Application of SlPRX2 gene in regulation and control of tomato flowering time

Abstract

The invention discloses application of an SlPRX2 gene in regulation and control of tomato flowering time, and belongs to the technical field of gene engineering. The technical problem to be solved by the invention is how to regulate and control the flowering time of plants. The invention relates to application of the SlPRX2 protein or a substance for regulating and controlling the expression of the coding gene of the SlPRX2 protein or a substance for regulating and controlling the activity or content of the SlPRX2 protein in regulating and controlling the maturation and / or flowering time of the plant stem tip meristem. The SlPRX2 protein is a protein of which the amino acid sequence is as shown in SEQ ID NO. 3. The invention discloses an SlPRX2 gene and application of an SlPRX2 protein coded by the SlPRX2 gene in regulation and control of plant flowering for the first time. A verification experiment shows that the gene can obviously regulate and control the flowering time of plants. The tomato gene SlPRX2 can be widely applied to genetic breeding of tomatoes, and plays an important role in improving germplasm resources of crops such as tomatoes.

Description

Technical Field

[0001] This application relates to the field of genetic engineering technology, SlPRX2 and the application of genes in regulating the flowering time of tomatoes. Background Art

[0002] Tomato ( Solanum lycopersicum ) originated from the warm and humid regions of the Andes Mountains in South America. It is a day-neutral plant and can be widely planted in different regions. Therefore, tomato is one of the most popular fruit and vegetable crops. The modern cultivated tomato variety M82 provided by Dani Zamir is often used as a control group in scientific research.

[0003] The fate of stem cells in the shoot apical meristem of plants is determined by the balance of cell proliferation and differentiation to maintain the stem cell population and organ formation. Once endogenous and environmental signals are perceived and integrated, the shoot apical meristem undergoes a process of gradual maturation, which enables the plant to transition from the vegetative growth stage to the reproductive growth stage and is accompanied by continuous leaf production. This process is called shoot apical meristem maturation. Shoot apical meristem maturation determines the flowering time and inflorescence structure of plants, and thus affects the fruit harvest time and yield. Tomato is an important economic crop, and its fruit harvest time is crucial for its economic value. Starting from genes and using genetic engineering means to create tomato plants with an ideal flowering time is helpful for tomato agricultural production. Summary of the Invention

[0004] The technical problem to be solved by this application is: how to regulate the flowering time of plants and / or the maturation of shoot apical meristems. Specifically, the technical problem to be solved by this application is: how to regulate the flowering time of tomatoes and / or the maturation of shoot apical meristems.

[0005] To solve the above technical problems, this application provides the application of SlPRX2 protein or substances that regulate the expression of the gene encoding the SlPRX2 protein or substances that regulate the activity or content of the SlPRX2 protein in any of the following: A1), the application in regulating the flowering time of plants; A2), the application in preparing products for regulating the flowering time of plants; A3), the application in regulating the maturation of shoot apical meristems of plants; A4), the application in preparing products for regulating the maturation of shoot apical meristems of plants; A5), the application in plant breeding or plant-assisted breeding; A6), the application in preparing products for plant breeding or plant-assisted breeding; The SlPRX2 protein can be any of the following proteins: a1), a protein with the amino acid sequence shown in SEQ ID NO. 3; a2), a protein that has more than 80% identity with the amino acid sequence shown in a1) and is related to plant flowering time, obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in a1); a3), a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of a1) or a2).

[0006] In this application, the indicators for plant breeding may include shoot apical meristem maturation and / or flowering time.

[0007] In this application, the purpose of plant breeding may include cultivating plants with altered shoot apical meristem maturation and / or flowering time.

[0008] In this application, the regulation may be to increase or promote or up-regulate.

[0009] In this application, the regulation may also be to decrease or inhibit or down-regulate.

[0010] In this application, the protein may be derived from tomato.

[0011] In this application, SEQ ID NO. 3 consists of 347 amino acid residues.

[0012] The above-mentioned protein can be artificially synthesized, or its coding gene can be synthesized first and then obtained through biological expression.

[0013] The connection in a3) can be through a peptide bond.

[0014] The protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using in vitro DNA recombination technology to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag can be a Flag protein tag, His protein tag, MBP protein tag, HA protein tag, myc protein tag, GST protein tag, and / or SUMO protein tag, etc.

[0015] Furthermore, in the above-mentioned application, the substance that regulates the expression of the SlPRX2 protein coding gene or the substance that regulates the activity or content of the SlPRX2 protein is a biological material, and the biological material can be any one of the following: B1), a nucleic acid molecule that inhibits or reduces the expression of the SlPRX2 protein coding gene; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6), a transgenic plant tissue containing the nucleic acid molecule described in B1), or a transgenic plant tissue containing the expression cassette described in B2), or a transgenic plant tissue containing the recombinant vector described in B3); B7), a transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3); B8), a nucleic acid molecule encoding the SlPRX2 protein; B9), an expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue, and / or a transgenic plant organ containing the gene encoding the nucleic acid molecule described in B8).

[0016] Further, in the above application, the nucleic acid molecule described in B1) may be an RNA targeting the coding gene of the above-mentioned SlPRX2 protein or a DNA encoding the RNA; The nucleic acid molecule described in B8) may be a DNA molecule described in any one of the following g1)-g3): g1), a DNA molecule whose coding sequence of the coding strand is SEQ ID NO.2; g2), a DNA molecule whose nucleotide sequence of the coding strand is SEQ ID NO.1; g3), a DNA molecule having more than 80% identity with the DNA molecule described in g1) or g2) and regulating the flowering time of plants.

[0017] Further, the target sequence of the nucleic acid molecule described in B1) may be the reverse complementary sequence of positions 3203-3222 (CTATGGATCCAACTATACCT) of SEQ ID NO.1 and / or positions 3983-4002 of SEQ ID NO.1 (CCTCCAAGTGATTTGTTTGC).

[0018] In some embodiments of the present application, the expression cassette described in B2) may be an expression cassette for transcribing an RNA targeting the coding gene of the above-mentioned SlPRX2 protein.

[0019] The recombinant vector described in B3) may be the pDIRECT-22C-SlPRX2 vector. The pDIRECT-22C-SlPRX2 vector can encode an sgRNA targeting the DNA molecule shown in SEQ ID NO.1 and an effector protein of the CRISPR / Cas9 system: Cas9 protein.

[0020] Furthermore, in the above application, the expression cassette described in B9) refers to DNA that can express the SlPRX2 protein in a host cell. This DNA may not only include a promoter that initiates the transcription of the SlPRX2 protein-encoding gene, but may also include a terminator or / and enhancer sequence that terminates the transcription of the SlPRX2 protein-encoding gene.

[0021] Furthermore, in the above application, the recombinant microorganism may specifically be yeast, bacteria, algae, and fungi.

[0022] Furthermore, in the above application, the plant tissue may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos, and anthers.

[0023] Furthermore, in the above application, the transgenic plant organ may be the roots, stems, leaves, flowers, fruits, and seeds of a transgenic plant.

[0024] Furthermore, in the above application, the transgenic plant cell line, transgenic plant tissue, and transgenic plant organ may or may not include propagation materials.

[0025] Furthermore, in the above application, the plant is selected from dicotyledonous plants.

[0026] Furthermore, in the above application, the dicotyledonous plant is selected from solanaceous plants.

[0027] Furthermore, in the above application, the solanaceous plant is selected from solanum plants.

[0028] Furthermore, in the above application, the solanum plant is selected from tomato ( Solanum lycopersicum ).

[0029] This application also provides a method for regulating the maturation and / or flowering time of the shoot apical meristem of a plant. The method includes regulating the expression level of the coding gene of the above SlPRX2 protein in a receptor plant and / or regulating the activity or content of the above SlPRX2 protein in the receptor plant to regulate the maturation and / or flowering time of the shoot apical meristem of the receptor plant.

[0030] Furthermore, in the above method, the regulation may be to increase or promote or up-regulate.

[0031] Furthermore, in the above method, the regulation may also be to decrease or inhibit or down-regulate.

[0032] Furthermore, the method includes reducing the expression level of the coding gene of the SlPRX2 protein in the recipient plant and / or reducing the activity or content of the above-mentioned SlPRX2 protein in the recipient plant, so as to delay the maturation of the shoot apical meristem and / or the flowering time of the recipient plant, and the recipient plant contains the coding gene of the SlPRX2 protein.

[0033] Furthermore, in the method, the reduction of the expression level of the coding gene of the SlPRX2 protein in the recipient plant and / or the reduction of the activity or content of the above-mentioned SlPRX2 protein in the recipient plant can be achieved by the following method M1) or M2): M1), knocking out the coding gene of the SlPRX2 protein in the recipient plant through the CRISPR / Cas system; M2), mutating the genes in the recipient plant as follows: In the two homologous chromosomes of the recipient tomato genome SlPRX2 The nucleotides at positions 3975 - 4018 (GTGATCCAGCAAACAAATCACTTGGAGGATTTTCAGTAATAGAA) of SEQ ID NO.1 of the gene are deleted.

[0034] Furthermore, in the method, knocking out the coding gene of the SlPRX2 protein in the recipient plant through the CRISPR / Cas system can be achieved by introducing the nucleic acid molecule described in B1) above and the coding gene of the Cas protein into the recipient plant.

[0035] Furthermore, in the method, the target sequence of the nucleic acid molecule described in B1) can be the reverse complementary sequence of positions 3203 - 3222 (CTATGGATCCAACTATACCT) of SEQ ID NO.1 and / or positions 3983 - 4002 of SEQ ID NO.1 (CCTCCAAGTGATTTGTTTGC).

[0036] Furthermore, in the method, the nucleic acid molecule described in B1) and the coding gene of the Cas protein are introduced into the recipient plant in the form of a vector.

[0037] In some embodiments of the present application, the vector containing the nucleic acid molecule described in B1) and the coding gene of the Cas protein can be the recombinant vector pDIRECT - 22C - SlPRX2. The pDIRECT - 22C - SlPRX2 vector can encode the sgRNA targeting the DNA molecule shown in SEQ ID NO.1 and the effector protein of the CRISPR / Cas9 system: Cas9 protein.

[0038] Further, in the method, the plant is selected from dicotyledonous plants.

[0039] Further, in the method, the dicotyledonous plant is selected from the Solanaceae family.

[0040] Further, in the method, the Solanaceae plant is selected from the Solanum genus.

[0041] Further, in the method, the Solanum plant is selected from tomato ( Solanum lycopersicum ).

[0042] The present application also provides a method for obtaining a target tomato with altered shoot apical meristem maturation and / or flowering time. The method includes obtaining a target tomato with delayed shoot apical meristem maturation and / or flowering time (obtaining a target tomato with shoot apical meristem maturation and / or flowering time delayed compared to the recipient tomato) by reducing the expression level of the coding gene of the SlPRX2 protein in the recipient plant and / or reducing the activity or content of the SlPRX2 protein in the recipient tomato, wherein the recipient tomato contains the coding gene of the SlPRX2 protein.

[0043] Further, in the method, the reduction of the expression level of the coding gene of the SlPRX2 protein in the recipient tomato and / or the reduction of the activity or content of the SlPRX2 protein in the recipient tomato is achieved by the manner described in M1) or M2) above.

[0044] The above-mentioned SlPRX2 protein and the above-mentioned biological materials are also the protection scope of the present application.

[0045] In the present application, the maturation of the plant shoot apical meristem can be reflected in the number of leaf primordia produced before the plant undergoes floral transition. The more leaf primordia are produced, the later the shoot apical meristem matures.

[0046] In the present application, the flowering time of the plant can be reflected in the number of leaves before the first inflorescence of the plant. The more leaves there are, the later the flowering time.

[0047] In this application, identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of an amino acid sequence (or nucleotide sequence) can be determined using homology search sites on the Internet, such as the BLAST web page on the NCBI home page website. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search to calculate the identity of a pair of amino acid sequences, and then the identity value (%) can be obtained.

[0048] The above 80% or more identity can be 80%, 85%, 90%, or 95% or more identity.

[0049] The identity of more than 80% can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The identity of more than 85% can be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The identity of more than 90% can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The identity of more than 95% can be at least 95%, 96%, 97%, 98%, or 99% identity.

[0050] The beneficial technical effects achieved by this application are as follows: This application discloses for the first time SlPRX2 the application of the gene and its encoded SlPRX2 protein in regulating plant flowering time and / or shoot apical meristem maturation. Verification tests show that this gene can significantly regulate the maturation of the shoot apical meristem and / or flowering time of plants. The tomato gene SlPRX2 can be widely applied in plant fields such as tomato genetic breeding, germplasm resource improvement, transgenic and genome editing breeding, and plays an important role in improving and modifying the germplasm resources of crops such as tomatoes. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 It is the statistical result of plant phenotypes. a. Schematic diagram of the target site of the CRISPR / Cas9 edited SlPRX2 gene and the identification result of mutant genotypes. SlPRX2A 44-bp gene deletion results in the loss of gene function. b. Inflorescence meristem diagrams of M82 plants and slprx2 mutant plants. Scale bar = 100 μm. c. Statistical analysis of the number of leaf primordia produced by M82 plants and slprx2 mutant plants before the transition to flowering. The quantitative results are the means ± standard deviations of 58 and 20 replicates, respectively. The statistical data were analyzed by Student's t test, and *** indicates Student's t test P < 0.001. d. Photos of M82 plants and slprx2 mutant plants. Plant scale bar = 2 cm, inflorescence scale bar = 1 cm. e. Statistical analysis of the flowering time of M82 plants and slprx2 mutant plants. The quantitative results are the means ± standard deviations of 24 and 11 replicates, respectively. The statistical data were analyzed by Student's t test, and *** indicates Student's t test P < 0.001. The statistical data were analyzed by Student's t test.

[0052] Figure 2 This is the map of the recombinant vector pDIRECT-22C-SlPRX2. Detailed implementation manners

[0053] The present application will be further described in detail below in conjunction with the specific implementation manners. The provided examples are only for clarifying the present application and not for limiting the scope of the present application. The following examples can be used as a guide for those of ordinary skill in the art to make further improvements and do not constitute any limitation to the present application in any way.

[0054] In the following examples, unless otherwise specified, the experimental methods are all conventional methods, which are carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

[0055] In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5′-terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3′-terminal nucleotide of the corresponding DNA / RNA.

[0056] In the following quantitative tests, unless otherwise specified, three replicates are set, and the results are averaged.

[0057] In the following examples, the data were processed using GraphPad Prism statistical software. The experimental results are expressed as the mean ± standard deviation and analyzed using t -test, *** ( P<0.001) indicates a highly significant difference.

[0058] Example 1. SlPRX2 can regulate the flowering time of tomatoes This example found that in tomatoes SlPRX2 gene ( Solyc12g096530 ) can regulate its flowering time. In tomato M82, SlPRX2 the genomic sequence is shown in SEQ ID No.1 in the sequence listing, and its coding sequence (CDS) is shown in SEQ ID No.2, encoding the SlPRX2 peroxidase shown in SEQ ID No.3.

[0059] I. Tomato SlPRX2 Preparation of gene editing target vector Using the CRISPR-Cas9 system to perform gene editing on the SlPRX2 gene, two target sequences of the SlPRX2 gene were designed and screened, namely target 1 (CTATGGATCCAACTATACCT, positions 3203 - 3222 of SEQ ID NO.1) and target 2 (CCTCCAAGTGATTTGTTTGC, the reverse complementary sequence of positions 3983 - 4002 of SEQ ID NO.1).

[0060] Select the target vector pDIRECT-22C expression system, select the CmYLCV for the promoter system, select the restriction enzyme BsaI, and select Csy4 for the cleavage system. Use the pDIRECT-22C vector digested with BanI as a template to clone the promoter, and clone the remaining fragments using the original pDIRECT-22C vector. The correctly sequenced recombinant vector is denoted as pDIRECT-22C-SlPRX2, and the specific steps are as follows: Using the pDIRECT-22C vector digested with BanI as a template, perform PCR amplification with 22C-SlPRX2 F1 and 22C-SlPRX2R1 to obtain a PCR fragment, which is the vector promoter fragment and SlPRX2 the first 12 nucleotide sequences of the first target of the

[0061] Using the pDIRECT-22C vector as a template, perform PCR amplification with 22C-SlPRX2 F2 and 22C-SlPRX2 R2 to obtain a PCR fragment, which is the SlPRX2 last 12 nucleotide sequences of the first target of the

[0062] Using the pDIRECT-22C vector as a template, PCR amplification was performed with 22C-SlPRX2 F3 and 22C-SlPRX2 R3 to obtain a PCR fragment, which is SlPRX2 The last 12 nucleotide sequences of the second target of the gene.

[0063] The vector pDIRECT-22C was diluted to 50 ng, and the obtained PCR fragments were mixed in equal amounts and then diluted to 5 - 7 ng. Sap I, Ban I, T4 ligase, and 10 × T4 ligase buffer were added, and water was added to make up to 20 μL for the Golden Gate reaction of cutting and ligating simultaneously. The program was 5 min at 37°C, 10 min at 16°C, for 20 cycles.

[0064] The ligated fragments were transformed into DH5α Escherichia coli competent cells, and recombinant resistant bacteria were screened on kanamycin medium. Colony identification primers F / R were used to screen correct positive clone plaques, and the correctness of the vector fragment was determined by plasmid extraction and sequencing. Then the correct plasmid (i.e., recombinant vector pDIRECT-22C-SlPRX2) was transformed into AGL1 Agrobacterium competent cells.

[0065] The nucleotide sequence of the recombinant vector pDIRECT-22C-SlPRX2 is shown below, and its map is Figure 2 . The 4214th to 4559th positions of the nucleotide sequence of the recombinant vector pDIRECT-22C-SlPRX2 are the CaMV 35S promoter, the 5208th to 9311th positions are the coding sequence of Cas9, the 10132nd to 10151st positions are the sequence of SlPRX2-target1 ( SlPRX2 the first target of the gene), the 10152nd to 10227th positions are the gRNA scaffold, the 10248th to 10267th positions are the sequence of SlPRX2-target2 ( SlPRX2 the second target of the gene), and the 10268th to 10343rd positions are the gRNA scaffold.

[0066] The primers used are as follows: 22C-SlPRX2 F1: TGCTCTTCGCGCTGGCAGACATACTGTCCCAC; 22C-SlPRX2 R1: TGGTCTCC TTGGATCCATAG CTGCCTATACGGCAGTGAAC ; 22C-SlPRX2 F2: TGGTCTCAC CAACTATACCT GTTTTAGAGCTAGAAATAGC ; 22C-SlPRX2 R2: TGGTCTCC ATCACTTGGAGG CTGCCTATACGGCAGTGAAC ; 22C-SlPRX2 F3: TGGTCTCA TGATTTGTTTGC GTTTTAGAGCTAGAAATAGC ; 22C-SlPRX2 R3:TGCTCTTCTGACCTGCCTATACGGCAGTGAAC.

[0067] 2. Genetic transformation of tomato After the recombinant vector pDIRECT-22C-SlPRX2 obtained in step 1 is introduced into AGL1 Agrobacterium, the obtained recombinant Agrobacterium is used to carry out genetic transformation of tomato by leaf disc method. The specific steps are as follows: (1) Seed preparation: Tomato M82 seeds were disinfected with 75% ethanol for 1 min, rinsed once with sterile distilled water, treated with 10% sodium hypochlorite solution for 10-15 min, and then rinsed 3-5 times with sterile distilled water. Finally, the seeds were sown in 1 / 2 MS medium (2.2 g / L MS powder, 30 g / L sucrose, 5 g / L plant gel), cultured in a dark environment at 26°C for 48 h, and then cultured in a culture room at 26°C with a photoperiod of 16 h light / 8 h dark for 5-7 days. (2) Explant preparation: When the cotyledons are extended but true leaves have not yet grown, cut the tips of the cotyledons and cut them into square explants. Soak them in MSO liquid medium (4.4 g / L MS powder, 15 g / L sucrose) for 1 h, discard the liquid, use sterile filter paper to absorb the remaining medium on the cotyledons, and then spread the explants flat on D1 medium (4.4 g / L MS powder, 30 g / L sucrose, 5 g / L phytogel, 1 mg / L zeatin, 0.2 mg / L 2,4-D, 0.1 mg / L kinetin) covered with sterile filter paper, with the adaxial side facing up, and culture them in the dark for 2 days. (3) Preparation of bacterial solution: Transform the plasmid into the Agrobacterium tumefaciens strain AGL1, pick the positive single clone colony and inoculate it into 3 mL LB liquid medium with corresponding resistance, and then culture it in a shaking incubator at 28°C and 220 rpm overnight. The next day, inoculate it into 30 mL LB liquid medium containing corresponding antibiotics at a ratio of 1:100, and continue to culture it in a shaking incubator at 28°C and 220 rpm until the OD600 is 0.6-0.8, then collect the bacteria by centrifugation at room temperature at 6000 rpm for 10 min, and resuspend the bacteria in MSO solution for later use; (4) Explant infection: The explants were cultured with bacterial solution by shaking for 15 min. After absorbing the excess bacterial solution with sterile filter paper, the explants were spread on D1 medium covered with sterile filter paper and cultured in the dark for 2 days. (5) Inducing callus and bud formation: Transfer the explants cultured in the dark from the D1 medium to the 2Z IAA medium (4.4 g / L MS powder, 20 g / L sucrose, 5 g / L phytagel, 2 mg / L zeatin, 200 mg / L ticarcillin, 150 mg / L kanamycin, 0.1 mg / L IAA, 500 μM ascorbic acid), and culture them in an incubator at a temperature of 26 °C with a photoperiod of 16 h light / 8 h dark. Replace the medium every three weeks until callus and buds are formed on the explants; (7) Inducing rooting: Cut the buds that have grown to 1 - 2 cm and place them in the MSSV medium (4.4 g / L MS powder, 20 g / L sucrose, 5 g / L phytagel, 200 mg / L ticarcillin, 150 mg / L kanamycin, 0.1 mg / L IAA, 500 μM ascorbic acid) until roots grow; (8) When the rooted seedlings grow to 5 cm, extract the leaf DNA for gene editing identification, and transplant the positive seedlings obtained from the identification. The primers used are as follows: PCR identification primer F: GGAGAACCAGCTGTTGTTCCACAT; PCR identification primer R: TCTGGTAGCCTCAGCAGTTTCACCA.

[0068] One slprx2 mutant was identified among the offspring of the positive seedlings. This mutant is SlPRX2 a homozygous mutation of the SlPRX2 gene. The sequencing results showed that: compared with the wild type, in one pair of homologous chromosomes of this mutant, the SlPRX2 gene had a deletion of nucleotides at positions 3975 - 4018 in SEQ ID No.1 (GTGATCCAGCAAACAAATCACTTGGAGGATTTTCAGTAATAGAA, 44 bp), thus knocking out the Figure 1 gene (as shown in a).

[0069] slprx2 The mutant self-crossed to obtain the homozygous T2 generation slprx2 mutant for phenotypic observation.

[0070] III. Plant phenotypic statistics and detection Test plants: Tomato M82, the slprx2 mutant obtained in Step II.

[0071] Pot the test plants. The flowerpot specifications are: diameter 20.6 cm, height 17.5 cm, bottom 15 cm. Plant one plant in each pot.

[0072] (1)Statistics of the maturation rate of shoot apical meristems: Under a stereomicroscope, the leaf primordia of tomato plants were dissected, the inflorescence meristems were photographed and recorded, and the number of leaf primordia produced before the inflorescence meristems was counted.

[0073] The results showed that slprx2 compared with M82 plants, the number of leaf primordia produced by mutant plants before the floral transition was significantly more than that of M82 plants ( Figure 1 b, c in). This result indicates that: compared with M82 plants, SlPRX2 the maturation of the shoot apical meristems of mutant plants was delayed.

[0074] (2)Statistics of flowering time: When the first inflorescence emerged, the number of true leaves below it was counted.

[0075] The results showed that slprx2 compared with M82 plants, the number of true leaves produced by mutant plants before the first inflorescence was significantly more than that of M82 plants ( Figure 1 d, e in), indicating that slprx2 the flowering time of mutant plants was later than that of M82 plants.

[0076] The above results indicate that: SlPRX2 the gene and its encoded protein can regulate the flowering time and / or the maturation of shoot apical meristems of tomatoes, SlPRX2 the flowering time of the homozygous mutants obtained by gene editing was later than that of the wild type.

[0077] SEQ ID No.1 ( SlPRX2 ( Solyc12g096530ATGGAGAAACTCAAACTACAAATATATTCAATCCAAA CACTATGTTTACGCAAAAAAAAATATAAATTTTCGTTACTTATTTTCTTGTGTTCGATAATATTTTTTTCGAAAAC ATCATGTTCAACTCTTTCATTTAATTTTTATGGATTATCTTGTCCCTCAGCTGAATTAATGGTGAAAAATACAGTA AGATCAGCTTCTTCTATGGATCCAACTATACCTGGGAAATTGCTTCGTCTTCTTTTTCACGATTGCTTTGTTGAG GTAATATTTCTAGTAATTATCTATTTAATTTTTATGCATTACGCTTGTATAAAAGAAATTTGGATTAACTACTTTGCATGCAATTACGTAACTAGTAGTGTATATTCTCACTTCAATTTACACTCTACTGTAGTTAATTTTATCGATTTGATGTGAACACTGAATAAAGTTTAATTCAAATAAATTTAATAAAGTTCTTAAATTCTTCCTCAAATAATACTTCTGATCTTAATTTACATGACATCATCTGATCAAGCATGAAGTTTTATAAATAAAATAAATACTTAATTGTGATCTAGAAATATTGTATTATTATAAATTATCTCATTTAAGCAATTAAGTAGTTTTCAATATAAATAAGTGACATTAATCACTTCTAAGAAAATAAAAAGAAAAAAAAAACATGTCATAAATTAAGGCAAATGACGTAATATTTTATCATATGAAAGATTGATTAATTTTTTTCTGAATAATAGGCCCTCCTGTCTATCCTTGTCCATTTAAGTACCAAACTATATTTTTGTGTTGATTAGGATTAAAAACTCGTAACTTGCATCTAACTTACACATCTGATATCATACATTGCGCTCTTATTACTAGATCAAAAATCCCCTGAGGCTAAAATATTGAGGAGGATTATAATATTTTTAAAATTTTTTTTTAG GGTTGTGATGCATCTATATTA TTAGAAGGAAATGGAACAGAAAGAAGTGATCCAGCAAACAAATCACTTGGAGGATTTTCAGTAATAGAAAATGCCA AAAGGGTTTTGGAAATATTTTGTCCTTTTACGGTTTCTTGTGCTGATATTGTTGCTTTGGCGGCTAGAGATGCTGT TGAATTTGTATGTTTTTCTAAAACTTATTTGTTACTCAACCGTCATTAATAAGGATTAGCGATGAAGTAATTTTTATTGTTTAGCAATATAAGTTATCCATTGTTGATTTCTATTTTTTTATAGTGTGTTTTTGTTTGTTTAATTAATGTATGTTAATTTTATGTGACATGTTTAATTTGTGATTAAAAAATTATTTAGTTCGTCGCTTATAAATATTTGATGTTTAAATGGAGAAGGATATATAAAAAAAGTTCATTATTCATCGAGTTTTGACTAGTATACATTTAGTTAATCTTCAAAAATTTAGATCAAGATTGAGAAAAAAAAAACTATTGTACTTATCGTTACTACCTTTTTAATACGTATTTTTGTTTGAAAACATAGAGAACTTCCTGTATTAGAGAAAATTAAATGTTTTCATATGTTTGATCGATTCTTATTACTATTCAAGATTGACTTGTTGAAAATGTTTTTGATGTTTCGATGGAAATGTTTGTTCAAAATTCTTTGATAGTAAATTTGTTTGAGACTGAAACGTTAATTGTTGTTATTTTGATGATTATAAAAACAG GCAGGAGGGCCAAATGTTCAAATTCCAACAGGAAGA AAAGATGGAAGAATTAGTTTGATAACAAATGTGAGACCAAACATAGTGGACACAAGTTTCACAATGGATCAAATGA TTAATATTTTTACTATAAAGGGACTTTCTTTAGATGATCTTGTTATCCTATCAGGTGCACACACAATAGGATCAGCACATTGCAATGCATTTAGTGATCG TTTTAGAGTGGACACAAATGGCAATTTCACTCTAATTGACCCTTCATTAGACAAAGCATATGCAATAGAGTTAACA AAACAATGTCCAGCAGGGGCAGCAACTTCAACAATTACAGTAAAAAATGATCCTCAAACACCTCAACTTTTTGACA ATCAATATTTCAAAGATTTAATACAACACAAGGGGCTTTTTCAATCCGATTCTGTTTTATTTAACGACGTACGTAC AAAGAAAAGAGTCGTTGAGTTTGCGAATGATCAAGACGGATTTTTCAGGAGTTGGAGTCAATCTTTCGTGAGACTT TCTGTGCTCGGAGTGAAGTCCGGAGAGGATGGAGAG GTTAGAACTTCTTGTTCGGTTATAAATTAATGTGTGGTAATATAATGACGTACGAACAAAGGAAAGAGTCATAGAGTTCGCAAATGATCAAGACGGATTTTTCAAGAGTTGGGAGTCAATCTTTTGTGAGACTTTCTATGCTTGGAGTGAAG TCTGGAGAGGATGAAGAGGTTAGAACTTCTTGTTCGGTTA TAAATTAGTGCGTGACAATACAGTGACGTATGCAGAATTTTATTCGTGAGTTGGTTTCTATTATTATAATTTGGGCTTGTAAGTAAGGTTTGAGTTTGGAATTTTATAAATTGTATTATTTTAATTTCAAAAAGTGTCGACTTATTTTATGTATTCATATTTTGTAATAAGTTAATTTATTACATTGTTGTTATATATAATTTTAAATTCATTTTTGTGCGTTACTTCATTTTGTAATAACTTTATATGATGTCTTAATACAAAACATATACGATATCTTTTTCTAAAACAAGATTTTTATCAAATTAAATTTTAAGTCACTAATTTTATTCAATCGTCTTGAATTTCAAAAATAAAATCAATTTATGCGATTGGTCAATTCGAGGCGGTGAGCCATGGTTTGTAGTATGTATAATTCTAGAAATTGCTAGAAAGGTGTCTATAGTTTTAAAAGTGACATGTTTATCCTTCTAACTTGCTAAAAGTTAAAAGATGACCTGTTATTTTATGACTCATTAATATTCTATTTAAAATATTAATAAAAAAAGTATAATTTTGAAAATAAAAAAGAGTCAAAAATACCCTTATTCATTAACAGGATCTGTAAACGCCACTTTGTTGCCATATGGATACCACATGGCATGCCACATAAGCCAAAAGAGTTCCACTCATGCCGCATAGAAAATAAACTTACCCCTAATTTCCCCCAATTTTCTCTATTTCCTTAAAATTTAGACACAAATTCACTGAACATCATAGAAATCCTTTCCCTTAGAACTTATGTATTTTGGAAAATTGTTCTAAAGAAATGGAGAAACGAGGAAAAAGGGTTCTATGTTCTTTAGTGAAATCATTTTTTAAATTCTACGGAAAATGGAGAAAATTGAGGGGAAATTAGGGGTAAGTTTATTAGTCTACGTGGCATGAGTGAAATTCTATTGGCTTATGTGGCATGCCATGTGACATCCACGTGAAATCTAAGTGACCTTTAACCGATTATATTAATGA。

[0078] SEQ ID No.2 ( SlPRX2 ( Solyc12g096530 ),CDS sequence) is as follows:

[0079] SEQ ID No.3 ( SlPRX2 ( Solyc12g096530 ), amino acid sequence) is as follows: MEKLKLQIYSIQTLCLRKKKYKFSLLIFLCSIIFFSKTSCSTLSFNFYGLSCPSAELMVKNTVRSASSMDPTIPGKLLRLLFHDCFVEGCDASILLEGNGTERSDPANKSLGGFSVIENAKRVLEIFCPFTVSCADIVALAARDAVEFAGGPNVQIPTGRKDGRISLITNVRPNIVDTSFTMDQMINIFTIKGLSLDDLVILSGAHTIGSAHCNAFSDRFRVDTNGNFTLIDPSLDKAYAIELTKQCPAGAATSTITVKNDPQTPQLFDNQYFKDLIQHKGLFQSDSVLFNDVRTKKRVVEFANDQDGFFRSWSQSFVRLSVLGVKSGEDGESGEDEEVRTSCSVIN*.

[0080] The nucleotide sequence of the recombinant vector pDIRECT-22C-SlPRX2 is as follows:

[0081] The above has described this application in detail. For those skilled in the art, without departing from the spirit and scope of this application and without the need for unnecessary experiments, this application can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of this application are given, it should be understood that further improvements can be made to this application. In short, according to the principle of this application, this application is intended to cover any changes, uses, or improvements to this application, including those that depart from the scope disclosed in this application but are made using conventional techniques known in the art.

Claims

1. Use of the SlPRX2 protein, or a substance that regulates the expression of the gene encoding the SlPRX2 protein, or a substance that regulates the activity or content of the SlPRX2 protein, in any of the following: A1), Use in regulating the flowering time of plants; A2), Use in preparing a product for regulating the flowering time of plants; A3), Use in regulating the maturation of the shoot apical meristem of plants; A4), Use in preparing a product for regulating the maturation of the shoot apical meristem of plants; A5), Use in plant breeding or plant-assisted breeding; A6), Use in preparing a product for plant breeding or plant-assisted breeding; The SlPRX2 protein is any of the following proteins: a1), A protein with an amino acid sequence shown in SEQ ID NO.3; a2), A protein obtained by substitution and / or deletion and / or addition of amino acid residues to the amino acid sequence shown in a1), having more than 80% identity with the amino acid sequence shown in a1), and being related to the flowering time of plants; a3), A fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of a1) or a2).

2. The application according to claim 1, wherein The substance that regulates the expression of the SlPRX2 protein-encoding gene or the substance that regulates the activity or content of the SlPRX2 protein is a biological material, and the biological material is any of the following: B1), A nucleic acid molecule that inhibits or reduces the expression of the SlPRX2 protein-encoding gene described in claim 1; B2), An expression cassette containing the nucleic acid molecule described in B1); B3), A recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2); B4), A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6), A transgenic plant tissue containing the nucleic acid molecule described in B1), or a transgenic plant tissue containing the expression cassette described in B2), or a transgenic plant tissue containing the recombinant vector described in B3); B7), A transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3); B8), A nucleic acid molecule encoding the SlPRX2 protein described in claim 1; B9), An expression cassette, recombinant vector, recombinant microorganism, transgenic plant cell line, transgenic plant tissue, and / or transgenic plant organ containing the gene encoding the nucleic acid molecule described in B8).

3. According to the use described in claim 2, wherein The nucleic acid molecule described in B1) is an RNA targeting the coding gene of the above-mentioned SlPRX2 protein or a DNA encoding the RNA; The nucleic acid molecule described in B8) is a DNA molecule described in any of the following g1)-g3): g1), A DNA molecule whose coding sequence of the coding strand is SEQ ID NO.2; g2), a DNA molecule whose nucleotide sequence of the coding strand is SEQ ID NO.1; g3), a DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates the flowering time of plants.

4. The application according to any one of claims 1 to 3, characterized in that, The plant is selected from dicotyledonous plants.

5. A method for regulating the maturation of plant shoot apical meristems and / or the flowering time, characterized in that, The method includes regulating the expression level of the coding gene of the above-mentioned SlPRX2 protein in the recipient plant and / or regulating the activity or content of the above-mentioned SlPRX2 protein in the recipient plant to regulate the maturation of the shoot apical meristem and / or the flowering time of the recipient plant.

6. The method according to claim 5, wherein The method includes reducing the expression level of the coding gene of the SlPRX2 protein in the recipient plant and / or reducing the activity or content of the above-mentioned SlPRX2 protein in the recipient plant, so that the maturation of the shoot apical meristem and / or the flowering time of the recipient plant is delayed, and the recipient plant contains the coding gene of the SlPRX2 protein.

7. The method according to claim 6, characterized in that, The reduction of the expression level of the coding gene of the above-mentioned SlPRX2 protein in the recipient plant and / or the reduction of the activity or content of the SlPRX2 protein in the recipient plant are achieved by the methods described in M1) or M2) below. M1), knocking out the coding gene of the SlPRX2 protein in the recipient plant through the CRISPR / Cas system; M2), mutate the gene in the recipient plant as follows: in two homologous chromosomes of the recipient tomato genome, SlPRX2 delete the nucleotides at positions 3975-4018 of SEQ ID NO.1 of the gene.

8. A method for obtaining a target tomato with altered maturity and / or flowering time of shoot apical meristems, characterized in that, The method includes obtaining a target tomato with delayed maturation of the shoot apical meristem and / or flowering time by reducing the expression level of the coding gene of the SlPRX2 protein in the recipient tomato and / or reducing the activity or content of the SlPRX2 protein in the recipient tomato, and the recipient tomato contains the coding gene of the SlPRX2 protein.

9. The method according to claim 8, characterized in that The reduction of the expression level of the coding gene of the SlPRX2 protein in the recipient tomato and / or the reduction of the activity or content of the SlPRX2 protein in the recipient tomato are achieved by the methods described in M1) or M2) above.

10. The SlPRX2 protein described in claim 1 and the biomaterials described in claims 2-4.

Images