular weight of approximately 21.95 kDa and an isoelectric point of approximately 5.40. Using the bioinformatics software SignalP 4.1 to analyze PnMYB8 the encoded protein sequence to detect whether it has a signal peptide, the result showed that gene PnMYB8 had no signal peptide, and subcellular localization prediction showed that it was localized in the nucleus.
[0016] Example 2: Construction of plant overexpression vector The pGEM-T- PnMYB8 and the plant expression vector pCAMBIA2300S plasmid were extracted using the SanPrep Column Plasmid DNA Mini-Preps Kit (Sangon Biotech Co., Ltd., China). Take 1 μL for agarose gel electrophoresis to detect the integrity and concentration of the extracted plasmid. Use the restriction endonucleases Eco RI (TaKaRa, Japan) and Bam HI (TaKaRa, Japan) to perform double digestion on the plasmids pGEM-T- PnMYB8 and pCAMBIA2300S (50 μL system). The reaction system and operation process were as follows: Take 20 μL of pGEM-T- PnMYB8 and pCAMBIA2300S plasmids, and successively add 7.5 μL of 10×Kbuffer, 2.5 μL of Eco RI, 2.5 μL of Bam HI, and 17.5 μL of ddH2O. After mixing, centrifuge briefly and place it at 37°C for enzyme digestion for 3 h. Dot all the enzyme digestion products on an agarose gel for electrophoresis, and then for PnMYB8The fragments and the large fragment of the pCAMBIA2300S vector were respectively recovered by gel extraction, and the whole process used the SanPrep Column DNA Gel Extraction Kit (Sangon Biotech (Shanghai) Co., Ltd., China). Take 1 μL of the recovered product and detect the size and concentration of the recovered fragment by agarose gel electrophoresis, and store it at -20 °C for future use.
[0017] Using T4 DNA Ligase (TaKaRa, Japan), the recovered PnMYB8 DNA fragments and pCAMBIA2300S vector fragments were ligated. The reaction system (20 μL) and operation process were as follows: Take 10 μL PnMYB8 DNA fragments and sequentially add 2 μL of pCAMBIA2300S vector DNA, 2 μL of 10×T4 DNA Ligase Buffer, 1 μL of T4 DNA Ligase, and 5 μL of ddH2O. After mixing, centrifuge briefly, and then react overnight in a water bath at 16 °C. Then, the ligation product was transferred into Escherichia coli DH5α by heat shock transformation, and positive clones were screened using solid medium containing 50 mg / L kanamycin (Km). Pick single colonies and shake the bacteria. Use the bacterial solution as a template for PCR with specific primers for amplification PnMYB8 and select PnMYB8 the clones that were successfully ligated with pCAMBIA2300S. If the detected strain is positive, add glycerol and store it at -80 °C for future use.
[0018] Extract and purify the pCAMBIA2300S- PnMYB8 plasmid in the above Escherichia coli. Subsequently, the constructed plant expression vector pCAMBIA2300S- PnMYB8 was transferred into competent cells of Agrobacterium tumefaciens LBA4404 by the freeze-thaw method. The operation steps were as follows: Take 2 μg of pCAMBIA2300S- PnMYB8 plasmid and add it to a centrifuge tube containing 100 μL of competent cells. Gently mix and incubate on ice for 5 min, then transfer it to liquid nitrogen for freezing for 5 min, then quickly place it in a water bath at 37 °C for 5 min, and then immediately incubate on ice for 5 min. Add 800 μL of LB liquid medium and culture it with shaking at 28 °C for 2 - 3 h. Spread the activated Agrobacterium on LB solid medium containing 50 mg / L Km and incubate it statically at 28 °C. Pick single colonies and shake the bacteria, and then perform PCR with specific primers for amplification PnMYB8 to detect whether pCAMBIA2300S- PnMYB8 was transferred into Agrobacterium. For positive clones, add glycerol and store it at -80 °C for future use.
[0019] Example 3: Agrobacterium-mediated Genetic Transformation of Tobacco and Screening of Transgenic Tobacco Soak tobacco seeds in 75% alcohol for 30 s, wash with sterile water, then soak in 0.1% HgCl2 for 8 min, and then wash with sterile water several times. Sow the seeds on 1 / 2 MS medium and incubate in the dark at 28°C for 6 d. After germination, transfer to a light incubator (25°C, 16 h / d light, 8 h / d dark), and subculture with 1 / 2 MS medium once a month thereafter.
[0020] Take out the Agrobacterium tumefaciens strain LBA4404 containing the pCAMBIA2300S- PnMYB8 plasmid stored in a -80°C refrigerator, inoculate it into 5 mL of LB liquid medium containing 50 mg / L Km and 20 mg / L rifampicin, and culture at 28°C until the medium becomes turbid. Pipette 1 mL of the turbid bacterial solution onto an LB solid medium containing 50 mg / L Km and culture at 28°C for 48 h; then scrape an appropriate amount of the Agrobacterium tumefaciens on the LB solid medium and inoculate it into MGL liquid medium supplemented with 20 mg / L acetosyringone, and shake-culture at 28°C for 2 - 3 h to activate the Agrobacterium tumefaciens.
[0021] Cut the leaves of tobacco sterile seedlings into leaf discs about 1 cm 2 in size, soak them completely in the above-mentioned MGL liquid medium containing activated Agrobacterium tumefaciens for 15 min, blot the bacterial solution on the leaf surface with sterile filter paper, and place the leaf discs on the co-culture medium for incubation at room temperature. The co-culture medium for tobacco transformation is MS + 0.02 mg / L 6-BA + 2.1 mg / L NAA + 30 g / L sucrose + 6 g / L agar, and incubate in the dark at 22°C for 2 days.
[0022] Transfer the co-cultured leaf discs to an MS screening medium supplemented with antibiotics to differentiate into seedlings and simultaneously screen for transgenic plants. The tobacco screening medium is MS + 0.5 mg / L 6-BA + 0.1 mg / L NAA + 30 g / L sucrose + 6 g / L agar + 50 mg / L Km + 200 mg / L cefotaxime sodium salt (Cef); during screening culture, transfer the culture bottles to a light incubator for culture (25°C, 16 h / d light, 8 h / d dark). After the tobacco sprouts, subculture with an MS medium containing 50 mg / L Km and 200 mg / L Cef. Transfer the regenerated tobacco seedlings to an MS medium containing 50 mg / L Km to allow them to root, and finally select the regenerated seedlings with better rooting for PCR detection.
[0023] The genomic DNA of the leaves of transgenic tobacco plants was extracted by the CTAB method. 1 μL of the extracted genomic DNA was taken and detected for its integrity and concentration by agarose gel electrophoresis. Using the genomic DNA of transgenic plants as a template, PCR was carried out with specific primers for amplification PnMYB8 After the PCR was completed, 8 μL of the product was taken for agarose gel electrophoresis to detect positive transgenic plants. The amplification results of some tobacco transgenic plants are as Figure 1 shown, and a total of 20 positive transgenic plants were screened
[0024] Example 4: PnMYB8 Expression analysis in transgenic tobacco Total RNA was extracted from the young leaves of positive transgenic plants and non-transgenic tobacco (wild type) respectively, and the first strand of cDNA was reverse transcribed. Using this as a template, real-time fluorescence quantitative PCR (qPCR) was carried out with specific primers for amplification PnMYB8 According to the qPCR results, the expression levels of PnMYB8 at the transcriptional level in each transgenic plant were analyzed; the methods for total RNA extraction and reverse transcription were the same as those in Example 1; the qPCR system was 1.0 μL of cDNA, 10 μL of 2×Go Taq® qPCR Master Mix, 0.2 μL of CXR Reference Dye, 7.6 μL of RNase-Free ddH2O, 0.6 µL of Primer QF (10 mM), and 0.6 µL of Primer QR (10 mM). The qPCR reaction was carried out using the following parameters: 95°C for 2 min; 95°C for 5 s; 60°C for 30 s (40 cycles). The qPCR reaction for each sample was repeated three times, PnMYB8 The expression level of -ΔΔCt was calculated by the 2 Figure 2 method, and the detection results of some individual plants are as
[0025] Example 5: PnMYB8 Functional analysis of transgenic tobacco plants against fungal infection Cylindrocladium destructans, Fusarium lateritium, Fusarium equiseti, and Phoma herbarum preserved in the laboratory were inoculated on PDA solid medium (200 g / L potato / carrot, 15 g / L agar, 20 g / L glucose) and cultured in the dark at 28°C for 7 days. The wild type tobacco (WT) and PnMYB8 the three transgenic tobacco plants with the highest PnMYB8 expression levels (8-7, 8-11, 8-14) were respectively inoculated with the spore suspension of Cylindrocladium destructans, Fusarium lateritium, Fusarium equiseti, and Phoma herbarum. After 7 days, the disease incidence of wild type tobacco (WT) andFigure 3 As shown, 7 days after inoculating with the spore suspensions of several pathogenic bacteria, the roots of wild-type tobacco showed obvious blackening, began to rot and soften, and the leaves also began to wither and turn black. While PnMYB8 for transgenic tobacco, the roots turned slightly yellow, but the leaves still showed a healthy green state. Obviously, PnMYB8 transgenic tobacco has obvious resistance to *Cylindrocladium destruens*, *Fusarium lateritium*, *Fusarium equiseti* and *Phoma herbarum*.
Claims
1. A Panax notoginseng MYB transcription factor gene PnMYB8 , characterized in that: Its nucleotide sequence is shown in SEQ ID NO:
1.
2. The Notoginseng MYB transcription factor gene according to claim 1 PnMYB8 in enhancing the resistance of tobacco to Cylindrocarpon destructans Cylindrocladium destructans Fusarium lateritium Fusarium lateritium Fusarium equiseti Fusarium equiseti Phoma herbarum and Phoma herbarum
Citation Information
Cited By
Panax notoginseng bHLH transcription factor gene PnbHLH2 and application thereof
CN120366334A
Panax notoginseng bHLH transcription factor gene PnbHLH2 and application thereof
CN120366334B