Method for rapidly and visually detecting drug resistance of cotton aphid to neonicotinoid insecticide
Through the combination of LAMP technology and specific primers, the rapid detection problem of cotton aphids to neonicotinoid insecticide resistance is solved, and efficient and simple detection is achieved under field conditions. The results are visualized and the detection efficiency is improved.
Patent Information
- Application Number
- CN202510716966.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-30
- Publication Date
- 2025-07-08
AI Technical Summary
In the prior art, cotton aphids have high levels of resistance to neonicotinic insecticide imidacloprid, etc., and the traditional PCR detection process is lengthy and complex, making it difficult to quickly and easily detect the nAChR β1 subunit R81T and V62I mutations of cotton aphids in the field.
LAMP technology was used to design specific primer combinations, and the R81T and V62I mutations of cotton aphid nAChR β1 subunits were combined with SYBR Green I dye. The results can be observed with naked eyes and are suitable for field conditions.
It has achieved efficient and simple detection of the resistance of cotton aphids to neonicotinoid pesticides under field conditions, greatly shortened the detection time, visualized the results, significantly improving the screening efficiency.
Smart Images

Figure CN120272613A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of drug resistance detection, and particularly relates to a composition for detecting point mutations R81T and V62I of the nAChR β1 subunit of cotton aphids and its application. Background Art
[0002] The cotton aphid (Aphis gossypii) belongs to the order Hemiptera, family Aphididae, and is one of the most serious pests on cotton. It also harms various crops such as melons and beans. The cotton aphid sucks the leaves and stems of cotton to obtain nutrients, causing the cotton leaves to curl and the plants to dwarf. The cotton aphid also excretes honeydew, induces sooty mold, and spreads viruses, seriously affecting the yield and quality of cotton.
[0003] At present, chemical control is the most important means to control this pest. Neonicotinoid insecticides such as imidacloprid are the most commonly used pesticides in production. However, with the long-term use of chemical pesticides, cotton aphids have generally developed high-level resistance to neonicotinoid insecticides such as imidacloprid. Research shows that the target mutation of the nicotinic acetylcholine receptor in cotton aphids is an important reason for the high resistance of field cotton aphids to neonicotinoid insecticides such as imidacloprid.
[0004] The emergence of drug resistance has seriously affected the sustainable use of insecticides and the efficient control of pests. With the in-depth study of the molecular mechanism of insect resistance, the molecular detection technology of resistance has become more and more mature. Loop-mediated isothermal amplification (LAMP) technology is a new type of nucleic acid amplification technology. It mainly uses two pairs of specific primers and a DNA polymerase with strand displacement activity to specifically, rapidly and efficiently amplify DNA under isothermal conditions. The result can be judged by adding a dye and observing the color change with the naked eye. It does not require a cumbersome electrophoresis process, generally completed within 1 hour. Moreover, compared with the detection method of general PCR technology, the LAMP rapid detection technology has high sensitivity, short time consumption and simple operation, and can realize the rapid identification and detection of insect mutant genotypes, suitable for rapidly and massively detecting the drug resistance of cotton aphids to insecticides under field conditions. Summary of the Invention
[0005] The purpose of the present invention is to provide a method for rapid detection of mutations R81T and V62I of the nAChR β1 subunit of cotton aphids based on LAMP technology, aiming at the disadvantages of the traditional PCR technology such as long detection process, complex operation and limited field application. By designing a specific primer combination, specific amplification of the genes containing mutations R81T and V62I in cotton aphids can be achieved. The detection can be completed without complex instruments, and the results can be directly observed with the naked eye, significantly improving the screening efficiency and being suitable for the rapid diagnosis of the drug resistance of field cotton aphids to neonicotinoid insecticides such as imidacloprid.
[0006] The above composition contains specific primers for the R81T and V62I resistance mutation sites of the β1 subunit of the cotton aphid nAChR, respectively;
[0007] The primer sequence for the R81T mutation site is:
[0008] R81T-F3: GAACGGTTTGCAGTCAAG
[0009] R81T-R3: ATAATGAAATCGAACGTTTGG
[0010] R81T-FIP: TAGACGTCTTATCCGACTACCG-ATTGCTAAGTAAGTTTCCTCC;
[0011] R81T-BIP: ACGCCTGATAAGAAACTGTTTATTT-ACGCTTGTGAGTACCAACT
[0012] The primer sequence for the V62I mutation site is:
[0013] V62I-F3: CGTCTTAAAAAAACAACATCGTA
[0014] V62I-B3: CCACGTTGATGAGTTGGATG
[0015] V62I-FIP: AACCAGACGCTCCTCGTCTT-CTGTGTTTTTTGTTTGTGTTCC
[0016] V62I-BIP: GAGATCTTTTCAGGGGCTACAAC-GCTAAACCAAATTGTACATTGAC
[0017] The object of the present invention is also to provide a kit for detecting the R81T and V62I mutations of the β1 subunit of the cotton aphid nAChR, and the kit includes the above primer combination.
[0018] In the above kit, a crude DNA extract is also included.
[0019] In the above kit, a LAMP reaction system is also included, and the LAMP reaction system includes: Bst DNA polymerase (8U / μL), 10× Thermopol Buffer, dNTPs (10 mmol / L), MgSO4 solution (100 mmol / L), and betaine solution (10 mmol / L).
[0020] In the above kit, SYBR Green I dye is also included.
[0021] The object of the present invention also lies in providing the use of the above-mentioned composition or the above-mentioned kit in detecting the resistance of cotton aphids to neonicotinoid insecticides.
[0022] The object of the present invention also lies in providing a method for detecting the resistance of cotton aphids to neonicotinoid insecticides, which comprises the following steps:
[0023] (1) After picking a single cotton aphid and thoroughly grinding it in the DNA crude extraction buffer 1, add buffer 2 and mix well for DNA extraction;
[0024] (2) Prepare a reaction system, add the above-mentioned crudely extracted DNA template into the reaction system solution for amplification reaction to obtain an amplification product;
[0025] (3) Add SYBR Green I dye to the obtained amplification product, and based on the color reaction, determine whether there are R81T and V62I mutations in the cotton aphids, that is, whether they are resistant to neonicotinoid insecticides.
[0026] The said reaction system includes:
[0027] 10×Thermopol Buffer 2.5 μL;
[0028] dNTPs (10 mmol / L) 2.0 μL - 3.5 μL;
[0029] MgSO4 solution (100 mmol / L) 0.5 μL - 1.0 μL;
[0030] Betaine solution (10 mmol / L) 1.5 μL - 2.5 μL
[0031] R81T-F3 / V62I-F3 (10 μmol / L) 0.5 μL;
[0032] R81T-B3 / V62I-B3 (10 μmol / L) 0.5 μL;
[0033] R81T-FIP / V62I-FIP (10 μmol / L) 2.0 μL;
[0034] R81T-BIP / V62I-FIP (10 μmol / L) 2.0 μL;
[0035] Bst DNA polymerase (8 U / μL) 1.0 μL;
[0036] The conditions of the said amplification reaction are: 63°C - 65°C, 45 min - 90 min, 80°C, 5 - 10 min.
[0037] Compared with other existing technologies, the field detection composition and kit for detecting the R81T and V62I mutations of the nAChR β1 subunit in cotton aphids of the present invention have the following advantages and positive effects:
[0038] 1. The present invention detects whether the base at position 242 of the nAChR β1 subunit in cotton aphids has a G-to-C point mutation and whether the base at position 184 has a G-to-A point mutation. Specific primers are designed accordingly, and loop-mediated isothermal amplification (LAMP) technology is used to achieve isothermal rapid amplification of the resistance cotton aphid R81T and V62I mutation sites, enabling the detection of the R81T and V62I mutations of the nAChR β1 subunit in cotton aphids without relying on laboratory conditions and equipment, and can be efficiently detected under field conditions.
[0039] 2. The present invention provides two pairs of primers for specifically detecting the R81T and V62I point mutations generated by resistant cotton aphids, and establishes a highly efficient, accurate and convenient visual detection kit, which greatly shortens the single-sample detection time, can detect DNA templates with a concentration of 1 - 10 fg / μL, and the detection results can be directly observed by the naked eye, and can be used for the detection of the R81T and V62I mutations of the nAChR β1 subunit in cotton aphids.
[0040] 3. The kit provided by the present invention can adapt to field conditions for detection through a portable constant temperature device, improving environmental compatibility. The result can be determined by observing the color change with the naked eye, significantly reducing the technical threshold of detection, and realizing the on-site detection mode of "sample in - result out". Description of the Drawings
[0041] Figure 1 . is the LAMP amplification result after adding dye and the electrophoresis pattern of the amplification product; where: the wild type is the individual without the R81T mutation, and the mutant type is the individual with the R81T mutation
[0042] Figure 2 . is the LAMP amplification result after adding dye and the electrophoresis pattern of the amplification product; where: the wild type is the individual without the V62I mutation, and the mutant type is the individual with the V62I mutation
[0043] Figure 3 . is the sensitivity detection of the LAMP reaction to the R81T mutation of cotton aphid DNA, and the reaction result is based on the color change after adding SYBR Green I dye; where, 1 = 10 6 fg / μL, 2 = 10 5 fg / μL, 3 = 10 4 fg / μL, 4 = 10 3 fg / μL, 5 = 10 2fg / μL, 6 = 10 fg / μL, 7 = 1 fg / μL, 8 is the blank control
[0044] Figure 4 . For the sensitivity detection of the LAMP reaction to the DNA V62I mutation of Aphis gossypii, the reaction results are based on the color change after adding SYBR Green I dye; among them, 1 = 10 6 fg / μL, 2 = 10 5 fg / μL, 3 = 10 4 fg / μL, 4 = 10 3 fg / μL, 5 = 10 2 fg / μL, 6 = 10 fg / μL, 7 = 1 fg / μL, 8 is the blank control
[0045] Figure 5 . For the comparison between the LAMP detection results and the sequencing results of the DNA acetylcholine receptor β1 subunit R81T mutation of 16 Aphis gossypii in Tai'an area
[0046] Figure 6 . For the comparison between the LAMP detection results and the sequencing results of the DNA acetylcholine receptor β1 subunit V62I mutation of 16 Aphis gossypii in Handan area Detailed implementation mode
[0047] The detailed implementation mode of the present invention will illustrate the technical solution through examples in detail, but the examples are only used for illustration rather than limiting the protection scope. Based on these implementation modes, those skilled in the art can obviously derive other equivalent or similar technical solutions without creative labor, and these solutions are all within the protection scope of the present invention. The materials, reagents and devices used in the implementation process of the present invention are all conventional commercially available products.
[0048] Example 1
[0049] According to a composition for detecting the R81T and V62I mutations of the nAChR β1 subunit of Aphis gossypii,
[0050] The primer sequences for the R81T mutation site are as follows:
[0051] R81T-F3: GAACGGTITGCAGTCAAG
[0052] R81T-R3: ATAATGAAATCGAACGTTTGG
[0053] R81T-FIP: TAGACGTCTTATCCGACTACCG-ATTGCTAAGTAAGTTTCCTCC;
[0054] R81T-BIP: ACGCCTGATAAGAAACTGTTTATTT-ACGCTTGTGAGTACCAACT
[0055] The primer sequences for the V62I mutation site are as follows:
[0056] V62I-F3: CGTCTTAAAAAAACAACATCGTA
[0057] V62I-B3: CCACGTTGATGAGTTGGATG
[0058] V62I-FIP: AACCAGACGCTCCTCGTCTT-CTGTGTTTTTTGTTTGTGTTCC
[0059] V62I-BIP: GAGATCTTTTCAGGGGCTACAAC-GCTAAACCAAATTGTACATTGAC
[0060] The kit for the field detection of R81T and V62I mutations in the β1 subunit of the cotton aphid nAChR includes: the above primers, and also includes a LAMP reaction system. The LAMP reaction system includes: Bst DNA polymerase (8U / μL), 10× Thermopol Buffer, dNTPs (10 mmol / L), MgSO4 solution (100 mmol / L), and betaine solution (10 mmol / L). It also includes a crude DNA extract and a chromogenic reagent SYBR Green I dye.
[0061] For example, the above solutions can specifically be:
[0062] 1) 10 mL of 10× Thermopol Buffer (New England Biolad);
[0063] 2) 20 mL of 100 mM MgSO4 solution (New England Biolad);
[0064] 3) 12 mL of 10 mM dNTP (Mixture) (TransGen Biotech Co., Ltd.);
[0065] 4) 1.2 mL of 10 μM outer primers R81T-F3 / V62I-F3 and R81T-B3 / V62I-B3;
[0066] 5) 14 mL of 10 μM inner primers R81T-FIP / V62I-FIP and R81T-BIP / V62I-BIP;
[0067] 6) 3200U (8U / μL) Bst DNA polymerase (New England Biolad);
[0068] 7) 1 mL of 10,000×SYBR Green I (Aidlab);
[0069] 8) 5 mL of DNA crude extraction buffer 1 (Tiangen Biochemical Technology (Beijing) Co., Ltd.);
[0070] 9) 5 mL of DNA crude extraction buffer 2 (Tiangen Biochemical Technology (Beijing) Co., Ltd.);
[0071] 10) 20 mL of 6M betaine (Aidlab).
[0072] During the reaction, the reaction system is prepared using the above reagents. For example, the reaction system (25 μL) includes:
[0073] 10×Thermopol Buffer 2.5 μL;
[0074] dNTPs (10 mmol / L) 2.5 μL;
[0075] MgSO4 solution (100 mmol / L) 1.0 μL;
[0076] Betaine solution (10 mmol / L) 2.0 μL
[0077] R81T-F3 / V62I-F3 (10 μmol / L) 0.5 μL;
[0078] R81T-B3 / V62I-B3 (10 μmol / L) 0.5 μL;
[0079] R81T-FIP / V62I-FIP (10 μmol / L) 2.0 μL;
[0080] R81T-BIP / V62I-BIP (10 μmol / L) 2.0 μL;
[0081] DNA template 1.0 μL;
[0082] Bst DNA polymerase (8U / μL) 1.0 μL;
[0083] Make up to 25 μL with ddH2O and add 20 μL of paraffin oil for liquid sealing.
[0084] Example 2: Specificity and accuracy verification test of LAMP reaction
[0085] First, pick a single-headed cotton aphid and place it in a 1.5 mL centrifuge tube. Add 10 μL of DNA crude extraction buffer 1, and use a grinding rod to grind it thoroughly. Then add 10 μL of DNA crude extraction buffer 2, mix well, and set aside. Pipette 1.0 μL of this DNA template into a reaction system containing 10× Thermopol Buffer, dNTP, MgSO4, four specific circularization primers, and DNA Bst I polymerase (as in Example 1), and perform isothermal amplification at 63 °C for 45 min and at 80 °C for 10 min.
[0086] After the LAMP reaction is completed, take 5 μL of the amplification product, mix it with 1.0 μL of 6× Loading buffer, and perform electrophoresis in a 1.0% agarose gel. Use a gel imaging system to observe the electrophoresis results and image them. The results are as Figure 1 and Figure 2 shown. For R81T and V62I mutant cotton aphids, corresponding amplified ladder band products are obtained by amplifying with specific primers R81T-F3 / R81T-B3 / R81T-FIP / R81T-BIP (V62I-F3 / V62I-B3 / V62I-FIP / V62I-BIP), while wild-type cotton aphids and the water control do not have corresponding amplification products.
[0087] In the amplified solution, add 1.0 μL of 10000× SYBR Green I dye and observe the color reaction. If a large amount of amplification product is generated, adding SYBR Green I dye will form a clearly distinguishable yellow-green color with the naked eye. If no amplification product is generated, adding SYBR Green I dye will not change the color, and it will still be brown. After adding the dye, the resistant cotton aphids will produce a yellow-green color, and the sensitive cotton aphids will be brown (as Figure 1 and Figure 2 shown).
[0088] Example 3: Detection sensitivity of R81T and V62I mutant cotton aphid DNA by LAMP technology
[0089] Dilute the cotton aphid DNA containing R81T / V62I mutation with a concentration of about 10 6 fg / μL by 10-fold serial dilution. Take 1.0 μL of each dilution as the DNA template for LAMP amplification. The LAMP amplification results are as Figure 3 and Figure 4 shown. When the DNA template concentration is as low as 1 - 10 fg / μL, the LAMP amplification product can still change color after adding SYBR Green I fluorescent dye, proving that the template can be detected (as Figure 3 and Figure 4 shown).
[0090] Example 4: Detection of R81T Mutation in the β1 Subunit of Acetylcholine Receptor nAChR in Cotton Aphids in the Field
[0091] According to this study, the DNA of 16 cotton aphids was selected to detect the specificity of the LAMP primers. All 16 cotton aphids were from Tai'an, Shandong. The DNA of these 16 cotton aphids was taken for PCR, and the PCR products were sent to the company for sequencing to ensure the accuracy of the results by comparison.
[0092] Using the primers and kits of Example 1, detection was carried out according to the method shown in Example 2.
[0093] The results are as Figure 5 shown. In the LAMP amplification reaction with the DNA of 16 cotton aphid populations in the Tai'an field as the template, after adding SYBR Green I dye, 14 cotton aphid DNAs showed yellow-green color, proving that specific amplification occurred. The DNA of 2 cotton aphids did not undergo an amplification reaction. It corresponded accurately with the sequencing results, indicating that the accuracy rate of LAMP detection reached 100%.
[0094] Example 5: Detection of V62I Mutation in the β1 Subunit of Acetylcholine Receptor nAChR in Cotton Aphids in the Field
[0095] In this study, the DNA of 16 cotton aphids was selected to detect the specificity of the LAMP primers. All 16 cotton aphids were from Handan, Hebei. The DNA of these 16 cotton aphids was taken for PCR, and the PCR products were sent to the company for sequencing to ensure the accuracy of the results by comparison.
[0096] Using the primers and kits of Example 1, detection was carried out according to the method shown in Example 2.
[0097] The results are as Figure 6 shown. In the LAMP amplification reaction with the DNA of 16 cotton aphid populations in the Handan field as the template, after adding SYBR Green I dye, 15 cotton aphid DNAs showed yellow-green color, proving that specific amplification occurred. The DNA of 1 cotton aphid did not undergo an amplification reaction. It corresponded accurately with the sequencing results, indicating that the accuracy rate of LAMP detection reached 100%.
Claims
1. A rapid visual molecular detection method for the resistance of cotton aphids to neonicotinoid insecticides based on the loop-mediated isothermal amplification (LAMP) technique, characterized in that, A LAMP primer combination for detecting the R81T mutation site of the nAChR β1 subunit of cotton aphids, wherein the primer combination includes two pairs of primers, namely outer primers and inner primers; the outer primers are: R81T-F3: GAACGGTTTGCAGTCAAG R81T-R3: ATAATGAAATCGAACGTTTGG The inner primers are: R81T-FIP: TAGACGTCTTATCCGACTACCG-ATTGCTAAGTAAGTTTCCTCC; R81T-BIP: ACGCCTGATAAGAAACTGTTTATTT-ACGCTTGTGAGTACCAACT.
2. A LAMP primer combination for detecting the V62I mutation site of the nAChR β1 subunit of cotton aphids, wherein the primer combination includes two pairs of primers, namely outer primers and inner primers; The outer primers are: V62I-F3: CGTCTTAAAAAAACAACATCGTA V62I-B3: CCACGTTGATGAGTTGGATG The inner primers are: V62I-FIP: AACCAGACGCTCCTCGTCTT-CTGTGTTTTTTGTTTGTGTTCC V62I-BIP: GAGATCTTTTCAGGGGCTACAAC-GCTAAACCAAATTGTACATTGAC.
3. A kit for detecting the R81T and V62I mutations of the β1 subunit of the cotton aphid nAChR, characterized in that, Including the composition according to claim 1 or 2.
4. The kit according to claim 3, wherein, Including the following steps: (1) Pick a single cotton aphid and extract DNA in a crude DNA extraction solution; (2) Prepare a reaction system, add the above DNA template to the reaction system solution for amplification reaction to obtain an amplification product; (3) Add a color reagent to the obtained amplification product, and determine whether there is a mutation at the R81T and V62I sites of the acetylcholine receptor β1 subunit of cotton aphids according to the color reaction. After the reaction ends, if the reaction solution is yellowish-green, it indicates that the sample is a resistant individual; if the reaction solution remains brown, it indicates that the sample is a sensitive individual.
5. The kit according to claim 4, wherein, Including a crude DNA extraction solution.
6. The kit according to claim 4, characterized in that, Including the composition according to claim 1 or 2.
7. The kit according to claim 4, wherein It also includes: Bst DNA polymerase (8U / μL), 10× Thermopol Buffer, dNTPs (10 mmol / / L), MgSO4 solution (100 mmol / L), and betaine solution (10 mmol / L).
8. The chromogenic reagent according to claim 4, wherein Including SYBR Green I dye.
9. Use of the composition according to claim 1 or 2 or the kit according to any one of claims 4 to 8 in detecting the R81T and V62I mutations of the nAChRβ1 subunit of cotton aphids.
10. The method according to claim 4, characterized in that, The reaction system includes: 10× Thermopol Buffer 2.5 μL; dNTPs (10 mmol / L) 2.0 μL - 3.5 μL; MgSO4 solution (100 mmol / L) 0.5 μL - 1.0 μL; Betaine solution (10 mmol / L) 1.5 μL - 2.5 μL R81T-F3 / V62I-F3 (10 μmol / L) 0.5 μL; R81T-B3 / V62I-B3 (10 μmol / L) 0.5 μL; R81T-FIP / V62I-FIP (10 μmol / L) 2.0 μL; R81T-BIP / V62I-BIP (10 μmol / L) 2.0 μL; Bst DNA polymerase (8 U / μL) 1.0 μL; The conditions of the amplification reaction are: 63°C to 65°C, 45 min to 90 min, 80°C, 5 to 10 min.