Molecular marker for identifying egg laying weight of chicken based on QSOX1 gene as well as identification method and application of molecular marker

Through SNP molecular markers based on the QSOX1 gene, PCR amplification and enzyme cleavage and electrophoresis technology were used to identify the egg-laying traits of chickens, which solved the problem of identification in the existing technology and achieved early rapid and low-cost breeding effects.

CN120272599APending Publication Date: 2025-07-08ANHUI AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510200357.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-24
Publication Date
2025-07-08

AI Technical Summary

Technical Problem

The prior art is difficult to quickly and effectively identify the heavy traits of chicken egg laying, resulting in slow breeding progress and it is difficult to improve breeding egg utilization and reproduction performance.

Method used

The SNP molecular marker based on the QSOX1 gene was developed, and PCR amplification and genotyping were designed to be performed by designing specific amplification primers. The BanⅡ restriction enzyme digestion was used to detect the QSOX1 genotype of chickens in combination with agarose gel electrophoresis, and the egg-laying traits were identified.

Benefits of technology

It has achieved early rapid and low-cost identification of chicken egg-laying traits, improved the efficiency and economic benefits of breeding, and is suitable for molecular marker assisted breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120272599A_ABST
    Figure CN120272599A_ABST
Patent Text Reader

Abstract

The invention relates to a molecular marker for identifying the egg laying weight of chickens based on a QSOX1 gene and an identification method and application thereof, the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, the 501st basic group of the nucleotide sequence is G or A; the egg laying weight of the to-be-detected chicken with the genotype of GA is higher than that of the to-be-detected chicken with the genotype of GG. The molecular marker for screening the egg weight at the early egg laying stage of the chicken is established by identifying the type of the molecular marker in a chicken genome and selecting the egg laying weight character of the chicken according to the genotype and is applied to early molecular breeding of the egg laying weight of the chicken, and the method is simple, rapid and low in cost, does not need a special instrument, and is suitable for large-scale popularization and application. The requirements of molecular marker-assisted breeding experiments are met.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular markers, and particularly relates to a molecular marker for identifying chicken egg production weight based on the QSOX1 gene, and an identification method and application thereof. Background Art

[0002] Egg weight is highly positively correlated with the weight of newly hatched poultry. As breeding eggs, the size of egg weight affects the uniformity of newly hatched poultry; as commercial eggs, the size of egg weight affects their sales. Most local poultry breeds in China are compact in body shape and low in weight, with small egg weight at the beginning of laying. The breeding eggs within 60 days after the start of laying cannot be used as breeding eggs due to their low egg weight, resulting in a decrease in the utilization rate of breeding eggs and a reduction in the reproductive performance of local poultry. Although increasing the weight of local poultry will increase egg weight, it will affect the market acceptance of local poultry. Therefore, during the breeding process, the egg weight within a certain period after the start of laying is gradually taken as an important index for breeding and selection. Egg weight, as an important economic trait, has complex characteristics, is regulated by multiple genes, and has a relatively high heritability (0.45 - 0.55). Therefore, it can be considered to be improved through genetic breeding and selection.

[0003] Previous studies have found that genes affecting egg weight include IGF-1, OCX32, OCX36, ER-α, TRPV6, OVR, etc. Among them, OCX32 is a matrix protein secreted by the shell gland, which can affect egg weight by influencing the shell weight. There are two restriction enzyme sites, PstⅠ (A-T mutation) and HinfⅠ (C-T mutation), in the 5' non-coding region of the IGF-1 gene in New Yangzhou chickens and Leghorn chickens, and the genotypes produced are significantly correlated with traits such as egg weight, protein weight, and yolk weight. TRPV6 (transient receptor potential cation channel subfamily V member 6) as a Ca 2+ transport protein is significantly expressed in the ovary and the uterovaginal junction of the oviduct, and participates in Ca 2+ transport in the uterus, and may be related to follicle maturation. Studying the tissue expression level of TRPV6 in ducks, it was found that the g.81465153C>G mutation in the second intron of the TRPV6 gene has a significant effect on the shell weight, and the g.81465176A>G has a significant effect on the egg weight. It can be seen that there are currently a large number of polymorphic locus screenings for egg weight. However, egg weight is composed of eggshell, egg white, and egg yolk, and any change in the weight of any component will affect the size of egg weight. The formation of each component is regulated by the expression of multiple genes. Therefore, more effective molecular markers are needed for the selection of the egg production weight trait of hens, and an egg weight breeding and selection method needs to be established. Establishing an egg weight breeding and selection method can greatly increase the economic benefits of breeding poultry and egg-laying poultry.

[0004] Quiescent protein sulfhydryl oxidase 1 (QSOX1) is an important enzyme for forming disulfide bonds, which is crucial for protein folding and stability. However, there is currently little research on the regulation of egg weight by the QSOX1 gene and molecular markers developed based on the QSOX1 gene that can be used to identify the egg production weight of chickens. Therefore, the present invention proposes a molecular marker for identifying the egg production weight of chickens based on the QSOX1 gene, as well as an identification method and application thereof. Summary of the Invention

[0005] The object of the present invention is to provide a molecular marker for identifying the egg production weight of chickens based on the QSOX1 gene, as well as an identification method and application thereof. Compared with the prior art, the present application has developed SNP (single nucleotide polymorphism) molecular markers based on the QSOX1 gene to solve the problem that the progress of conventional phenotypic breeding is slow and it is difficult to achieve early identification of the egg production weight trait at the initial stage of chicken egg production.

[0006] The present invention achieves the above object through the following technical solutions:

[0007] The present invention provides a molecular marker for identifying the egg production weight of chickens based on the QSOX1 gene. The nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, wherein the 501st base of the nucleotide sequence is G or A.

[0008] The present invention also provides an application of the above molecular marker in identifying the egg production weight trait of chickens.

[0009] As a further optimized scheme of the present invention, the egg production weight of the test chickens with the GA genotype is higher than that of the test chickens with the GG genotype.

[0010] As a further optimized scheme of the present invention, the egg production weight of the test chickens with the GA genotype is higher than that of the test chickens with the GG genotype.

[0011] The present invention also provides a method for identifying the egg production weight of chickens using the above molecular marker, including the following steps:

[0012] (1) Extract total DNA from the wing vein blood of chickens;

[0013] (2) Design specific amplification primers with the sequence composed of the locus of the molecular marker and its upstream and downstream bases as the target sequence. Using the total DNA as a template, perform PCR amplification with the specific amplification primers to obtain an amplification product;

[0014] (3) Perform genotyping detection and sequencing on the amplification product to obtain the molecular marker type of the test chickens;

[0015] (4) Determine the egg production weight trait of chickens according to the molecular marker type; among them, the egg production weight of the chickens to be tested with the GA genotype is higher than that of the chickens to be tested with the GG genotype.

[0016] As a further optimization scheme of the present invention, the breed of the chickens to be tested is Southern Anhui Sanhuang Chicken or Huainan Mahuang Chicken.

[0017] As a further optimization scheme of the present invention, the sequence of the specific amplification primer is:

[0018] SEQ ID NO.2: QSOX1-F: CGCATCCCTCCATCCCAATC;

[0019] SEQ ID NO.3: QSOX1-R: TGCAACCCAGGAGCAAAGG.

[0020] As a further optimization scheme of the present invention, the genotyping detection method is: digest the amplified product with BanⅡ restriction endonuclease to obtain the digested product, detect the digested product by agarose gel electrophoresis with a concentration of 2.0% or more by mass ratio, and perform genotyping according to the image. If the digested product contains 3 bands, it is the GG type; if it contains 4 bands, it is the GA type.

[0021] The principle of the present invention is: the up-regulation of the expression of the QSOX1 gene can promote the formation of eggshell membrane fibers, and then promote the egg formation process. Therefore, it is speculated that the QSOX1 gene causes a low egg weight in poultry by promoting the formation of proteins and eggshell fibers. The QSOX1 gene also participates in the formation process of ovalbumin and eggshell membrane proteins and is a key gene regulating egg weight.

[0022] The present invention has the following beneficial effects:

[0023] Based on the QSOX1 gene, this application has developed a molecular marker for identifying the egg production weight of chickens. The present invention selects the egg production weight trait of hens according to the genotype by identifying the type of the molecular marker existing in the chicken genome, establishes a molecular marker for screening the egg weight at the initial stage of chicken egg production and applies it to the early molecular breeding of chicken egg production weight. This method is simple, fast, low-cost, does not require special instruments, and meets the needs of molecular marker-assisted breeding experiments. Description of the Drawings

[0024] Figure 1 It is an agarose gel electrophoresis diagram of the digested product obtained by digesting the PCR amplification product of some samples. Detailed Embodiments

[0025] The present application will be further described in detail below with reference to the accompanying drawings. It is necessary to point out here that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the protection scope of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0026] 1. Materials

[0027] Unless otherwise specified, the methods used in this embodiment are conventional methods known to those skilled in the art. The reagents and other materials used are commercially available products unless otherwise specified.

[0028] 2. Methods

[0029] 2.1 Primer Design

[0030] The DNA sequence of the QSOX1 gene on chicken chromosome 8 was found from the chicken genome database, and a specific amplification primer was designed using a partial DNA sequence of the QSOX1 gene (the sequence composed of the locus where the polymorphic molecular marker of the present invention is located and its upstream and downstream bases, and the base at the mutation site 8_5996106 is G / A) as a template. The partial DNA sequence of the QSOX1 gene is shown in SEQ ID NO.1, and the specific amplification primer sequences are as follows:

[0031] SEQ ID NO.2: QSOX1-F: CGCATCCCTCCATCCCAATC;

[0032] SEQ ID NO.3: QSOX1-R: TGCAACCCAGGAGCAAAGG.

[0033] The length of the amplifiable region of this primer is 383bp, and the sequence is shown in SEQ ID NO.4, which contains the molecular marker of the G / A mutation at the 501st site of the nucleotide sequence shown in SEQ ID NO.1.

[0034] 2.2 Extraction of Total Blood DNA

[0035] Local breed hens (353 Wannan Sanhuang chickens and 450 Huainan Mahuang chickens) were selected, and blood was collected from the wing vein. Total blood DNA was extracted using a blood DNA extraction kit produced by Tiangen Biotech Co., Ltd. The extraction steps were carried out according to the kit instructions.

[0036] 2.3 PCR Amplification

[0037] Using the Mix produced by Shanghai Yisheng Biotech Co., Ltd., a PCR amplification reaction was carried out on the target fragment of the QSOX1 gene with the synthesized sequencing-specific primers;

[0038] PCR amplification reaction system: Take 1 μL of DNA, 0.4 μL of upstream primer (10 μmol / L), 0.4 μL of downstream primer (10 μmol / L), 10 μL of 2×PCR Mix, and make up the reaction system to 20 μL with dd H2O. The PCR amplification reaction conditions are as follows: denaturation at 94°C for 5 min; 40 sec at 94°C, 30 sec at 63°C, 1 min at 72°C for 35 cycles; extension at 72°C for 3 min.

[0039] 2.4 Detection and sequencing of PCR amplification products

[0040] The PCR amplification products were detected by 2% mass ratio agarose gel electrophoresis. After imaging with a gel imager, a band with an approximate length of 383 bp was obtained, which was consistent with the predicted length, indicating that the target fragment was obtained. The PCR products were sent to Beijing Tsingke Biotechnology Co., Ltd. (Nanjing), and the sequence was as shown in SEQ ID NO.4, which was consistent with the predicted result.

[0041] 2.5 Genotyping

[0042] The reaction system for the restriction enzyme digestion experiment was 10 μL, among which, 0.2 μL of restriction endonuclease (ER0281, BanⅡ, 5'GR GCY↓C 3'), 1 μL of Cut Smart buffer, 7.8 μL of dd H2O, and 1 μL of PCR amplification products. The reaction conditions were 37°C for 15 min.

[0043] The restriction enzyme digestion products were detected by 2% mass ratio low-voltage agarose gel electrophoresis, and the results (partial results) were obtained as shown in Figure 1 ; Among them, the BanⅡ enzyme can cut the DNA double strand of the homozygous wild type (GG type) into three fragments of 47 bp, 114 bp, and 222 bp. For the DNA double strand of the heterozygous type (GA type), one strand was cut into three fragments of 47 bp, 114 bp, and 222 bp by the BanⅡ enzyme, and the other strand was cut into two fragments of 222 bp and 161 bp. Therefore, four clear and bright bands were shown at 222 bp, 161 bp, 114 bp, and 47 bp in the electrophoresis pattern. If the restriction enzyme digestion products contained 3 bands, it was the GG type; if it contained 4 bands, it was the GA type.

[0044] 2.6 Effect verification

[0045] 2.6.1. To determine the association between the G / A polymorphism at the 501st base of the QSOX1 gene on chicken chromosome 8 as shown in SEQ ID NO.1 and the phenotypic trait of chicken egg production weight, 353 Wannan Sanhuang chickens in step 2.2 were used as experimental materials. The average egg weight within 60 days at the initial stage of egg production was statistically analyzed. Using the genotyping method in step 2.5, 353 Wannan Sanhuang chickens were genotyped. The results are shown in Table 1:

[0046] Table 1 Gene Frequency Analysis

[0047]

[0048]

[0049] Note: The smaller the chi-square value, the smaller the deviation degree. A P value greater than 0.05 indicates compliance with the hardy-Weinberg equilibrium.

[0050] Using the least squares analysis method in SAS9.4 software to analyze the association between the three genotypes and the phenotypic trait of chicken egg production weight, the association analysis results between different genotypes and the phenotypic trait of chicken egg production weight are shown in Table 2:

[0051] Table 2 Average Egg Production Weight during the Statistical Period for Each Genotype

[0052]

[0053] Note: a, b Different letters in the same column indicate significant differences (P<0.05), and * indicates significant correlation at the 0.05 level.

[0054] 2.6.2. To determine the association between the G / A polymorphism at the 501st base of the QSOX1 gene on chicken chromosome 8 as shown in SEQ ID NO.1 and the phenotypic trait of chicken egg production weight, 450 Huainan Mahuang chickens in step 2.2 were used as experimental materials. The average egg weight within 60 days at the initial stage of egg production was statistically analyzed. Using the genotyping method in step 2.5, 450 Huainan Mahuang chickens were genotyped. The results are shown in Table 3:

[0055] Table 3 Gene Frequency Analysis

[0056]

[0057] Note: The smaller the chi-square value, the smaller the deviation degree. A P value greater than 0.05 indicates compliance with the hardy-Weinberg equilibrium.

[0058] Using the least squares analysis method in SAS9.4 software to analyze the association between the three genotypes and the phenotypic trait of chicken egg production weight, the association analysis results between different genotypes and the phenotypic trait of chicken egg production weight are shown in Table 4:

[0059] Table 4 Average egg production weight during the statistical period of each genotype

[0060]

[0061] Note: Different letters in the same column indicate significant differences (P<0.05), and * indicates significant correlation at the 0.05 level.

[0062] Experimental conclusion: As can be seen from Table 2 and Table 4, by comparing the average egg weights during the statistical period of individuals with different genotypes, the average egg production weight of the GA genotype during the statistical period is the highest, the average egg weight of the GG genotype is medium, and the average egg weight of the AA genotype is lower.

[0063] The above embodiments only represent several implementation manners of the present invention, and their descriptions are relatively specific and detailed, but should not be construed as limiting the scope of the patent of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention.

Claims

1. A molecular marker for identifying chicken egg production weight based on the QSOX1 gene, characterized in that, The nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, wherein the 501st base of the nucleotide sequence is G or A.

2. Use of the molecular marker according to claim 1 in identifying the egg production weight trait of chickens.

3. The application according to claim 2, wherein The egg production weight of the chicken to be tested with the GA genotype is higher than that of the chicken to be tested with the GG genotype.

4. A method for identifying the egg production weight of chickens using the molecular markers as described in claim 1, characterized in that It includes the following steps: (1) Extract the total DNA from the wing vein blood; (2) Design specific amplification primers with the sequence composed of the locus of the molecular marker and its upstream and downstream bases as the target sequence. Using the total DNA as a template, perform PCR amplification with the specific amplification primers to obtain an amplification product; (3) Perform genotyping detection and sequencing on the amplification product to obtain the molecular marker type of the chicken to be tested; (4) Judge the egg production weight trait of the chicken according to the molecular marker type; wherein, the egg production weight of the chicken to be tested with the GA genotype is higher than that of the chicken to be tested with the GG genotype.

5. The method according to claim 4, characterized in that The sequences of the specific amplification primers are as follows: SEQ ID NO.2: QSOX1-F: CGCATCCCTCCATCCCAATC; SEQ ID NO.3: QSOX1-R: TGCAACCCAGGAGCAAAGG.

6. The method according to claim 4, wherein The genotyping detection method is: detect the digested product by agarose gel electrophoresis, perform genotyping according to the image. If the digested product contains 3 bands, it is the GG type; if it contains 4 bands, it is the GA type.