KASP molecular markers and their application in identifying the number of main stem nodes in soybean varieties

Abstract

The present invention provides KASP molecular markers and their application in identifying the number of main stem nodes of soybean varieties. Specifically, the present invention develops two KASP molecular markers significantly correlated with the number of main stem nodes of soybean, Chr06-47409386 ( qMSN6 ) and Chr19‑45135078 ( qMSN19 ), an A / G mutation at the Chr06-47409386 marker site (i.e., an A / G mutation at position 86 of the sequence shown in SEQ ID NO: 1), and an A / T mutation at the Chr19-45135078 marker site (i.e., an A / T mutation at position 78 of the sequence shown in SEQ ID NO: 2). The superior alleles at these two marker sites are G and A, respectively, and the inferior alleles are A and T, respectively. Rapid soybean genotype detection using these molecular markers revealed that soybean varieties with the GA haplotype had a significantly higher mean number of main stem nodes than soybean varieties with the AT haplotype. The present invention utilizes KASP molecular markers to sensitively, efficiently, and cost-effectively predict the number of soybean main stem nodes, facilitating soybean molecular breeding, screening and cultivating high-yield, high-quality soybean varieties, and further shortening the breeding process.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and particularly relates to a KASP molecular marker and an application thereof in identifying the number of main stem nodes of soybean varieties. Background Art

[0002] Soybean (Glycine max) is an important dual-purpose grain and oil crop in my country. Its yield and adaptability are significantly influenced by plant architecture, and Main Stem Node Number (MSN) is a key agronomic trait that determines plant height, branch number, and pod-setting habit. Traditional breeding relies on phenotypic selection, but MSN is susceptible to environmental influences, resulting in low selection efficiency and a long cycle. With the development of molecular marker technology, precision selection based on single nucleotide polymorphisms (SNPs) has become an important tool for modern soybean genetic improvement.

[0003] In recent years, researchers have identified multiple QTLs (quantitative trait loci) regulating soybean main stem node number through linkage mapping and genome-wide association studies (GWAS). For example, the SoyBase database contains 38 MSN-related QTLs (based on linkage mapping), and an additional 45 MSN QTLs have been reported through GWAS. Fu et al. (2022) used RTM-GWAS (random effects mixed model GWAS) to identify 76 MSN QTLs (containing 183 alleles) in 306 Northeast soybean accessions, explaining 65.63% of the phenotypic variance (PV). Fahim et al. (2023) detected 151 MSN QTLs (587 alleles) in 821 Chinese cultivated soybean accessions, covering both main effect loci and QTL-environment interaction (QEI) loci, with a cumulative contribution of 90.64% of the PV. These studies provide key targets for the development of molecular markers for MSN, but existing markers are mostly based on high-throughput sequencing, which is costly and complex to operate, making them difficult to directly apply in breeding practice.

[0004] Competitive allele-specific PCR (KASP) is a fluorescence-based SNP typing technology with the following advantages: high throughput and low cost, capable of simultaneously testing thousands of samples, with the cost of a single SNP typing test as low as 2.3 yuan; high precision, based on a dual fluorescent probe design, with an accuracy rate of >99.5%; strong equipment compatibility, requiring only an ordinary real-time fluorescence PCR instrument, without the need for a complex sequencing platform; and suitable for large-scale breeding screening, especially for early selection of complex quantitative traits such as MSN.

[0005] Currently, the development of soybean MSN-related KASP markers still faces challenges. For example, functional loci are insufficiently validated, and most QTL intervals are large (>1 Mb), requiring precise mapping of key SNPs. Markers have limited universality, with some being effective only in specific populations and limiting their application across ecological regions. Furthermore, the mechanisms of multi-gene coordinated regulation are complex, and the interpretation rate of single SNPs is low, necessitating the development of multi-locus combination markers. Summary of the Invention

[0006] To address the challenges of existing technologies, the present invention provides KASP molecular markers and their application in identifying main stem node number in soybean varieties. Specifically, the present invention screens for functional SNPs based on the newly significant GWAS loci Chr06-47409386 and Chr19-45135078 to develop a stable KASP marker. Combined with haplotype analysis, a multi-locus combination marker is designed, its stability validated across multiple environments, and the accuracy of predicting MSN variation is improved.

[0007] The KASP markers developed in this application can be used in marker-assisted selection (MAS) to screen for ideal plant types early on, shortening the breeding cycle. The development of highly efficient KASP markers based on the number of main stem nodes is crucial for precision soybean breeding and yield improvement, meeting the needs of my country's soybean industry to reduce losses and increase efficiency.

[0008] In this case, the present invention includes but is not limited to the following:

[0009] In one aspect, the present invention provides a KASP molecular marker associated with the number of nodes in the soybean main stem, wherein the nucleotide sequence of the first KASP molecular marker is shown in SEQ ID NO: 1, and an A / G base mutation exists at position 86 of the sequence shown in SEQ ID NO: 1; and the nucleotide sequence of the second KASP molecular marker is shown in SEQ ID NO: 2, and an A / T base mutation exists at position 78 of the sequence shown in SEQ ID NO: 2.

[0010] In another aspect, the present invention provides a primer set for detecting the KASP molecular marker of the present invention, characterized in that the primer set comprises:

[0011] The primer set for detecting the first KASP molecular marker includes: an upstream primer F1', an upstream primer F2' and a universal downstream primer R1, the nucleotide sequence of the upstream primer F1' is 5'-ATGGAGGAGGATGTTGATTGAA-3', the nucleotide sequence of the upstream primer F2' is 5'-ATGGAGGAGGATGTTGATTGAG-3', and the nucleotide sequence of the universal downstream primer R1 is 5'-ATCTCTGGCTGTCCAAAAGT-3';

[0012] The primer set for detecting the second KASP molecular marker includes: an upstream primer F3', an upstream primer F4' and a universal downstream primer R2. The nucleotide sequence of the upstream primer F3' is 5'-ATATATGTAAAATGATATAAAAACA-3', the nucleotide sequence of the upstream primer F4' is 5'-ATATATGTAAAATGATATAAAAACT-3', and the nucleotide sequence of the universal downstream primer R2 is 5'-ATTGATAAATTATTTTTTGAGTAATATTT-3'.

[0013] In one aspect, the 5' ends of upstream primers F1' and F2' of the present invention are connected to tags for distinguishing the base type at the first KASP molecular marker; and the 5' ends of upstream primers F3' and F4' are connected to tags for distinguishing the base type at the second KASP molecular marker.

[0014] In one aspect, in the present invention, a linker sequence is connected between the upstream primer F1', the upstream primer F2', the upstream primer F3' and / or the upstream primer F4' and the tag, respectively.

[0015] In one aspect, the linker sequence connected between the upstream primer F1' and the tag and between the upstream primer F3' and the tag of the present invention is gaaggtgaccaagttcatgct, and the linker sequence connected between the upstream primer F2' and the tag and between the upstream primer F4' and the tag is gaaggtcggagtcaacggatt.

[0016] In one aspect, the label for distinguishing the base types at the first and second KASP molecular markers of the present invention is fluorescein.

[0017] In one aspect, the fluorescein linked to the upstream primer F1' and the upstream primer F3' of the present invention is 6-carboxyfluorescein, and the fluorescein linked to the upstream primer F2' and the upstream primer F4' is hexachloro-6-methylfluorescein.

[0018] Preferably, in the primer set of the present invention, the upstream primer F1' sequence of the present invention is shown in SEQ ID NO: 3, and 6-carboxyfluorescein is connected to the 5' end; the upstream primer F2' sequence is shown in SEQ ID NO: 4, and hexachloro-6-methylfluorescein is connected to the 5' end; the upstream primer F3' sequence is shown in SEQ ID NO: 6, and 6-carboxyfluorescein is connected to the 5' end; the upstream primer F4' sequence is shown in SEQ ID NO: 7, and hexachloro-6-methylfluorescein is connected to the 5' end.

[0019] In another aspect, the present invention provides a primer set for detecting the KASP molecular marker of the present invention, characterized in that the primer set comprises:

[0020] The primer set for detecting the first KASP molecular marker includes: an upstream primer F1', an upstream primer F2', and a universal downstream primer R1. The nucleotide sequence of the upstream primer F1' is shown in SEQ ID NO: 3, and 6-carboxyfluorescein is connected to the 5' end; the sequence of the upstream primer F2' is shown in SEQ ID NO: 4, and hexachloro-6-methylfluorescein is connected to the 5' end; the nucleotide sequence of the universal downstream primer R1 is shown in SEQ ID NO: 5;

[0021] The primer set for detecting the second KASP molecular marker includes: an upstream primer F3', an upstream primer F4', and a universal downstream primer R2. The nucleotide sequence of the upstream primer F3' is shown in SEQ ID NO: 6, and 6-carboxyfluorescein is connected to the 5' end; the nucleotide sequence of the upstream primer F4' is shown in SEQ ID NO: 7, and hexachloro-6-methylfluorescein is connected to the 5' end; the nucleotide sequence of the universal downstream primer R2 is shown in SEQ ID NO: 8.

[0022] In another aspect, the present invention provides a detection kit comprising the primer set of the present invention.

[0023] In one aspect, the present invention provides the use of the KASP molecular marker, primer set or detection kit of the present invention in any of the following:

[0024] (1) Application in identifying the number of nodes on the soybean main stem;

[0025] (2) Application in improving soybean germplasm resources;

[0026] (3) Application in cultivating high-yield soybeans.

[0027] In another aspect, the present invention also provides a method for identifying the number of nodes of a soybean main stem, characterized in that it comprises the following steps:

[0028] Using the genomic DNA of the soybean sample to be tested as a template, the template is amplified by fluorescent quantitative PCR using the primer set or the detection kit of the present invention. After the PCR amplification is completed, the fluorescent signal is read, the fluorescent signal is analyzed and converted, the genotype is identified, and the number of main stem nodes of the soybean is determined according to the genotype;

[0029] If the genotype at the first KASP molecular marker site Chr06-47409386 is G, and the genotype at the second KASP molecular marker site Chr19-45135078 is A, the soybean has many main stem nodes;

[0030] If the genotype at the first KASP molecular marker site Chr06-47409386 is A, and the genotype at the second KASP molecular marker site Chr19-45135078 is T, the soybean has fewer main stem nodes;

[0031] The first KASP molecular marker site Chr06-47409386 is located at 47,409,386 bp on chromosome 6 of the soybean genome, and the second KASP molecular marker site Chr19-45135078 is located at 45,135,078 bp on chromosome 19 of the soybean genome. The full gene sequence version of the soybean genome is Wm82.a2.v1.

[0032] In one aspect, the present invention marks Chr06-47409386 ( qMSN6 The fluorescence quantitative PCR reaction system for PCR was as follows: 5 μL of 2×KASP Master mix; 0.14 μL of KASP mixed primers (F1:F2:R1 = 2:2:5 (V / V / V); 2 μL of 50 ng / μL soybean sample DNA template; and sterile water to make the total system 10 μL.

[0033] In one aspect, the present invention marks Chr06-47409386 ( qMSN6 The reaction conditions for fluorescence quantitative PCR were as follows: fluorescence collection at 30°C for 1 min; pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 sec, annealing at 61-55°C for 1 min, with the temperature decreasing by 0.6°C each cycle, for 10 cycles; denaturation at 94°C for 20 sec, annealing at 55°C for 1 min, for 26 cycles; fluorescence collection at 30°C for 1 min.

[0034] In one aspect, the present invention marks Chr19-45135078 ( qMSN19 The reaction system was as follows: 5 μL of 2×KASP Master mix; 0.14 μL of KASP primer mixture (F3:F4:R2 = 2:2:5 (V / V / V); 0.063 μL of 50 mM MgCl2; 2 μL of 50 ng / μL soybean sample DNA template; and sterile water to make the total system 10 μL.

[0035] In one aspect, the present invention marks Chr19-45135078 ( qMSN19The reaction conditions were as follows: fluorescence collection at 30°C for 1 min; pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 sec, annealing at 55°C for 1 min, 40 cycles; fluorescence collection at 30°C for 1 min.

[0036] Beneficial effects:

[0037] The present invention developed two KASP molecular markers significantly associated with soybean main stem node number, Chr06-47409386 ( qMSN6 ) and Chr19-45135078 ( qMSN19 ), an A / G mutation at the Chr06-47409386 marker site (i.e., an A / G mutation at position 86 of the sequence set forth in SEQ ID NO: 1), and an A / T mutation at the Chr19-45135078 marker site (i.e., an A / T mutation at position 78 of the sequence set forth in SEQ ID NO: 2). The superior alleles at these two marker sites are G and A, respectively, and the inferior alleles are A and T, respectively. Using these molecular markers for rapid soybean genotype detection, it was found that soybean varieties with the GA haplotype had a significantly higher mean number of main stem nodes than soybean varieties with the AT haplotype. The present invention utilizes KASP molecular markers to sensitively, efficiently, and cost-effectively predict the number of main stem nodes in soybeans, facilitating soybean molecular breeding, screening and cultivating high-yield, high-quality soybean varieties, and further shortening the breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 Manhattan plots of the genome-wide association analysis results for soybean main stem node number in 2023 (top) and 2024 (bottom). The gray horizontal dashed line in the figure represents the significance threshold: -log 10 ( p value)≥7.94, and the black vertical dotted lines represent the sites that can be repeatedly detected in the 2023 and 2024 environments.

[0039] Figure 2 This is a genotyping chart for different soybean varieties using KASP primers. Blue dots near the vertical axis represent identical terminal base genotypes for the upstream primers F1 or F3, while red dots near the horizontal axis represent identical terminal base genotypes for the upstream primers F2 or F4. DETAILED DESCRIPTION

[0040] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples, unless otherwise specified, are conventional methods. The test materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent stores.

[0041] The present invention utilizes genome-wide association analysis (GWAS) to discover major loci related to the number of main stem nodes in soybeans with high throughput, and develops KASP molecular markers based on significantly associated SNPs for early selection of the number of main stem nodes in soybeans, thereby screening high-quality and high-yield soybean germplasm. This has a significant effect on reducing the workload of soybean breeding and accelerating the progress of soybean breeding, and provides a reference basis for soybean yield increase research and breeding of new high-yield varieties.

[0042] The development and application of the above-mentioned KASP molecular markers are further illustrated below with specific examples.

[0043] Example 1: Obtaining SNPs Significantly Associated with the Number of Nodes in the Soybean Main Stem

[0044] (1) Sources of materials and genotype data

[0045] The experimental materials and genotype data were derived from published literature (Lu et al., Stepwise selection on homeologous PRR genes controlling flowering and maturity during soybean domestication. Nature genetics (2020). https: / / doi.org / 10.1038 / s41588-020-0604-7). A total of 438 materials were obtained, including 207 local species and 231 cultivated species. Seeds were not available for 17 materials, and 196 local species and 225 cultivated species were actually used.

[0046] (2) Phenotypic statistics

[0047] Method for measuring soybean main stem node number: The field was organized into 1.1 m wide ridges, with two rows planted per ridge, and divided into plots. Each plot was planted with 20 cm hole spacing, 45 cm row spacing, and a 180 cm row length, with two plants per hole and 50 cm between plots. All materials in the field were managed uniformly with regard to watering, fertilizer, and pest control. After the materials reached maturity, the plants at both ends of the plot were removed. Representative plants within the plot were selected and the main stem node number was counted, starting from the cotyledonary node to the apical node of the main stem. The number of nodes bearing leaves, branches, and pods was counted, excluding the cotyledonary node and the apical inflorescence. At least 10 plants per material were counted. Main stem node number phenotypes were analyzed in 2023 and 2024 under two different environments.

[0048] (3) Genome-wide association analysis

[0049] A genome-wide association study (GWAS) was performed on the main stem node number phenotype of 421 accessions using 4,301,538 high-quality SNPs (minor allele frequency (MAF) > 0.05 and missingness < 10%). Association analysis was performed using a mixed linear model (MLM) in the high-performance mixed model association analysis software (EMMAX), and the kinship matrix was calculated for all SNPs. The significance threshold of the GWAS was determined using the Bonferroni correction (i.e., the corrected p = 0.05 / n, where n is the number of SNPs in the whole genome), the significance level was determined to be 1.16×10 -8 The results of the two-year phenotypic data association analysis showed that in Chr06-47409386 ( qMSN6 ) and Chr19-45135078 ( qMSN19 ) are closely associated and recur. The specific physical locations of these SNPs (referenced in the soybean genome Wm82.a2.v1) are: 47,409,386 bp on chromosome 6, where an A-to-G substitution occurs; the nucleotide sequence of this SNP is shown in SEQ ID NO: 1; and 45,135,078 bp on chromosome 19, where an A-to-T substitution occurs; the nucleotide sequence of this SNP is shown in SEQ ID NO: 2.

[0050] SEQ ID NO: 1: TGAATTTCTATACCCTCTAGAATAGTAGGAGGAACGGAAAGTTAAATTAATAAGTCTCTTGAAGATGGAGGAGGATGTTGATTGA(A / G)ATTGCATGGCAGTTTGCCTGATATCAGGCATCTTAGAATGCTCCTCATGTATGGTTTCTCTAACAGCTGATTACTAAATACTTTTGGACAGCCAGAGATATTTAGATATCCAAGAGAACTTAGACTCAATATGTTGCTGGGTAGACTTACTAGAC (the 86th bp of the sequence is a SNP site with an A / G mutation).

[0051] SEQ ID NO: 2: CGGTTATATTTTAACAATACAAACTTAGTTCCAAATGTGAGTTCTACCAAAAAATATATGTAAAATGATATAAAAAC(A / T)TACACAAAATATTACTCAAAAAATAATTTATCAATACAAAATAGAAAGAAATTTTTAACTCACAATTTTATGTTTAGAAAGAATTAACCTAATAGATATTTGGTTACAACGAATTTATCCAA (the 78th bp of the sequence is a SNP site, with an A / T mutation).

[0052] (4) Genotype and haplotype analysis

[0053] According to Chr06-47409386 ( qMSN6 ) and Chr19-45135078 ( qMSN19 ) two loci, in the association analysis population of 421 soybean materials, qMSN6 The average number of main stem nodes of 352 soybean materials with genotype A was 14.71 (2023) and 15.07 (2024). qMSN6 The average number of main stem nodes of 69 soybean materials with genotype G was 17.50 (2023) and 17.09 (2024), respectively. The average number of main stem nodes of soybean materials with genotype G was 2.79 (2023) / 2.02 (2024) more than that of soybean materials with genotype A. qMSN19 The average number of main stem nodes of 71 soybean materials with genotype A was 16.75 (2023) and 16.57 (2024). qMSN19 The average number of main stem nodes of 350 soybean materials with genotype T was 14.84 (2023) and 15.17 (2024), respectively. The average number of main stem nodes of soybean materials with genotype A was 1.91 (2023) / 1.4 (2024) more than that of soybean materials with genotype T. qMSN6 (G) The effect of increasing the number of main stem nodes is stronger than qMSN19 (A).

[0054] Table 1 Chr06-47409386 ( qMSN6 ) and Chr19-45135078 ( qMSN19 ) Analysis of the phenotypic contribution of the two loci

[0055]

[0056] According to Chr06-47409386 ( qMSN6 ) and Chr19-45135078 ( qMSN19 ) genotypes at two loci, Hap1 (AA), Hap2 (AT), Hap3 (GA), and Hap4 (GT), were used to classify 421 soybean accessions into four haplotypes: Hap1 (AA), Hap2 (AT), Hap3 (GA), and Hap4 (GT). When both loci were dominant (Hap2), the phenotypic value was lowest, while when both loci were dominant (Hap3), the phenotypic value was highest.

[0057] Table 2 Haplotype analysis

[0058]

[0059] Note: Lowercase letters ad represent multiple comparisons with significant differences ( p < 0.05)

[0060] Example 2: Development of KASP-labeled specific primers

[0061] against qMSN6 For the SNP site, three primers were designed based on SEQ ID NO: 1 using the Primer-BLAST function of NCBI (https: / / www.ncbi.nlm.nih.gov / ): upstream primer F1, upstream primer F2, and universal downstream primer R1. The 5' ends of upstream primers F1 and F2 were linked to the 6-carboxyfluorescein (FAM) and hexachloro-6-methylfluorescein (HEX) linker sequences (lowercase letters) specific to the KASP reaction reagents from the UK LGC (Laboratory of the Government Chemist), followed by a 23-25 ​​bp binding sequence (uppercase letters). The 3' end was the allelic variant base, and downstream primer R1 was the reverse binding sequence. The primer sequences are as follows:

[0062] Upstream primer F1: 5′-gaaggtgaccaagttcatgctATGGAGGAGGATGTTGATTGAA-3′ (SEQ ID NO: 3);

[0063] Upstream primer F2: 5′-gaaggtcggagtcaacggattATGGAGGAGGATGTTGATTGAG-3′ (SEQ ID NO: 4);

[0064] Downstream primer R1: 5'-ATCTCTGGCTGTCCAAAAGT-3' (SEQ ID NO: 5).

[0065] Similarly, qMSN19 Three primers were designed based on the SNP site of SEQ ID NO: 2, upstream primer F3, upstream primer F4 and universal downstream primer R2. The primer sequences are as follows:

[0066] Upstream primer F3: 5′-gaaggtgaccaagttcatgctATATATGTAAAATGATATAAAAACA-3′ (SEQ ID NO: 6);

[0067] Upstream primer F4: 5′-gaaggtcggagtcaacggattATATATGTAAAATGATATAAAAACT-3′ (SEQ ID NO: 7);

[0068] Downstream primer R2: 5′-ATTGATAAATTATTTTTTGAGTAATATTT-3′ (SEQ ID NO: 8).

[0069] Example 3: Detecting the Genotypes of SNP Loci in Different Soybean Varieties Using KASP Markers and Their Application in Breeding Soybean Varieties with Main Stem Node Number

[0070] 72 soybean materials were randomly selected, and genomic DNA of 72 tested varieties was extracted respectively. The genomic DNA was used as a template and PCR amplification was performed using KASP-labeled primers to obtain PCR amplification products.

[0071] After optimization of reaction conditions, Chr06-47409386 ( qMSN6 The reaction system for the PCR product was as follows: 5 μL of 2× KASP Master mix (Laboratory of the Government Chemist, LGC, UK); 0.14 μL of KASP primer mix (F1:F2:R = 2:2:5 (V / V / V); 2 μL of 50 ng / μL soybean sample DNA template; and sterile water added to a total of 10 μL. The reaction conditions were: fluorescence acquisition at 30°C for 1 min; initial denaturation at 94°C for 15 min; 10 cycles of denaturation at 94°C for 20 sec, annealing at 61–55°C for 1 min, with the temperature decreasing by 0.6°C each cycle; 26 cycles of denaturation at 94°C for 20 sec, annealing at 55°C for 1 min; and fluorescence acquisition at 30°C for 1 min.

[0072] Chr19-45135078 ( qMSN19The reaction system for the PCR product was as follows: 5 μL of 2× KASP Master mix; 0.14 μL of KASP primer mix (F1:F2:R = 2:2:5 (V / V / V); 0.063 μL of 50 mM MgCl2; 2 μL of 50 ng / μL soybean sample DNA template; and sterile water to a total of 10 μL. The reaction conditions were: fluorescence acquisition at 30°C for 1 min; initial denaturation at 94°C for 15 min; 40 cycles of denaturation at 94°C for 20 sec and annealing at 55°C for 1 min; and fluorescence acquisition at 30°C for 1 min.

[0073] PCR amplification was performed in an ABI QuantStudio3 real-time fluorescence quantitative PCR instrument. The test sample bound to a specific FAM detection primer and released a blue fluorescent group (near the vertical axis). The KASP genotype identification result was the last base A (Chr06-47409386) or A (Chr19-45135078) of the upstream primer F1 or F3 sequence. The test sample bound to a specific HEX detection primer and released a red fluorescent group (near the horizontal axis). The KASP genotype identification result was the last base G (Chr06-47409386) or T (Chr19-45135078) of the upstream primer F2 or F3 sequence. After the PCR, the instrument can perform genotyping based on the fluorescent signal (e.g. Figure 2 ).

[0074] Based on the typing results, 36 Hap2 (AT)-type varieties and 9 Hap3 (GA)-type varieties were obtained. The two-year phenotypic values ​​of the number of main stem nodes are shown in Table 3. The results showed that the number of main stem nodes of Hap2-type germplasm was generally lower than that of Hap3-type germplasm. Using the two KASP markers designed in Example 2, germplasm materials with many and few main stem nodes can be quickly and efficiently distinguished from each other in the population.

[0075] Table 3 Main stem node number and genotyping results of 45 soybean germplasms

[0076]

[0077] Note: NA indicates missing data

[0078] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A molecular marker associated with the number of nodes in the soybean main stem, characterized in that: The molecular marker includes a first molecular marker and a second molecular marker, wherein the nucleotide sequence of the first molecular marker is as shown in SEQ ID NO: 1, and there is an A / G base mutation at position 86 of the sequence shown in SEQ ID NO: 1; and the nucleotide sequence of the second molecular marker is as shown in SEQ ID NO: 2, and there is an A / T base mutation at position 78 of the sequence shown in SEQ ID NO:

2.

2. A primer set for detecting the molecular marker according to claim 1, characterized in that: The primer set includes: The primer set for detecting the first molecular marker includes: an upstream primer F1', an upstream primer F2', and a universal downstream primer R1, wherein the nucleotide sequence of the upstream primer F1' is 5'-ATGGAGGAGGATGTTGATTGAA-3', the nucleotide sequence of the upstream primer F2' is 5'-ATGGAGGAGGATGTTGATTGAG-3', and the nucleotide sequence of the universal downstream primer R1 is 5'-ATCTCTGGCTGTCCAAAAGT-3'; and The primer set for detecting the second molecular marker includes: an upstream primer F3', an upstream primer F4' and a universal downstream primer R2, the nucleotide sequence of the upstream primer F3' is 5'-ATATATGTAAAATGATATAAAAACA-3', the nucleotide sequence of the upstream primer F4' is 5'-ATATATGTAAAATGATATAAAAACT-3', and the nucleotide sequence of the universal downstream primer R2 is 5'-ATTGATAAATTATTTTTTGAGTAATATTT-3'.

3. The primer set according to claim 2, characterized in that The 5' ends of upstream primers F1' and F2' are connected with a tag for distinguishing the type of base at position 86 of the first molecular marker; and the 5' ends of upstream primers F3' and F4' are connected with a tag for distinguishing the type of base at position 78 of the second molecular marker.

4. The primer set according to claim 3, characterized in that Adapter sequences are connected between the upstream primer F1', the upstream primer F2', the upstream primer F3' and / or the upstream primer F4' and the tag, respectively.

5. The primer set according to claim 4, characterized in that The linker sequence connected between the 5' end of the upstream primer F1' and the tag and between the 5' end of the upstream primer F3' and the tag is gaaggtgaccaagttcatgct, and the linker sequence connected between the 5' end of the upstream primer F2' and the tag and between the 5' end of the upstream primer F4' and the tag is gaaggtcggagtcaacggatt.

6. The primer set according to any one of claims 3 to 5, characterized in that The label used to distinguish the base type at position 86 of the first molecular marker from the base type at position 78 of the second molecular marker is fluorescein.

7. The primer set according to claim 6, characterized in that The fluorescein linked to the upstream primer F1' and the upstream primer F3' is 6-carboxyfluorescein, and the fluorescein linked to the upstream primer F2' and the upstream primer F4' is hexachloro-6-methylfluorescein.

8. A detection kit, characterized in that: The kit comprises the primer set according to any one of claims 2 to 7.

9. Use of the molecular marker according to claim 1, the primer set according to any one of claims 2 to 7, or the detection kit according to claim 8 in any of the following: (1) Application in identifying the number of nodes on the main stem of soybean; (2) Application in improving soybean germplasm resources, wherein the improved soybean germplasm resources increase the number of nodes on the main stem.

10. A method for identifying the number of nodes of soybean main stem, characterized in that: The following steps are involved: Using the genomic DNA of the soybean sample to be tested as a template, performing fluorescent quantitative PCR amplification on the template using the primer set of any one of claims 2 to 7 or the detection kit of claim 8, reading the fluorescent signal after the PCR amplification is completed, analyzing and converting the fluorescent signal, identifying the genotype, and determining the number of main stem nodes of the soybean according to the genotype; If the genotype at the first molecular marker site Chr06-47409386 is G, and the genotype at the second molecular marker site Chr19-45135078 is A, the soybean has many main stem nodes; If the genotype at the first molecular marker site Chr06-47409386 is A, and the genotype at the second molecular marker site Chr19-45135078 is T, the soybean has fewer main stem nodes; The first molecular marker site Chr06-47409386 is located at 47,409,386 bp on chromosome 6 of the soybean genome, and the second molecular marker site Chr19-45135078 is located at 45,135,078 bp on chromosome 19 of the soybean genome. The full gene sequence version of the soybean genome is Wm82.a2.v1.

Images