Method for identifying Vietnam camellia oleifera, small-fruit camellia oleifera and common camellia oleifera

Abstract

The invention relates to the technical field of molecular markers, and particularly provides a method for identifying Vietnam camellia oleifera, small-fruit camellia oleifera and common camellia oleifera. According to the identification method, the amplification primer pair provided by the invention is used for detecting the specific SNP sites, and the camellia oleifera varieties are distinguished according to the SNP. The amplification primer pair comprises a forward primer 5 'CCATAAGTGATTGGAAGTAG3' and a reverse primer 5 'GAGCCATAACTAACAGAAG3', the camellia tonkinensis is subjected to base mutation at the 213th site of an amplified fragment to obtain 'A', and the camellia microcarpa is subjected to base mutation at the 213th site of the amplified fragment to obtain 'G'; the common camellia oleifera is subjected to base mutation at the 213th site of the amplified fragment to be T. The method is simple, rapid and accurate, and provides technical support for classification identification and molecular breeding selection of related camellia oleifera resources.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and plant molecular breeding, and particularly relates to an identification method for Vietnamese camellia, small-fruit camellia and common camellia. Background Art

[0002] Camellia oleifera, along with coconut, olive, and oil palm, is considered one of the world's four major woody oil crops. It is one of my country's key woody oil resource development areas and an important staple oil crop. Camellia oil, produced from camellia seeds, is rich in unsaturated fatty acids, with a content of approximately 90%, and is hailed as a high-quality health-promoting edible oil. Currently, the cultivated area of ​​camellia oleifera in China has reached approximately 90 million mu (approximately 1.6 million hectares). Cultivated camellias in my country primarily include multiple species of the genus Camellia in the Theaceae family, with core cultivars including common camellia, small-fruited camellia, and Vietnamese camellia. These three species exhibit high morphological similarities, making them particularly difficult to distinguish at the seedling stage. Furthermore, significant variation in leaf traits and other characteristics under different habitats complicates species identification. This not only poses challenges to camellia production management but also hinders the healthy development of the industry. Furthermore, accurate identification of parental lines is crucial for improving breeding efficiency in camellia breeding. However, morphological similarities and the difficulty of identifying parental lines at the seedling stage have severely hampered breeding progress. Compared to chloroplast and nuclear genome information, the mitochondrial genome is more conserved and less variable, making primers designed based on it more suitable for the rapid identification of complex species. Therefore, there is an urgent need to establish a rapid, accurate, and efficient technical means to accurately identify and type Camellia oleifera germplasm resources, thereby better supporting the sustainable development of the Camellia oleifera industry. Summary of the Invention

[0003] In order to overcome some of the defects in the existing technology, the present invention performed mitochondrial whole genome sequencing and comparative analysis on one germplasm of each of the three main cultivated tea species, Camellia oleifera, Camellia oleifera and Camellia oleifera, screened out single-base variation sites that can be used to identify these three species, and developed SNP markers, as well as detection primers and methods.

[0004] The purpose of the present invention is to provide mitochondrial genome SNP sites for identifying three Camellia oleifera species germplasm resources as well as specific primers and an identification method for identifying the three Camellia oleifera species germplasm resources.

[0005] To achieve the above object, the present invention provides the following technical solutions: The first aspect of the present invention provides a specific primer pair for identifying Vietnamese camellia, small-fruit camellia and common camellia; The specific primer pair includes a forward primer and a reverse primer; The sequence of the forward primer was: 5′CCATAAGTGATTGGAAGTAG3′; The sequence of the reverse primer was: 5′GAGCCATAACTAACAGACAG3′; In the PCR amplification product of Vietnamese camellia, a base mutation occurred at the 213th position of the amplified fragment to "A"; in the PCR amplification product of small-fruit camellia, a base mutation occurred at the 213th position of the amplified fragment to "G"; in the PCR amplification product of common camellia, a base mutation occurred at the 213th position of the amplified fragment to "T".

[0006] A second aspect of the present invention provides a method for identifying or assisting in identifying Vietnamese camellia, small-fruit camellia, and common camellia, comprising the following steps: S1. Extracting total genomic DNA from the tested Camellia oleifera germplasm materials; S2. Using the DNA of the sample to be tested extracted in step S1 as an amplification template, the SNP-specific primers are used to perform PCR amplification on the DNA of the sample to be tested to obtain a PCR amplification product; S3. Detection of PCR amplification products: PCR amplification products were electrophoresed on a 1% agarose gel containing 8% Goldview nucleic acid dye at 100 V for 40 min in 1× TBE buffer. The gel run was photographed using a gel imaging system. Using 5000 bp DNA as a marker, only one amplification product band of 456 bp in size was observed, indicating the target band. S4. Sequencing of PCR amplification products: The PCR amplification products were sequenced using conventional Sanger first-generation sequencing. At the 213th position of the amplification product, the germplasm base "A" was for Vietnamese Camellia oleifera, the germplasm base "G" was for small-fruit Camellia oleifera, and the germplasm base "T" was for common Camellia oleifera.

[0007] Furthermore, in step S2, the PCR reaction system used was 30 μL: 10.0 μL of ddH2O, 15.0 μL of 2×Taq PCR Master Mix, 1.0 μL of total genomic DNA, 2.0 μL of forward primer, and 2.0 μL of reverse primer; PCR amplification program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 30 sec, for 35 cycles; final extension at 72°C for 10 min, and storage at 4°C.

[0008] Beneficial effects of the present invention: Compared with the chloroplast genome and nuclear genome sequence information, the mitochondrial genome sequence information is more conservative. The specific molecular marker technology developed based on its variant sites has higher accuracy and is not affected by environmental factors. There is no need to wait for the plants to bloom or bear fruit. Only a very small amount of fresh tissue samples, or tissue samples that have been quickly dried with silica gel, are needed to accurately and efficiently identify plant germplasm resources. By selecting a representative germplasm material from each of the three main camellia species, Camellia oleifera, Camellia oleifera, and Camellia oleifera, and conducting mitochondrial whole genome sequencing and comparative analysis, the present invention successfully developed a SNP marker based on the mitochondrial genome. The detection system based on its marker can quickly and accurately distinguish and identify germplasm resources such as Camellia oleifera, Camellia oleifera, and Camellia oleifera. This technology provides strong technical support for the healthy development of my country's camellia industry. At the same time, it also has important application value in exploring the origin and evolution of camellia oleifera resources and promoting molecular breeding of camellia oleifera. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 This is the electrophoresis diagram of the LH-1 primer amplification product in the example.

[0010] Figure 2 This is the peak diagram result of some bases in the LH-1 marker site sequencing; Figure 3 This is the phylogenetic tree obtained by UPGMA cluster analysis of different Camellia oleifera germplasms. DETAILED DESCRIPTION

[0011] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the appended claims, these changes are obvious, and all inventions and creations utilizing the concepts of the present invention are protected.

[0012] Example 1 Molecular Identification of Germplasm Resources of Different Camellia oleifera Species

[0013] 1. Select experimental materials A total of 30 samples (Table 1) from three major cultivated Camellia oleifera species distributed in South China were collected for SNP-specific marker validation: 10 samples from five populations of Camellia oleifera in Hainan Province, 10 samples from three populations of Camellia microcarpa in Fujian Province, and 10 samples from three populations of Camellia oleifera in Hunan, Anhui, and Zhejiang Provinces.

[0014] 2. SNP marker detection 2.1 The modified CTAB method was used to extract the total DNA of the above-mentioned experimental materials, Camellia oleifera samples; 2.2 Using the DNA of the Camellia oleifera sample extracted in step 2.1 as the amplification template and the developed specific labeled primer LH-1 as the amplification primer, perform PCR amplification; The LH-1 comprises: Forward primer (SEQ ID No. 1): 5′CCATAAGTGATTGGAAGTAG3′; Reverse primer (SEQ ID No. 2): 5′GAGCCATAACTAACAGACAG3′; 2.3 PCR reaction system: The volume was 30 μL, including 10.0 μL of ddH2O, 15.0 μL of 2× Taq PCR Master Mix, 1.0 μL of genomic DNA (~20 ng), 2.0 μL of LH-1 forward primer, and 2.0 μL of LH-1 reverse primer. The amplification procedure was as follows: initial denaturation at 95°C for 5 min; 35 cycles of denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec, and extension at 72°C for 30 sec; and a final extension at 72°C for 10 min. The DNA was then stored at 4°C.

[0015] The PCR amplification products were electrophoresed on a 1.5% agarose gel (containing 8% Goldview nucleic acid dye) in 1× TBE buffer at 240 V for 7 min. The gel run was photographed and recorded using a gel imaging system.

[0016] 2.4 The above PCR products were sequenced using the conventional Sanger first-generation sequencing method.

[0017] 3. Identification results: The sequencing results were analyzed to find the SNPs mentioned above and identify the Vietnamese Camellia oleifera, Camellia microcarpa and Camellia oleifera germplasm materials. The test results are shown in Table 1. Figure 1 、 Figure 2 and Figure 3 shown.

[0018] Table 1 Specific SNP analysis table for identifying different Camellia oleifera species resources

[0019] Table 1 clearly shows that the primer LH-1 amplifies the target fragment at position 213 in the 30 test materials, which is SNP 1. For example, if the test germplasm material has an "A" base sequence at SNP 1, it is a Vietnamese camellia; if the test germplasm material has a "G" base sequence at SNP 1, it is a small-fruit camellia; and if the test germplasm material has a "T" base sequence at SNP 1, it is a common camellia.

[0020] Depend on Figure 1 and Figure 2It can be clearly shown that: The results show that the length of the mitochondrial gene fragment amplified by primer LH-1 is 456bp (see Appendix Figure 1 The mitochondrial gene fragment amplified by primer LH-1 has a SNP site (SNP1). If the amplified target fragment SNP1 is an "A" base sequence, the germplasm can be accurately identified as Vietnamese Camellia oleifera; if SNP 1 is a "G" base sequence, the germplasm can be accurately identified as small-fruit Camellia oleifera; if SNP 1 is a "T" base sequence, the germplasm can be accurately identified as common Camellia oleifera.

[0021] Figure 3 The UPGMA cluster tree analysis results were obtained using the UPGMA clustering method to construct a cluster tree for 30 samples. Small-fruited camellia (FJHB, FJSM, and FJXG) clustered into cluster 1; common camellia (XYPT, NHWT, and ZJHZ) clustered into cluster 2; and Vietnamese camellia (JZSC, JZSC, SMP, WCNS, YCW, and WCPS) clustered into cluster 3. Small-fruited camellia and common camellia first clustered into a large clade and then clustered with Vietnamese camellia, consistent with the phylogenetic relationship among the three species. These results demonstrate that this method is effective in identifying germplasm resources from small-fruited camellia, common camellia, and Vietnamese camellia, and that the developed LH-1-specific SNP marker is effective, accurate, and reliable.

[0022] Specific embodiments are used in the present invention to illustrate the principles and implementation methods of the present invention. The description of the above embodiments is only used to help understand the method of the present invention and its core ideas. At the same time, for those skilled in the art, according to the ideas of the present invention, there may be changes in the specific implementation methods and application scopes. In summary, the contents of this specification should not be understood as limiting the present invention.

Claims

1. A SNP-specific primer pair for identifying Vietnamese Camellia oleifera, Camellia microcarpa and Camellia oleifera, characterized in that: The specific primer pair includes a forward primer and a reverse primer; The sequence of the forward primer was: 5′CCATAAGTGATTGGAAGTAG3′; The sequence of the reverse primer was: 5′GAGCCATAACTAACAGACAG3′; In the PCR amplification product of Vietnamese Camellia oleifera, the base mutation occurred at the 213th position of the amplified fragment to "A"; in the PCR amplification product of small-fruit Camellia oleifera, the base mutation occurred at the 213th position of the amplified fragment to "G"; in the PCR amplification product of common Camellia oleifera, the base mutation occurred at the 213th position of the amplified fragment to "T".

2. A method for identifying or assisting in identifying Vietnamese camellia, small-fruit camellia and common camellia, characterized in that: The steps include: S1. Extracting total genomic DNA from the tested Camellia oleifera germplasm materials; S2. Using the DNA of the sample to be tested extracted in step S1 as an amplification template, PCR amplification is performed on the DNA of the sample to be tested using the SNP-specific primers described in claim 1 to obtain a PCR amplification product; S3. Detection of PCR amplification products: PCR amplification products were electrophoresed on a 1% agarose gel containing 8% Goldview nucleic acid dye at 100 V for 40 min in 1× TBE buffer. The gel run was photographed using a gel imaging system. Using 5000 bp DNA as a marker, only one amplification product band of 456 bp in size was observed, indicating the target band. S4. Sequencing of PCR amplification products: The PCR amplification products were sequenced using conventional Sanger first-generation sequencing. At the 213th position of the amplification product, the germplasm base "A" was for Vietnamese Camellia oleifera, the germplasm base "G" was for small-fruit Camellia oleifera, and the germplasm base "T" was for common Camellia oleifera.

3. The method for identifying or assisting in identifying Vietnamese camellia, small-fruit camellia and common camellia according to claim 2, characterized in that: In step S2, the PCR reaction system used was 30 μL: 10.0 μL of ddH2O, 15.0 μL of 2×Taq PCR Master Mix, 1.0 μL of total genomic DNA, 2.0 μL of forward primer, and 2.0 μL of reverse primer; PCR amplification program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 30 sec, for 35 cycles; final extension at 72°C for 10 min, and storage at 4°C.

Images