MRNA of FASN gene and application thereof

Abstract

The invention belongs to the technical field of mRNA vaccines, and particularly provides mRNA of an FASN gene and application of the mRNA. The sequence of the FASN gene is shown as SEQ ID No.1, a 3-O-Me-GAG cap structure is added to the 5'end of mRNA of the optimized FASN gene, a polyadenylic acid polyA tail structure is added to the 3 'end of mRNA of the optimized FASN gene, and all U basic groups in the mRNA sequence are replaced with pseudouracil psi-UTP. After codon optimization is carried out on mRNA of the FASN gene, in-vitro modification and synthesis are carried out, the in-vitro synthesized mRNA which is high in synthesis efficiency, high in translation efficiency, accurate in translation and good in stability is obtained, the in-vitro synthesized mRNA can be applied to modeling, the modeling period is shortened, the modeling cost is reduced, a new tool is provided for research of metabolism-related diseases, and the in-vitro synthesized mRNA has good application prospects. And the biomedical research with low cost and high safety is realized.

Description

[0001] Cross-reference

[0002] This application claims priority to Chinese Patent Application No. CN202410489473.6, filed on April 23, 2024, the entire content of which is incorporated herein by reference. Technical Field

[0003] The present invention belongs to the technical field of mRNA vaccines, and particularly relates to an mRNA of the FASN gene and its applications. Background Art

[0004] In recent years, the rapid progress of biotechnology has propelled mRNA vaccine technology to become an innovative means for preventing and treating various diseases. This technology precisely designs mRNA sequences to guide host cells to produce specific proteins with biological functions, thereby triggering a series of immune responses or achieving therapeutic effects. Especially in the face of current global health challenges, the value of mRNA technology has been widely recognized.

[0005] Fatty acid synthase (FASN), as a key enzyme, plays an indispensable role in the process of fatty acid synthesis and is crucial for maintaining cell function and energy balance. In scientific research, overexpression of the FASN gene can lead to fat accumulation, providing an important model for studying obesity, diabetes, and other metabolic diseases. However, traditional gene overexpression methods, especially gene transduction techniques relying on viral vectors, face multiple challenges such as safety hazards, low efficiency, and high costs. Especially when it comes to a gene like FASN with a relatively long base sequence, the packaging and transmission of viral vectors become particularly difficult, not only with complex technical implementation but also huge economic costs.

[0006] Compared with traditional methods, animal models, especially mouse models created through gene editing technology, although provide a way for FASN overexpression, this process is not only time-consuming but also costly. Therefore, it has become particularly urgent to develop a new, efficient, and cost-effective method for FASN overexpression. Summary of the Invention

[0007] In view of this, the purpose of the present invention is to provide an mRNA of the FASN gene and its application. After codon optimization of the mRNA of the FASN gene, in vitro modification and synthesis are carried out to obtain an in vitro synthesized mRNA with high synthesis efficiency, high translation efficiency, accurate translation and good stability, which can achieve effective overexpression of the FASN gene in vivo and in vitro. It can not only simplify the establishment of the fat deposition model, but also significantly reduce the experimental cost and the overall cost. The development of this method provides a new tool for the research of metabolism-related diseases, enabling researchers to conduct important biomedical research at lower cost and higher safety. Through this innovative technology, the biological function of FASN and its role in various metabolic diseases can be explored more effectively, thus promoting scientific progress and medical innovation in related fields.

[0008] The present invention provides an optimized FASN gene, and the sequence of the optimized FASN gene is shown in SEQ ID No.1.

[0009] The present invention also provides an mRNA synthesized in vitro from the optimized FASN gene. A 3-O-Me-GAG cap structure is added to the 5' end of the mRNA, and a polyadenylate polyA tail structure is added to the 3' end. All U bases in the mRNA sequence are replaced with pseudouridine ψ-UTP.

[0010] The present invention provides a recombinant plasmid expressing the optimized FASN gene, including an initial plasmid and the optimized FASN gene.

[0011] Preferably, the initial plasmid is the PUC57 blunt-end vector.

[0012] The present invention also provides an mRNA delivery system for the FASN gene. The mRNA is encapsulated with liposomes, and the encapsulation concentration of the mRNA is 50-200 μg / mL.

[0013] Preferably, the liposome is the SM-102 liposome.

[0014] The present invention also provides an mRNA vaccine composition, which includes the mRNA, the recombinant plasmid or the mRNA delivery system.

[0015] The present invention provides the application of the mRNA, the recombinant plasmid or the mRNA delivery system in the preparation of a model for metabolism-related fatty liver disease.

[0016] Preferably, the model is an animal model or a cell model.

[0017] Preferably, the model is a fat deposition model.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention provides an optimized FASN gene, which simultaneously increases synonymous codon replacement, eliminates potential slippery sequences, and avoids ribosome frameshifting during the translation process; two repeated stop codons TGA are set at the C-terminus of the FASN gene, and two other stop codons TAATAG are added thereafter to ensure effective termination.

[0020] The optimized FASN gene in vitro synthesized mRNA provided by the present invention realizes in vitro synthesis of long fragments by adding a 3-O-Me-GAG cap structure to the 5' end, adding a polyadenylic acid polyA tail structure to the 3' end, and performing pseudouracil ψ-UTP modification, and has high synthesis efficiency and good stability; the pseudouracil ψ-UTP modification can enhance the accuracy of translation and reduce the immunogenicity of host cells; while the commonly used methyl pseudouracil modification can increase the misreading of the termination codon of eukaryotic mRNA and may affect the misreading of prokaryotic mRNA translation.

[0021] In view of the limitations of the prior art, the mRNA of the FASN gene proposed in the present invention utilizes the mRNA vaccine technology to safely and efficiently overexpress the FASN gene in vivo or in vitro, thereby promoting fat deposition; it has the following advantages: high safety, avoiding the use of viral vectors, reducing the risk of infection and immune rejection. High efficiency: mRNA directly mediates protein expression, avoiding the multi-step conversion process from DNA to mRNA and then to protein, and improving the expression efficiency. Low cost: The synthesis and purification process of mRNA is relatively simple, reducing the production cost. Wide application: The mRNA can not only be used to make fat deposition models, but can also be expanded to other fields, such as studying various metabolic diseases, drug screening, and cell function research. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Schematic diagram of the structure of the optimized in vitro synthesized mRNA of the FASN gene;

[0023] Figure 2 It is the CE peak diagram of FASN-mRNA vaccine;

[0024] Figure 3 This is the FLAG-TAG immunofluorescence staining of C3A cells under a confocal microscope. Red indicates positive results, and blue indicates the nuclei of dead cells stained with DAPI.

[0025] Figure 4 The results of oil red staining of the liver of mice fed a high-sugar diet after vaccine treatment. The left picture is the control group, and the right picture is the experimental group;

[0026] Figure 5It is the result of Sudan red O staining of the pathological section of the liver of a mouse after using the FASN-mRNA vaccine. Specific implementation mode

[0027] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they cannot be understood as limiting the protection scope of the present invention.

[0028] Example 1 Obtaining of the optimized FASN gene

[0029] First, obtain and analyze the full-length transcript amino acid sequence of the FASN gene (NCBI Reference Sequence: NP_004095.4) on NCBI, optimize the FASN gene sequence according to the amino acid sequence (e.coli system optimization strategy), and increase the synonymous codon substitution; then perform sequence modification to obtain the optimized FASN gene, and the specific sequence is shown in SEQ ID No.1.

[0030] In SEQ ID NO.1:

[0031] actcagagagaacccgccacc Is Geneious type: Editing History Insertion;

[0032] atg is the start codon;

[0033] gaggaggtggtgatcgccggcatg……tgagagagggc is the CDS sequence (NP_004095.4) of the fatty acid synthase gene;

[0034] ggggggagcgggggg is the fusion protein linker GS linker;

[0035] gactacaaggacgacgacgacaaa is the FLAG tag protein Flag-tag;

[0036] tgatga is a double stop codon;

[0037] ctcgagctggtactgcatgc is Geneious type: Editing History Insertion.

[0038] Technical route for in vitro synthesis of mRNA (the in vitro synthesis of mRNA was commissioned to Beijing Aoke Dingsheng Biotechnology Co., Ltd.):

[0039] The optimized FASN gene was ligated with the PUC57 blunt-end vector (Ouke Biotech (Wuhan) - V002) to obtain a recombinant plasmid; mRNA (SEQ ID No.1) was synthesized by in vitro transcription. A 5'-terminal 3-O-Me-GAG cap structure was incorporated into the mRNA sequence (capping the mRNA by co-transcription to form a Cap1 structure), and a polyadenylate polyA tail structure with 29 + 80 (with a 10-nt linker in the middle) was added to the 3'-end (Poly(A) polymerase-catalyzed tailing method). Then, the DNA template was digested with DNase enzyme, and at the same time, a pseudouridine (ψ-UTP) optimization modification scheme was performed for all U bases corresponding in the mRNA sequence.

[0040] The purpose of the above optimization design is as follows: The 5'-terminal 3-O-Me-GAG cap structure can improve the translation efficiency; setting the 3'-terminal polyadenylate polyA tail structure can produce mature mRNA, making the mRNA more stable and improving the translation initiation efficiency of mRNA; ψ-UTP modification can reduce the immunogenicity of host cells, reduce innate immune stimulation, and enhance stability; DNase enzyme treatment can degrade the DNA template well and eliminate interference.

[0041] After in vitro synthesis, RNA purification was carried out, and then RNA purity and concentration were detected; The CE peak map is as Figure 2 shown.

[0042] Detection results of the mRNA stock solution:

[0043] Sample submitted for inspection: FASN-mRNA

[0044] Product batch number: G231070-1

[0045] Submission date: 2024.01.10

[0046] Sampling volume: 20 μL

[0047] Table 1 Detection results of the mRNA stock solution

[0048] Item Method Result mRNA concentration Ultraviolet spectrophotometry 1.062 mg / ml Purity (A260 / A280) Ultraviolet spectrophotometry 1.971 Purity (A260 / A230) Ultraviolet spectrophotometry 2.032 mRNA purity and integrity CE 87.3％

[0049] Example 2

[0050] LNP: SM-102 (SM-102 is an amino cationic lipid with higher transfection efficiency. SM-102 plays an important role in the effectiveness of lipid nanoparticles in delivering mRNA therapeutic drugs and vaccines).

[0051] The mRNA synthesized in Example 1 was encapsulated with liposome SM-102, and the encapsulation concentration of mRNA was 100 μg / mL.

[0052] Detection results of the encapsulated preparation:

[0053] Submitted product: SM102-FASN-mRNA, product lot number: G231070-1

[0054] Submission date: 2024.01.26

[0055] Table 2 Detection results of encapsulated preparations

[0056] Item Method Result LNP particle size DLS 106 nm PDI DLS 0.13 Zata potential DLS 13.4 RNA content Ribogreen method 100 ng / ul Encapsulation efficiency Ribogreen method 96％

[0057] Experimental example 3 Study on the activity of FASN-mRNA in human liver cells C3A

[0058] Add 100 nmol / ml of FASN-mRNA vaccine with flag-tag label (mix 0.5 ml of mRNA-liposome encapsulation complex, 0.4 ml of PBS at pH 7.2, and 0.05 ml of Tween 80 with a concentration of 0.05% (w / v) to assemble the final mRNA vaccine preparation) into the medium of human liver cells C3A. Observe the cell expression at the 3rd, 5th, 7th, 9th, 11th, and 14th days of culture. Without fixing the cells, add DAPI staining to label the dead cell nuclei, and at the same time observe the expression of FASN under a confocal microscope (red light with a wavelength of 587 nm).

[0059] The results are as Figure 3 shown. The number of dead cells decreases with the prolongation of time, indicating that the FASN-mRNA vaccine has no obvious cytotoxicity and the cells gradually adapt. The expression of FASN is the highest at the 7th day and although it gradually weakens by the 14th day, there is still red fluorescence expression. This shows that the effectiveness of the vaccine can last for about 14 days.

[0060] Example 4 Therapeutic effect of FASN-mRNA on high-sugar diet mice

[0061] The experiment was divided into a control group and an experimental group. The experimental group used high-sugar diet (drinking water containing 4.5 mg / ml glucose) mice treated with FASN-mRNA vaccine (subcutaneous injection), and the control group used high-sugar diet (drinking water containing 4.5 mg / ml glucose) mice treated with placebo (normal saline). After 8 weeks, pathological sections were made. The Western Blot results showed that the relative expression level of FASN protein in the liver of the mice treated with the experimental group was significantly increased compared with the control group (placebo), indicating that the vaccine increased the expression of FASN protein in the liver of the mice. Staining was performed with Oil Red O, and the results are as Figure 4 shown. Compared with the control group mice ( Figure 4 on the left), the experimental group ( Figure 4In the pathological sections of the liver of C57BL6 mice (right in the figure), fat deposition increased significantly, indicating that the FASN-mRNA vaccine provided by the present invention can promote lipid deposition.

[0062] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An optimized FASN gene, characterized in that, The sequence of the optimized FASN gene is shown in SEQ ID No.

1.

2. The in vitro synthesized mRNA of the optimized FASN gene according to claim 1, wherein, A 3-O-Me-GAG cap structure is added to the 5' end of the mRNA, and a polyadenylate polyA tail structure is added to the 3' end. All U bases in the mRNA sequence are replaced with pseudouridine ψ-UTP.

3. A recombinant plasmid expressing the optimized FASN gene as claimed in claim 1, characterized in that, It includes an initial plasmid and the optimized FASN gene described in claim 1.

4. The recombinant plasmid according to claim 3, characterized in that, The initial plasmid is a PUC57 blunt-end vector.

5. An mRNA delivery system for the FASN gene, characterized in that, The mRNA described in claim 2 is encapsulated with liposomes, and the encapsulation concentration of the mRNA is 50 - 200 μg / mL.

6. The mRNA delivery system according to claim 5, wherein The liposomes are SM-102 liposomes.

7. An mRNA vaccine composition, characterized in that, The mRNA vaccine composition includes the mRNA described in claim 2, the recombinant plasmid described in claim 3 or 4, or the mRNA delivery system described in claim 5.

8. Use of the mRNA described in claim 2, the recombinant plasmid described in claim 3 or 4, or the mRNA delivery system described in claim 5 or 6 in the preparation of a model for metabolic associated fatty liver disease.

9. The application according to claim 8, wherein, The model is an animal model or a cell model.

10. The application according to claim 8, characterized in that, The model is a fat deposition model.

Images