Application of OsbZIP39 gene in regulating and controlling salt tolerance of rice

By overexpressing the OsbZIP39 gene in rice, its salt tolerance is improved, and the problem of rice is sensitive to salt stress is solved, and the salt tolerance is significantly improved, which promotes the utilization and yield of salinized land.

CN120272522AActive Publication Date: 2025-07-08HAINAN UNIVERSITY SANYA NANFAN RESEARCH INSTITUTE +1
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202510766019.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-10
Publication Date
2025-07-08
Estimated Expiration
2045-06-10

AI Technical Summary

Technical Problem

Rice is sensitive to salt stress, and the existing technology is difficult to effectively improve its salt tolerance, which limits the utilization and yield of salinized land.

Method used

By overexpressing the OsbZIP39 gene, the expression amount and activity of OsbZIP39 protein in rice are improved, and OsbZIP39 protein promoter or related biological materials are used to introduce it into rice tissues to enhance its salt tolerance.

Benefits of technology

It significantly improves the salt tolerance of rice, provides a technical means to quickly create new salt-resistant rice varieties, and enhances the survival ability of rice under salt stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120272522A_ABST
    Figure CN120272522A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of modern agriculture, and particularly relates to application of an OsbZIP39 gene in the aspect of regulating and controlling the salt tolerance of rice. The application of the OsbZIP39 gene in regulating and controlling the salt tolerance character of the rice is found for the first time. By overexpressing the OsbZIP39 gene in the rice, the salt tolerance of the rice can be remarkably improved, and a simple and effective technical means is provided for quickly creating a new salt-tolerant rice strain.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of modern agricultural technologies, and particularly relates to OsbZIP39 the application of genes in regulating the salt tolerance of rice. Background Art

[0002] Salt stress is one of the main abiotic stresses that limit plant growth and crop yields. Rice ( Oryza sativa L.) is an important food crop and is very sensitive to salt stress. It is estimated that the area of saline-alkali land globally is approximately 800 million hectares, and there is great potential for comprehensive development and utilization. Therefore, improving the salt tolerance of rice is of great practical significance for fully utilizing saline-alkali land for rice production, releasing the productivity of rice, and further increasing rice yields.

[0003] Therefore, it is necessary to screen and identify genetic genes that are of great significance for the directional genetic improvement of rice salt tolerance and develop new technical methods for cultivating salt-tolerant rice. Summary of the Invention

[0004] To solve the above technical problems, the technical solution adopted by the present invention is as follows: In the first aspect of the present invention, there is provided the application of an OsbZIP39 protein promoter in improving the salt tolerance of rice.

[0005] In some embodiments of the present invention, the OsbZIP39 protein promoter includes a reagent that targets and upregulates the expression level of the OsbZIP39 protein.

[0006] In some embodiments of the present invention, the amino acid sequence of the OsbZIP39 protein is as shown in SEQ ID NO: 3.

[0007] In the second aspect of the present invention, there is provided the application of overexpressing OsbZIP39 genes in improving the salt tolerance of rice.

[0008] In some embodiments of the present invention, the OsbZIP39 genomic nucleotide sequence of the gene is as shown in SEQ ID NO: 1.

[0009] In some embodiments of the present invention, the OsbZIP39 CDS sequence of the gene is as shown in SEQ ID NO: 2.

[0010] In the third aspect of the present invention, there is provided the application of biological materials related to overexpressing the OsbZIP39 protein in cultivating rice varieties with improved salt tolerance.

[0011] In some embodiments of the present invention, the amino acid sequence of the OsbZIP39 protein is as shown in SEQ ID NO: 3.

[0012] In some embodiments of the present invention, the biomaterial does not include propagation material.

[0013] In some embodiments of the present invention, the biomaterial comprises a nucleic acid molecule, a vector, or a cell.

[0014] In some embodiments of the present invention, the nucleic acid molecule comprises a nucleic acid molecule encoding the protein shown in SEQ ID NO: 3.

[0015] In some embodiments of the present invention, the nucleic acid molecule comprises the nucleotide sequence shown in SEQ ID NO: 2.

[0016] In some embodiments of the present invention, the vector comprises an overexpression vector, including but not limited to conventional overexpression vector tools in the art such as pIPKB003.

[0017] In some embodiments of the present invention, the cell comprises at least one of Escherichia coli and Agrobacterium tumefaciens. Among them, Escherichia coli is a commonly used host cell for constructing vectors and plasmids in the art, and Agrobacterium tumefaciens is a common tool for delivering DNA molecules to plants in the art.

[0018] In the third aspect of the present invention, those skilled in the art can understand that due to the degeneracy of codons, other technical solutions that modify the OsbZIP39 gene but still encode a protein with an amino acid sequence as shown in SEQ ID NO: 3 can achieve the same or similar technical effects as the present invention and still fall within the protection scope of the present invention.

[0019] In the fourth aspect of the present invention, there is provided a method for cultivating a rice variety with improved salt tolerance, comprising the step of increasing the expression level and / or activity of a OsbZIP39 gene in rice.

[0020] In some embodiments of the present invention, the step of increasing the expression level and / or activity of the OsbZIP39 gene in rice is to introduce the biomaterial related to overexpressing the OsbZIP39 protein described in the third aspect of the present invention into rice tissues or rice cells.

[0021] In some embodiments of the present invention, the biomaterial does not include propagation material.

[0022] In some embodiments of the present invention, the introduction method comprises using at least one of Ti plasmid, Ri plasmid, plant virus vector, microinjection, and electroporation.

[0023] In some embodiments of the present invention, increasing the OsbZIP39The steps for gene expression level and / or activity are specifically as follows: 1) Using the sequence shown in SEQ ID NO: 2 as OsbZIP39 the full-length CDS sequence of the gene, design primers for amplifying OsbZIP39 the full-length CDS sequence of the gene; 2) Using the cDNA of rice as a template, perform PCR amplification to obtain a PCR product; 3) After purifying the PCR product, use homologous recombination ligation to recombinantly obtain an overexpression vector; 4) Transform the overexpression vector into rice by Agrobacterium-mediated transformation method.

[0024] In some embodiments of the present invention, the rice variety includes Zhonghua 11.

[0025] In some embodiments of the present invention, the sequences of the primers are as shown in SEQ ID NO: 4 and SEQ ID NO: 5.

[0026] The beneficial effects of the present invention are: The present invention discovers for the first time OsbZIP39 the application of the gene in regulating the salt tolerance trait of rice. By overexpressing the OsbZIP39 gene in rice, the salt tolerance of rice can be significantly improved, providing a simple and effective technical means for rapidly creating new salt-tolerant rice lines. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The following further describes the present invention in conjunction with the drawings and embodiments, wherein: Figure 1 is OsbZIP39 the expression level results of overexpressing plants.

[0028] Figure 2 is OsbZIP39 the salt tolerance experiment results of overexpressing plants, where A is the growth state of the plants before salt treatment, B is the growth state of the plants after salt treatment, and C is the statistical result. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0029] The following will clearly and completely describe the concept of the present invention and the technical effects produced in conjunction with the embodiments to fully understand the purpose, features, and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention.

[0030] Example 1 Construction of pIPKB003-OsbZIP39 Expression Vector and Obtaining Overexpressing Plants of OsbZIP39 Protein From OsbZIP39 Design primers from the CDS sequence region of the OsbZIP39 full-length CDS was amplified by PCR, and the full-length CDS sequence of OsbZIP39 was ligated to the pPIPKB003 vector by homologous recombination. Then, the pIPKB003-OsbZIP39 vector was transformed into Zhonghua 11 rice by Agrobacterium-mediated transformation to obtain OsbZIP39 Overexpressing rice plants.

[0031] OsbZIP39 The genomic sequence of the

[0032] Its CDS sequence is as follows:

[0033] The encoded protein sequence is as follows: N - terminus - MAEPALLDPTAAFDLRLYPAHLFDHELPLAGGGGGDDDDDLPLDGLEFDLPGDFS VEDFLLRSPERDDSGEGSAAGSGPTASPSSSPTTSASNSAVANGSGGEVKHEESDEGRSGGGDPKWSLKRKQASPGPSSDAAKCRRSGDGDVSPSASASRTAVDSDEGGTVCEEEEDERRAARLMRNRESAQLSRQRKKRYVEELEEKVKSMHSVINDLNSRISFVVAENATLRQQLSGGSVNCPPPGVYPPAPIPGMHFPWMPGYAMRPPGSHVPLVPIPRLKPQQPVPSSKVVKKPESKKTVENKSKSKTKTKKVASVSLLGLLLIMLVFGAFIPGFNHNFGMCGQSDNAMFRNFGQSHARVLSVSSQDKSSLNNSDMIGVDVGKMTGNTDGPGKKHQPAHNSSEILPALLYVPRNGKHVKINGNLIIHSVLASEKAVAHKASKDDSDQSARDHKETSVAIARYLSLPGKDVNRQETSSADGPLPQWFREGMEGPILNSGMCSEVFQFDISTASSNPGGIIPASPVVNSSSVNATEKIPAHSAAYHGKLKNRRVMYNEAIPLTGKTANNTEPFNRTSESSSKLPDSKPASSVVVSVLADPREAGNGDGDPRVSPKPLSKIFVVVLVDGVRYVTYSCTLPFKSSSPHLVN - C - terminus (SEQ ID NO: 3).

[0034] 1. The steps for constructing the pIPKB003 - OsbZIP39 expression vector are as follows: The pIPKB003 expression vector for gene overexpression is driven by the rice actin promoter for gene overexpression. This vector is double - digested with two restriction endonucleases, HindIII and SalI, and thus primers for amplifying the OsbZIP39 CDS are designed.

[0035] The primer sequence information is as follows: 003F: CGCGGGGCTGCAGGAATTCAAGCTT ATGGCGGAGCCGGCCCTGCT (SEQ ID NO: 4).

[0036] 003R: AACATATCCAGTCACTATGGTCGAC TTAGTTCACAAGATGTGGGC (SEQ ID NO: 5).

[0037] In the primer, the underlined part is the homologous arm required for homologous recombination ligation.

[0038] Using the cDNA of Zhonghua 11 as a template, 003F and 003R as primers, PCR amplification was carried out to obtain a PCR product. The pIPKB003 vector was double digested with two restriction endonucleases, HindIII and SalI, to obtain a digested product. The PCR product and the digested product were purified respectively, and then the following homologous recombination-ligation method was used to recombinantly obtain the pIPKB003-OsbZIP39 expression vector.

[0039] The reaction system is shown in Table 1.

[0040] Table 1

[0041] Note: The homologous recombination enzyme is Uniclone One Step SeamLess Cloning Kit from Beijing Jinsha Biotechnology Co., Ltd., and the product number is SC612.

[0042] 2. Identification Take 10 μL of the ligation product and transform competent Escherichia coli. Screen on an LB plate containing 50 μg / mL kanamycin. Colony PCR was used to identify monoclonal clones, positive clones were selected, and plasmids were extracted and sent for sequencing. The plasmid with a positive clone sequencing result was selected as the recombinant overexpression vector pIPKB003-OsbZIP39.

[0043] Example 2 Identification of pIPKB003-OsbZIP39 Transformed Rice Calli and Positive Seedlings 1. Agrobacterium Transformation The correctly sequenced recombinant vector pIPKB003-OsbZIP39 was transformed into the competent Agrobacterium tumefaciens GV3101 strain by electroporation, and after verification by colony PCR, the bacteria were preserved for use.

[0044] The correctly identified single colony of Agrobacterium tumefaciens GV3101 / pIPKB003-OsbZIP39 was inoculated into 2 - 3 mL of liquid medium containing 100 μg / mL spectinomycin and 50 μg / mL rifampicin, and cultured overnight with shaking at 28°C. The next day, it was transferred to a large amount of liquid medium containing antibiotics and cultured with shaking. After several transfers, the bacterial cells were collected and resuspended to an OD600 between 0.8 - 1.0. The recombinant strain GV3101 / pIPKB003-OsbZIP39 was transformed into Zhonghua 11 by Agrobacterium-mediated method. The immature embryos were infected with Agrobacterium tumefaciens GV3101, and the immature embryos invaded by Agrobacterium tumefaciens GV3101 were placed on the selection medium for multiple screenings to obtain resistant calli. The resistant calli were regenerated into seedlings to obtain T0 generation transgenic seedlings. The Agrobacterium-mediated transformation method of rice was carried out with reference to the literature (Zhao, W., Zheng, S. & Ling, HQ. An efficient regeneration system and Agrobacterium-mediated transformation of Chinese upland rice cultivar Handao297. Plant Cell Tiss Organ Cult 106, 475–483 (2011)).

[0045] 2. Identification of T0 generation plants of OsbZIP39 overexpressing plants RNA was extracted from the leaves of T0 generation transgenic rice plants and Zhonghua 11 and reverse transcribed into cDNA, and OsbZIP39 the gene was detected by real-time quantitative PCR (qPCR) to determine whether the gene was overexpressed. Using Zhonghua 11 as a control, two effective overexpressing lines with increased expression levels compared to Zhonghua 11 were identified and named OsbZIP39-OE-1 and OsbZIP39-OE-2 (The results are as shown in Figure 1 ).

[0046] Thus, qPCR primers for amplifying OsbZIP39 were designed, and the sequence information is as follows: OsbZIP39qPCR-F: GTCAATGCTACCGAGAAAATCC (SEQ ID NO: 6); OsbZIP39qPCR-R: GAGTGGAATCGCTTCATTGTAC (SEQ ID NO: 7).

[0047] Example 3 Functional verification of salt tolerance of overexpressing plants of different lines OsbZIP39 Select wild-type Zhonghua 11 (WT), line( OsbZIP39-OE ​OE-1, OE-2 )Adopt the method of greenhouse hydroponics. Disinfect the seeds with 10% H2O2 for 10 min, then rinse the H2O2 on the seed surface with distilled water. Place the seeds evenly in a petri dish with sterilized filter paper, and germinate them in the dark in a constant temperature incubator at 37 °C for 2 d, and germinate them at 28 °C for one day. Place the germinated seeds in a hydroponic box with a filter screen and grow for 7 d. Replace the nutrient solution in the hydroponic box every 2 d. The growth conditions are 28 / 25 °C (day / night, about 70% relative humidity), the light cycle is 14 h / 10 h (day / night), and the light intensity is 400 μmol·m -2 ·s -1 . Select rice seedlings with good growth and a leaf age of 3-leaf stage, and perform salt stress treatment with 120 mM NaCl for 10 d, and then recover for 5 d.

[0048] The nutrient solution formula is shown in Table 2.

[0049] Table 2 Nutrient solution mother liquor formula table

[0050] When in use, prepare the working solution immediately before use. Each liter of working solution requires 1.25 mL of each mother liquor, and adjust the pH to 5.5.

[0051] The results are as Figure 2 shown.

[0052] Before salt treatment ( Figure 2 in A), the WT is similar to the OsbZIP39-OE line. After salt treatment ( Figure 2 in B), compared with the WT, the growth state of the OsbZIP39-OE line is significantly better. The survival rate of the OsbZIP39-OE line is significantly higher than that of the WT (the survival rate of the WT is about 8.3%, while the survival rates of OsbZIP39-OE-1 and OsbZIP39-OE-2 are 83.3% and 66.6% respectively), indicating that overexpression of the OsbZIP39 gene can significantly improve the salt stress tolerance of rice.

[0053] The above has described the embodiments of the present invention in detail with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those of ordinary skill in the art, various changes can be made without departing from the purpose of the present invention. In addition, without conflict, the embodiments of the present invention and the features in the embodiments can be combined with each other.

Claims

1. Application of the OsbZIP39 protein promoter in improving the salt tolerance of rice; The OsbZIP39 protein promoter includes a reagent that targets and upregulates the expression level of the OsbZIP39 protein; The amino acid sequence of the OsbZIP39 protein is as shown in SEQ ID NO:

3.

2. Overexpression OsbZIP39 Use of the gene in improving the salt tolerance of rice; The said OsbZIP39 The nucleotide sequence of the gene is shown in SEQ ID NO:

2.

3. Application of biomaterials related to overexpressing the OsbZIP39 protein in cultivating rice varieties with improved salt tolerance; The amino acid sequence of the OsbZIP39 protein is as shown in SEQ ID NO: 3; The biomaterials do not include propagation materials.

4. The application according to claim 3, wherein: The biomaterials include nucleic acid molecules, vectors or cells.

5. The application according to claim 4, wherein: The nucleic acid molecule includes a nucleic acid molecule encoding the protein shown in SEQ ID NO:

3.

6. The application according to claim 5, wherein: The nucleic acid molecule includes the nucleotide sequence shown in SEQ ID NO:

2.

7. The application according to claim 4, wherein: The vector includes an overexpression vector.

8. The application according to claim 4, wherein: The cells include at least one of Escherichia coli and Agrobacterium tumefaciens.

9. A method for cultivating a rice variety with improved salt tolerance, comprising the step of increasing the expression level and / or activity of the OsbZIP39 gene; The step of increasing the expression level and / or activity of the OsbZIP39 gene is to introduce the biological material related to overexpressing the OsbZIP39 protein described in any one of claims 3 to 8 into rice tissues or rice cells.

10. The method according to claim 9, wherein: The introduction method includes using at least one of Ti plasmid, Ri plasmid, plant virus vector, microinjection, and electroporation.

Citation Information

Patent Citations

  • Rice bZIP and application of the same in improving stress tolerance of plants

    CN101220363A

  • Transcription factor TFSALT1 for improving salt resistance of rice, and application thereof

    CN106011152A

  • Application of rice OsbZIP39 gene in improving cadmium resistance of rice

    CN114591982A

  • Application of OsST1 gene in regulating and controlling salt tolerance of rice

    CN119506334A

  • Application of rice OsRMT1 gene in improvement of salt tolerance of rice

    CN120098948A