KASP molecular marker and application thereof in identifying number of main stem nodes of soybean variety

Abstract

The invention provides a KASP molecular marker and application of the KASP molecular marker in identifying the number of main stem nodes of a soybean variety, and particularly develops two KASP molecular markers which are remarkably related to the number of main stem nodes of the soybean, the two KASP molecular markers comprise Chr06-47409386 (qMSN6) and Chr19-45135078 (qMSN19), the Chr06-47409386 marker sites have A / G mutation (namely, A / G mutation exists at the 86th site of the sequence shown in SEQ ID NO: 1), the Chr19-45135078 marker sites have A / T mutation (namely, A / T mutation exists at the 78th site of the sequence shown in SEQ ID NO: 2), and the two KASP molecular markers are used for identifying the number of The excellent allelic variations of the two marker sites are G and A respectively, the disadvantageous allelic variations of the two marker sites are A and T respectively, the soybean genotype is rapidly detected by using the molecular marker, and it is found that the mean value of the number of main stem nodes of a soybean variety with the haplotype being GA is significantly higher than that of a soybean variety with the haplotype being AT. The KASP molecular marker can be used for sensitively and efficiently predicting the number of soybean main stem nodes at low cost, is beneficial to assisting soybean molecular breeding, screens and cultivates high-yield and high-quality soybean varieties, and further shortens the breeding process.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and in particular relates to a KASP molecular marker and an application thereof in identifying the number of main stem nodes of soybean varieties. Background Art

[0002] Soybean (Glycine max) is an important grain and oil crop in my country. Its yield and adaptability are significantly affected by plant structure, and the main stem node number (MSN) is one of the key agronomic traits that determine plant height, branch number and pod-setting habits. Traditional breeding relies on phenotypic selection, but MSN is easily affected by environmental factors, with low selection efficiency and long cycle. With the development of molecular marker technology, precise selection based on single nucleotide polymorphism (SNP) has become an important means of modern soybean genetic improvement.

[0003] In recent years, through linkage mapping and genome-wide association study (GWAS), researchers have identified multiple QTLs (quantitative trait loci) that regulate the number of nodes in the main stem of soybean. For example, the SoyBase database contains 38 MSN-related QTLs (based on linkage mapping), and another 45 MSN QTLs have been reported through GWAS. Fu et al. (2022) used RTM-GWAS (random effects mixed model GWAS) to identify 76 MSN QTLs (including 183 alleles) in 306 Northeast soybean germplasms, explaining 65.63% of the phenotypic variation (PV). Fahim et al. (2023) detected 151 MSN QTLs (587 alleles) in 821 Chinese cultivated soybeans, covering major effect sites and QTL-environment interaction (QEI) sites, with a cumulative contribution rate of 90.64% PV. These studies provide key targets for the development of molecular markers for MSN, but existing markers are mostly based on high-throughput sequencing, which is costly and complex to operate, making them difficult to directly apply in breeding practice.

[0004] Competitive allele-specific PCR (KASP) is a SNP typing technology based on fluorescence detection, which has the following advantages: high throughput and low cost, thousands of samples can be tested simultaneously, and the cost of a single SNP typing test is as low as 2.3 yuan; high precision, based on dual fluorescent probe design, with an accuracy rate of >99.5%; strong equipment compatibility, only requires an ordinary real-time fluorescence PCR instrument, and no complex sequencing platform is required; it is suitable for large-scale breeding screening, especially for the early selection of complex quantitative traits such as MSN.

[0005] Currently, the development of KASP markers related to soybean MSN still faces challenges. For example: insufficient verification of functional sites, large QTL intervals for most (>1 Mb), requiring fine mapping of key SNPs; poor marker universality, some markers are only effective in specific populations and are limited in cross-ecological region applications; the multi-gene co-regulation mechanism is complex, and the single SNP explanation rate is low, requiring the development of multi-locus combination markers. Summary of the Invention

[0006] Aiming at the problems of the prior art, the present invention provides KASP molecular markers and their application in identifying the number of main stem nodes of soybean varieties. Specifically, the present invention intends to screen functional SNPs based on the new GWAS significant loci Chr06-47409386 and Chr19-45135078, develop stable KASP markers, and design multi-locus combination markers by combining haplotype analysis, and verify their stability across environments to improve the prediction accuracy of MSN variation.

[0007] The KASP markers developed in this application can be applied to marker-assisted selection (MAS) to early screen materials with ideal plant types and shorten the breeding cycle. Developing efficient KASP markers based on the main stem node loci is of great significance for realizing precise breeding of soybean and improving the yield level, meeting the needs of "reducing losses and increasing efficiency" in China's soybean industry.

[0008] In this case, the present invention includes but is not limited to the following: In one aspect, the present invention provides KASP molecular markers related to the number of main stem nodes of soybean. The nucleotide sequence of the first KASP molecular marker is as shown in SEQ ID NO: 1, and there is an A / G base mutation at the 86th position of the sequence shown in SEQ ID NO: 1; and the nucleotide sequence of the second KASP molecular marker is as shown in SEQ ID NO: 2, and there is an A / T base mutation at the 78th position of the sequence shown in SEQ ID NO: 2.

[0009] In another aspect, the present invention provides a primer set for detecting the KASP molecular markers of the present invention, characterized in that the primer set includes: The primer set for detecting the first KASP molecular marker includes: upstream primer F1’, upstream primer F2’ and common downstream primer R1. The nucleotide sequence of the upstream primer F1’ is 5’-ATGGAGGAGGATGTTGATTGAA-3’, the nucleotide sequence of the upstream primer F2’ is 5’-ATGGAGGAGGATGTTGATTGAG-3’, and the nucleotide sequence of the common downstream primer R1 is 5’-ATGGAGGAGGATGTTGATTGAG-3’; The primer set for detecting the second KASP molecular marker includes: upstream primer F3’, upstream primer F4’ and universal downstream primer R2. The nucleotide sequence of the upstream primer F3’ is 5’-ATATATGTAAAATGATATAAAAACA-3’, the nucleotide sequence of the upstream primer F4’ is 5’-ATATATGTAAAATGATATAAAAACT-3’, and the nucleotide sequence of the universal downstream primer R2 is 5’-ATTGATAAATTATTTTTTGAGTAATATTT-3’.

[0010] In one aspect, tags for distinguishing the base types at the first KASP molecular marker are connected to the 5’ ends of the upstream primer F1’ and the upstream primer F2’ of the present invention; and tags for distinguishing the base types at the second KASP molecular marker are connected to the 5’ ends of the upstream primer F3’ and the upstream primer F4’.

[0011] In one aspect, linker sequences are respectively connected between the upstream primer F1’, the upstream primer F2’, the upstream primer F3’ and / or the upstream primer F4’ and the tags of the present invention.

[0012] In one aspect, the linker sequences connected between the upstream primer F1’ and the tag and between the upstream primer F3’ and the tag are gaaggtgaccaagttcatgct, and the linker sequences connected between the upstream primer F2’ and the tag and between the upstream primer F4’ and the tag are gaaggtcggagtcaacggatt.

[0013] In one aspect, the tags for distinguishing the base types at the first and second KASP molecular markers of the present invention are fluorescein.

[0014] In one aspect, the fluorescein connected to the upstream primer F1’ and the upstream primer F3’ is 6-carboxyfluorescein, and the fluorescein connected to the upstream primer F2’ and the upstream primer F4’ is hexachloro-6-methylfluorescein.

[0015] Preferably, in the primer set of the present invention, the sequence of the upstream primer F1’ is as shown in SEQ ID NO: 3, and 6-carboxyfluorescein is connected to the 5’ end; the sequence of the upstream primer F2’ is as shown in SEQ ID NO: 4, and hexachloro-6-methylfluorescein is connected to the 5’ end; the sequence of the upstream primer F3’ is as shown in SEQ ID NO: 6, and 6-carboxyfluorescein is connected to the 5’ end; the sequence of the upstream primer F4’ is as shown in SEQ ID NO: 7, and hexachloro-6-methylfluorescein is connected to the 5’ end.

[0016] In another aspect, the present invention provides a primer set for detecting the KASP molecular markers of the present invention, characterized in that the primer set comprises: The primer set for detecting the first KASP molecular marker comprises: upstream primer F1’, upstream primer F2’ and common downstream primer R1. The nucleotide sequence of the upstream primer F1’ is as shown in SEQ ID NO: 3, and a 6-carboxyfluorescein is connected to the 5’ end; the nucleotide sequence of the upstream primer F2’ is as shown in SEQ ID NO: 4, and a hexachloro-6-methylfluorescein is connected to the 5’ end; the nucleotide sequence of the common downstream primer R1 is as shown in SEQ ID NO: 5; The primer set for detecting the second KASP molecular marker comprises: upstream primer F3’, upstream primer F4’ and common downstream primer R2. The nucleotide sequence of the upstream primer F3’ is as shown in SEQ ID NO: 6, and a 6-carboxyfluorescein is connected to the 5’ end; the nucleotide sequence of the upstream primer F4’ is as shown in SEQ ID NO: 7, and a hexachloro-6-methylfluorescein is connected to the 5’ end; the nucleotide sequence of the common downstream primer R2 is as shown in SEQ ID NO: 8.

[0017] In another aspect, the present invention provides a detection kit, which contains the primer set of the present invention.

[0018] In one aspect, the present invention provides the application of the KASP molecular markers, primer set or detection kit of the present invention in any one of the following: (1) Application in identifying the number of nodes on the main stem of soybeans; (2) Application in improving soybean germplasm resources; (3) Application in cultivating high-yield soybeans.

[0019] In another aspect, the present invention also provides a method for identifying the trait of the number of nodes on the main stem of soybeans, characterized by comprising the following steps: Using the genomic DNA of the soybean sample to be tested as a template, performing fluorescence quantitative PCR amplification on the template using the primer set or detection kit of the present invention. After the PCR amplification is completed, read the fluorescence signal, analyze and convert the fluorescence signal, identify the genotype, and judge the number of nodes on the main stem of the soybean according to the genotype; If the genotype at the first KASP molecular marker locus Chr06-47409386 is G, and the genotype at the second KASP molecular marker locus Chr19-45135078 is A, then the number of nodes on the main stem of the soybean is large; If the genotype at the first KASP molecular marker locus Chr06-47409386 is A and the genotype at the second KASP molecular marker locus Chr19-45135078 is T, then the number of main stem nodes of the soybean is small; The first KASP molecular marker locus Chr06-47409386 is located at 47,409,386 bp on chromosome 6 of the soybean genome, and the second KASP molecular marker locus Chr19-45135078 is located at 45,135,078 bp on chromosome 19 of the soybean genome. The whole gene sequence version of the soybean genome is Wm82.a2.v1.

[0020] In one aspect, the fluorescence quantitative PCR reaction system for the marker Chr06-47409386 ( qMSN6 ) is as follows: 5 μL of 2×KASP Master mix; 0.14 μL of KASP mixed primers, where F1:F2:R1 = 2:2:5 (V / V / V); 2 μL of 50 ng / μL soybean sample DNA template; add sterilized water to make the total volume of the system 10 μL.

[0021] In one aspect, the fluorescence quantitative PCR reaction conditions for the marker Chr06-47409386 ( qMSN6 ) are as follows: Collect fluorescence at 30°C for 1 min; pre-denature at 94°C for 15 min; denature at 94°C for 20 sec, anneal at 61 - 55°C for 1 min, with a decrease of 0.6°C for each cycle, for 10 cycles; denature at 94°C for 20 sec, anneal at 55°C for 1 min, for 26 cycles; collect fluorescence at 30°C for 1 min.

[0022] In one aspect, the reaction system for the marker Chr19-45135078 ( qMSN19 ) is as follows: 5 μL of 2×KASP Master mix; 0.14 μL of KASP mixed primers, where F3:F4:R2 = 2:2:5 (V / V / V); 0.063 μL of 50 mM MgCl2; 2 μL of 50 ng / μL soybean sample DNA template; add sterilized water to make the total volume of the system 10 μL.

[0023] In one aspect, the reaction conditions for the marker Chr19-45135078 ( qMSN19 ) are as follows: Collect fluorescence at 30°C for 1 min; pre-denature at 94°C for 15 min; denature at 94°C for 20 sec, anneal at 55°C for 1 min, for 40 cycles; collect fluorescence at 30°C for 1 min.

[0024] Beneficial effects: The present invention has developed two KASP molecular markers significantly associated with the number of nodes on the main stem of soybean, Chr06-47409386 ( qMSN6 ), and Chr19-45135078 ( qMSN19 ). There is an A / G mutation at the Chr06-47409386 marker locus (i.e., an A / G mutation at the 86th position of the sequence shown in SEQ ID NO: 1), and an A / T mutation at the Chr19-45135078 marker locus (i.e., an A / T mutation at the 78th position of the sequence shown in SEQ ID NO: 2). The excellent allele variations at the two marker loci are G and A respectively, and the inferior allele variations are A and T respectively. Using this molecular marker to rapidly detect the genotype of soybean, it is found that the average number of nodes on the main stem of soybean varieties with the haplotype GA is significantly higher than that of soybean varieties with the haplotype AT. The present invention can sensitively, efficiently, and low-costly predict the number of nodes on the main stem of soybean using KASP molecular markers, which is beneficial to assisting soybean molecular breeding, screening and cultivating high-yield and high-quality soybean varieties, and further shortening the breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 is a Manhattan plot of the genome-wide association analysis results of the number of nodes on the main stem of soybean in 2023 (upper) and 2024 (lower). The gray horizontal dashed line in the figure represents the significance threshold: -log 10 ( p value) ≥ 7.94, and the black vertical dashed line represents the loci that can be repeatedly detected in the two environments of 2023 and 2024.

[0026] Figure 2 is a genotyping map of different soybean varieties using KASP primers. The blue dots close to the ordinate represent the same terminal base genotypes of the upstream primers F1 or F3 sequences, and the red dots close to the abscissa represent the same terminal base genotypes of the upstream primers F2 or F4 sequences. DETAILED DESCRIPTION OF THE INVENTION

[0027] The following examples facilitate a better understanding of the present invention, but do not limit the present invention. The experimental methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples are all obtained from regular biochemical reagent stores unless otherwise specified.

[0028] The present invention uses genome-wide association analysis (GWAS) to high-throughput explore major loci related to the number of nodes on the main stem of soybean, and develops KASP molecular markers based on significantly associated SNPs for early selection of the number of nodes on the main stem of soybean, so as to screen high-quality and high-yield soybean germplasms, which has a significant effect on reducing the workload of soybean breeding and accelerating the soybean breeding progress, and provides a reference basis for soybean yield increase research and breeding of high-yield new varieties.

[0029] The following specific examples are used to further illustrate the development and application of the above KASP molecular markers.

[0030] Example 1: Obtaining SNP loci significantly associated with the number of nodes on the main stem of soybean (1) Sources of materials and genotype data The experimental materials and genotype data are from a publicly published literature (Lu et al., Stepwise selection on homeologous PRR genes controlling flowering and maturity during soybean domestication. Nature genetics (2020). https: / / doi.org / 10.1038 / s41588-020-0604-7). There are a total of 438 materials, including 207 landraces and 231 cultivars. Among them, seeds of 17 materials could not be obtained, and actually 196 landraces and 225 cultivars were used.

[0031] (2) Phenotypic statistics Method for measuring the number of nodes on the main stem of soybean: The field is arranged into ridges with a width of 1.1 m, with 2 rows planted on each ridge and divided into several plots; each plot is planted with a hole spacing of 20 cm, a row spacing of 45 cm, and a row length of 180 cm, with 2 plants per hole, and a 50-cm interval between plots; all materials in the field are uniformly managed in terms of water, fertilizer, pest and disease prevention; after the materials grow to maturity, the plants at both ends of the plot are removed, and representative plants in the plot are selected to count the number of nodes on the main stem, starting from above the cotyledon node to the top node of the main stem, including the number of nodes with leaves, branches, and pods, excluding the cotyledon node and the apical inflorescence (at least 10 plants are counted for each material). The phenotypic data of the number of nodes on the main stem in two environments of 2023 and 2024 were statistically analyzed.

[0032] (3) Genome-wide association study Using 4,301,538 high-quality SNPs (minor allele frequency MAF > 0.05 and missing rate < 10%), a genome-wide association study (GWAS) was conducted on the phenotypic data of the number of nodes on the main stem of 421 materials. The association analysis was carried out using the mixed linear model (MLM) in the efficient mixed model association analysis software (EMMAX), and the kinship matrix was calculated from all SNPs. The significance threshold of GWAS was determined by Bonferroni correction (i.e., corrected p = 0.05 / n, where n is the number of genome-wide SNPs), and the significance level was determined to be 1.16×10 -8 . The results of the association analysis of the phenotypic data for two years showed that at Chr06-47409386 ( qMSN6 ) and Chr19-45135078 (qMSN19 1) Two loci are closely associated and appear repeatedly. Their specific physical positions of SNPs (referring to the soybean genome Wm82.a2.v1) are respectively: at 47,409,386 bp on chromosome 6, where a base substitution from A to G occurred, and the nucleotide sequence where this SNP is located is as shown in SEQ ID NO: 1; at 45,135,078 bp on chromosome 19, where a base substitution from A to T occurred, and the nucleotide sequence where this SNP is located is as shown in SEQ ID NO: 2.

[0033] SEQ ID NO: 1: TGAATTTCTATACCCTCTAGAATAGTAGGAGGAACGGAAAGTTAAATTAATAAGTCTCTTGAAGATGGAGGAGGATGTTGATTGA(A / G)ATTGCATGGCAGTTTGCCTGATATCAGGCATCTTAGAATGCTCCTCATGTATGGTTTCTCTAACAGCTGATTACTAAATACTTTTGGACAGCCAGAGATATTTAGATATCCAAGAGAACTTAGACTCAATATGTTGCTGGGTAGACTTACTAGAC (The 86th bp of this sequence is the SNP locus with an A / G mutation).

[0034] SEQ ID NO: 2: CGGTTATATTTTAACAATACAAACTTAGTTCCAAATGTGAGTTCTACCAAAAAATATATGTAAAATGATATAAAAAC(A / T)TACACAAAATATTACTCAAAAAATAATTTATCAATACAAAATAGAAAGAAATTTTTAACTCACAATTTTATGTTTAGAAAGAATTAACCTAATAGATATTTGGTTACAACGAATTTATCCAA(The 78th bp of this sequence is the SNP locus with an A / T mutation).

[0035] 4) Genotype and haplotype analysis Based on the two loci Chr06 - 47409386 ( qMSN6 and Chr19 - 45135078 ( qMSN19 ), in the association analysis population of 421 soybean materials, qMSN6 The average number of main stem nodes of 352 soybean materials with genotype A was 14.71 (in 2023) and 15.07 (in 2024), qMSN6The average number of nodes on the main stem of 69 soybean materials with genotype G was 17.50 (in 2023) and 17.09 (in 2024) respectively. The average number of nodes on the main stem of soybean materials with genotype G was 2.79 (in 2023) / 2.02 (in 2024) more than that of soybean materials with genotype A; qMSN19 The average number of nodes on the main stem of 71 soybean materials with genotype A was 16.75 (in 2023) and 16.57 (in 2024) respectively, qMSN19 The average number of nodes on the main stem of 350 soybean materials with genotype T was 14.84 (in 2023) and 15.17 (in 2024) respectively. The average number of nodes on the main stem of soybean materials with genotype A was 1.91 (in 2023) / 1.4 (in 2024) more than that of soybean materials with genotype T. qMSN6 The effect of (G) on increasing the number of nodes on the main stem was stronger than qMSN19 (A).

[0036] Table 1 Phenotypic contribution analysis of two loci Chr06 - 47409386 ( qMSN6 ) and Chr19 - 45135078 ( qMSN19 )

[0037] According to the genotypes of two loci Chr06 - 47409386 ( qMSN6 ) and Chr19 - 45135078 ( qMSN19 ), 421 soybean materials can be divided into four haplotypes, namely Hap1 (AA), Hap2 (AT), Hap3 (GA), and Hap4 (GT). When both loci are inferior alleles (Hap2), the phenotypic value is the lowest; when both loci are superior alleles (Hap3), the phenotypic value is the highest.

[0038] Table 2 Haplotype analysis

[0039] Note: Lowercase letters a - d indicate significant differences in multiple comparison analysis ( p < 0.05) Example 2 Development of specific primers for KASP markers For qMSN6For the SNP sites, using the Primer-BLAST function of NCBI (https: / / www.ncbi.nlm.nih.gov / ), three primers were designed based on the SEQ ID NO: 1 sequence, namely the upstream primer F1, the upstream primer F2, and the common downstream primer R1. Among them, the 5' ends of the upstream primers F1 and F2 were ligated with the specific 6-carboxyfluorescein (FAM) and hexachloro-6-methylfluorescein (HEX) adapter sequences (lowercase letters) of the KASP reaction reagent of LGC (Laboratory of the Government Chemist) in the UK, followed by a 23-25 bp binding sequence (uppercase letters), and the 3' ends were allelic variant bases. The downstream primer R1 was a reverse binding sequence, and the primer sequences were as follows: Upstream primer F1: 5'-gaaggtgaccaagttcatgctATGGAGGAGGATGTTGATTGAA-3' (SEQ ID NO: 3); Upstream primer F2: 5'-gaaggtcggagtcaacggattATGGAGGAGGATGTTGATTGAG-3' (SEQ ID NO: 4); Downstream primer R1: 5'-ATCTCTGGCTGTCCAAAAGT-3' (SEQ ID NO: 5).

[0040] Similarly, qMSN19 For the SNP sites, three primers were designed based on the SEQ ID NO: 2 sequence, namely the upstream primer F3, the upstream primer F4, and the common downstream primer R2. The primer sequences were as follows: Upstream primer F3: 5'-gaaggtgaccaagttcatgctATATATGTAAAATGATATAAAAACA-3' (SEQ ID NO: 6); Upstream primer F4: 5'-gaaggtcggagtcaacggattATATATGTAAAATGATATAAAAACT-3' (SEQ ID NO: 7); Downstream primer R2: 5'-ATTGATAAATTATTTTTTGAGTAATATTT-3' (SEQ ID NO: 8).

[0041] Example 3: Application of KASP markers in detecting the genotypes of SNP sites in different soybean varieties and in the breeding of the number of main stem nodes in soybean varieties Randomly select 72 soybean materials, extract the genomic DNA of 72 tested varieties respectively, use the genomic DNA as a template, and perform PCR amplification with the specific primers of KASP markers to obtain PCR amplification products.

[0042] After optimizing the reaction conditions, the reaction system for Chr06 - 47409386 ( qMSN6 ) is as follows: 5 μL of 2×KASP Master mix (Laboratory of the Government Chemist, LGC, UK); 0.14 μL of KASP mixed primers; where F1:F2:R = 2:2:5 (V / V / V); 2 μL of 50 ng / μL soybean sample DNA template; add sterile water to make the total volume of the system 10 μL. The reaction conditions are: collect fluorescence at 30 °C for 1 min; pre - denature at 94 °C for 15 min; denature at 94 °C for 20 sec, anneal at 61 - 55 °C for 1 min, with a decrease of 0.6 °C for each cycle, for 10 cycles; denature at 94 °C for 20 sec, anneal at 55 °C for 1 min, for 26 cycles; collect fluorescence at 30 °C for 1 min.

[0043] Chr19 - 45135078 ( qMSN19 ) The reaction system is: 5 μL of 2×KASP Master mix; 0.14 μL of KASP mixed primers; where F1:F2:R = 2:2:5 (V / V / V); 0.063 μL of 50 mM MgCl2; 2 μL of 50 ng / μL soybean sample DNA template; add sterile water to make the total volume of the system 10 μL. The reaction conditions are: collect fluorescence at 30 °C for 1 min; pre - denature at 94 °C for 15 min; denature at 94 °C for 20 sec, anneal at 55 °C for 1 min, for 40 cycles; collect fluorescence at 30 °C for 1 min.

[0044] PCR amplification is carried out in an ABI QuantStudio3 real - time fluorescence quantitative PCR instrument. The test sample binds to the specific FAM detection primer and releases a blue fluorescent group (near the ordinate). The KASP genotype identification result is the last base A (Chr06 - 47409386) or A (Chr19 - 45135078) of the upstream primer F1 or F3 sequence. The test sample binds to the specific HEX detection primer and releases a red fluorescent group (near the abscissa). The KASP genotype identification result is the last base G (Chr06 - 47409386) or T (Chr19 - 45135078) of the upstream primer F2 or F3 sequence. After PCR, the instrument can perform genotyping according to the fluorescence signal (such as Figure 2 ).

[0045] According to the genotyping results, 36 varieties of the Hap2 (AT) type and 9 varieties of the Hap3 (GA) type were obtained. The phenotypic values of the main stem node numbers for two years are shown in Table 3. The results show that the main stem node numbers of the Hap2 germplasm are generally lower than those of the Hap3 germplasm. Using the two KASP markers designed in Example 2, germplasm materials with more or fewer main stem nodes can be quickly and efficiently distinguished from the population.

[0046] Table 3 Main stem node numbers and genotyping results of 45 soybean germplasms

[0047] Note: NA indicates missing data The above are only the preferred embodiments of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A KASP molecular marker related to the number of nodes on the main stem of soybean, characterized in that, The nucleotide sequence of the first KASP molecular marker is shown in SEQ ID NO: 1, and there is an A / G base mutation at the 86th position of the sequence shown in SEQ ID NO: 1; and the nucleotide sequence of the second KASP molecular marker is shown in SEQ ID NO: 2, and there is an A / T base mutation at the 78th position of the sequence shown in SEQ ID NO:

2.

2. A primer set for detecting the KASP molecular marker according to claim 1, characterized in that, The primer set includes: The primer set for detecting the first KASP molecular marker includes: upstream primer F1’, upstream primer F2’ and common downstream primer R1. The nucleotide sequence of the upstream primer F1’ is 5’-ATGGAGGAGGATGTTGATTGAA-3’, the nucleotide sequence of the upstream primer F2’ is 5’-ATGGAGGAGGATGTTGATTGAG-3’, and the nucleotide sequence of the common downstream primer R1 is 5’-ATGGAGGAGGATGTTGATTGAG-3’; The primer set for detecting the second KASP molecular marker includes: upstream primer F3’, upstream primer F4’ and common downstream primer R2. The nucleotide sequence of the upstream primer F3’ is 5’-ATATATGTAAAATGATATAAAAACA-3’, the nucleotide sequence of the upstream primer F4’ is 5’-ATATATGTAAAATGATATAAAAACT-3’, and the nucleotide sequence of the common downstream primer R2 is 5’-ATTGATAAATTATTTTTTGAGTAATATTT-3’.

3. The primer set according to claim 2, wherein The 5’ ends of the upstream primer F1’ and the upstream primer F2’ are connected with tags for distinguishing the base types at the first KASP molecular marker; and the 5’ ends of the upstream primer F3’ and the upstream primer F4’ are connected with tags for distinguishing the base types at the second KASP molecular marker.

4. The primer set according to claim 3, wherein Adapter sequences are respectively connected between the upstream primer F1’, the upstream primer F2’, the upstream primer F3’ and / or the upstream primer F4’ and the tags.

5. The primer set according to claim 4, wherein The adapter sequences connected between the 5’ end of the upstream primer F1’ and the tag and between the 5’ end of the upstream primer F3’ and the tag are gaaggtgaccaagttcatgct, and the adapter sequences connected between the 5’ end of the upstream primer F2’ and the tag and between the 5’ end of the upstream primer F4’ and the tag are gaaggtcggagtcaacggatt.

6. The primer set according to any one of claims 3-5, characterized in that, The tags for distinguishing the base types at the first and second KASP molecular markers are fluorescein.

7. The primer set according to claim 6, characterized in that, The fluorescein connected to the upstream primer F1’ and the upstream primer F3’ is 6-carboxyfluorescein, and the fluorescein connected to the upstream primer F2’ and the upstream primer F4’ is hexachloro-6-methylfluorescein.

8. A detection kit, characterized in that, The kit contains the primer set according to any one of claims 2-7.

9. Use of the KASP molecular marker according to claim 1, the primer set according to any one of claims 2-7 or the detection kit according to claim 8 in any one of the following: (1) Application in identifying the number of nodes on the main stem of soybean; (2) Application in improving soybean germplasm resources; (3) Application in cultivating high-yield soybeans.

10. A method for identifying the number of nodes on the main stem of soybeans, characterized in that, It includes the following steps: Using the genomic DNA of the soybean sample to be tested as a template, performing fluorescence quantitative PCR amplification on the template with the primer set described in any one of claims 2-7 or the detection kit described in claim 8, reading the fluorescence signal after the PCR amplification is completed, analyzing and converting the fluorescence signal, identifying the genotype, and judging the number of nodes on the main stem of the soybean according to the genotype; If the genotype at the first KASP molecular marker locus Chr06-47409386 is G and the genotype at the second KASP molecular marker locus Chr19-45135078 is A, then the number of nodes on the main stem of the soybean is large; If the genotype at the first KASP molecular marker locus Chr06-47409386 is A and the genotype at the second KASP molecular marker locus Chr19-45135078 is T, then the number of nodes on the main stem of the soybean is small; Among them, the first KASP molecular marker locus Chr06-47409386 is located at 47,409,386 bp on chromosome 6 of the soybean genome, and the second KASP molecular marker locus Chr19-45135078 is located at 45,135,078 bp on chromosome 19 of the soybean genome. The full gene sequence version of the soybean genome is Wm82.a2.v1.

Images