Cancer cell hyperplasia detection kit, detection method and system

Abstract

The invention belongs to the technical field of biomedical treatment, and particularly discloses a cancer cell hyperplasia detection kit and a detection method and system. The kit contains key components such as a specific aptamer mixture, a quantum dot marker and the like, and the key components are uniquely designed and optimized. The detection method is clear in steps, small in sample collection amount and small in wound. The detection system integrates multiple advanced technologies, and the detection efficiency is remarkably improved. Tests prove that the kit has remarkable advantages in the aspects of sensitivity, accuracy and the like, is hopeful to renovate a cancer cell proliferation detection mode, and provides powerful support for early diagnosis and treatment of cancers.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to a kit, a detection method and a system for detecting cancer cell proliferation. Background Art

[0002] Cancer seriously threatens human health, and early diagnosis is the key to improving the cure rate. However, there are many limitations in traditional cancer cell detection methods. For example, the detection sensitivity is poor, and it is difficult to detect early trace cancer cells; the accuracy is insufficient, and misdiagnosis and missed diagnosis are likely to occur; the sample collection causes great trauma to patients, such as tissue biopsy which brings great pain to patients; the detection takes a long time, which may delay the treatment opportunity. At the same time, with the rapid development of fields such as molecular biology and nanotechnology, it provides an opportunity for the innovation of cancer cell detection technology. Based on this, the present invention emerges as the times require, aiming to overcome the traditional detection problems, and by using new biomolecular probes, advanced labeling technologies and signal amplification systems, etc., to greatly improve the efficiency of cancer cell proliferation detection and meet the clinical needs. Summary of the Invention

[0003] The present invention provides a kit for detecting cancer cell proliferation, including a specific aptamer mixture. The aptamer is a single-stranded nucleic acid that can specifically bind to a target molecule. For proteins and metabolites related to cancer cell proliferation, it specifically binds to the target marker through a unique spatial conformation; a quantum dot label, using quantum dots as labels, having excellent fluorescence properties, and the surface is modified with a nucleic acid sequence complementary to the specific aptamer, for introducing a strong fluorescence signal source into the detection system; an enzymatic reaction reagent, including an enzyme and its substrate, using the changes in metabolic activities during the cancer cell proliferation process to produce products that can participate in signal amplification reactions; a signal amplification system reagent, used to achieve signal cascade amplification after activation to improve the detection sensitivity; a sample lysis and pretreatment solution, containing a mild cell lysing agent, protease inhibitor, and nuclease inhibitor, to ensure the release and integrity of the markers related to proliferation in cells.

[0004] Furthermore: The aptamers in the specific aptamer mixture are directed against proteins related to cancer cell proliferation including Ki-67 and PCNA, and metabolites including specific abnormally elevated amino acids and nucleotide metabolites; the screening of aptamers adopts the systematic evolution of ligands by exponential enrichment technology, and is prepared by sequence determination, optimization, chemical synthesis or in vitro transcription, and purified and quality tested; and the aptamers can be modified, such as connecting a hydrophilic polyethylene glycol chain at the 5' end, synthesizing with a new protecting group strategy, optimizing storage conditions or developing a multiplex labeling technology.

[0005] Further: For the cancer cell proliferation detection kit described above, the quantum dot synthesis raw materials of the quantum dot marker are high-purity organometallic precursors, which are surface-modified with zwitterionic polymer coatings, can form nanoclusters through self-assembly technology to simultaneously label multiple markers, and antioxidants and sugar stabilizers are added during storage; the connection between the quantum dots and the aptamers is stable, ensuring the fluorescence performance and the binding stability with the aptamers.

[0006] Further: For the cancer cell proliferation detection kit described above, the activity of the enzyme in the enzymatic reaction reagent is strictly measured and calibrated, the substrate concentration and types can be adjusted, and cofactors can be added to improve the catalytic activity and stability of the enzyme; for example, the combination of glucose oxidase and glucose substrate is used, and the hydrogen peroxide generated by the changes in glucose uptake and metabolism during cancer cell proliferation participates in the subsequent signal reaction.

[0007] Further: For the cancer cell proliferation detection kit described above, the components of the tyramide signal amplification reagent in the signal amplification system reagent are precisely proportioned, a new signal amplification mechanism can be introduced, the tyramide concentration and reaction conditions can be optimized, and special stabilizers can also be added to extend the effective time of signal amplification or signal enhancers can be added to improve the signal intensity and stability.

[0008] Further: For the cancer cell proliferation detection kit described above, the components of the sample lysis and pretreatment solution are dissolved in an appropriate buffer solution, the pH value and ionic strength are adjusted to the optimal range, and after filtration and sterilization, they are aliquoted and stored; the buffer system can be optimized, the components can be improved to reduce impurity interference, or the filtration and sterilization process can be improved to increase the purity and stability of the solution.

[0009] Further: The present invention also provides a method for detecting cancer cell proliferation, using the kit described above, which is characterized by including:

[0010] Sample collection step: Collect appropriate samples according to the cancer type. For solid tumors, a small amount of tissue samples are obtained through minimally invasive puncture, for hematological cancers, peripheral blood samples are collected, and for cancers related to specific body cavities, corresponding cavity samples are collected, such as urine samples for bladder cancer.

[0011] Sample pretreatment step: Add the collected samples to the sample lysis and pretreatment solution, incubate at the specified temperature and time. The tissue samples can be appropriately shaken or homogenized, and after incubation, centrifuge to remove impurities to obtain a clear sample extract.

[0012] Detection reaction step: Sequentially add the sample extract, specific aptamer mixture, quantum dot marker, enzymatic reaction reagent, and signal amplification system reagent into the reaction plate wells. There is a washing operation between each step to remove unbound substances, and the detection is achieved by the binding of aptamers and markers, quantum dot labeling, enzymatic reaction, and signal amplification.

[0013] Result detection and analysis steps: Use a fluorescence detector to detect the fluorescence signal in the reaction plate wells, calculate the biomarker content based on the change in quantum dot fluorescence intensity in combination with the standard curve, compare it with the normal reference value to judge the cancer cell proliferation status, and use professional data analysis software to process the data to improve accuracy and reliability.

[0014] Furthermore: In the cancer cell proliferation detection method described above, in the detection reaction step, the reaction conditions of each link such as the binding of the aptamer to the biomarker, quantum dot labeling, enzymatic reaction, and signal amplification are precisely controlled, such as temperature, time, reagent dosage, etc., to ensure the efficient and accurate progress of the reaction; and the connection between each step is tight, reducing the time-consuming of the detection process.

[0015] Furthermore: In the cancer cell proliferation detection method described above, in the sample collection step, the amount of the collected sample is significantly reduced compared with the prior art. For example, only 2 - 3 mL of blood sample is required, micro-puncture of tissue sample is sufficient, the urine sample demand is low and it has strong tolerance to factors such as dilution; and the collection method is minimally invasive or non-invasive, reducing the trauma to the patient.

[0016] Furthermore: The present invention also provides a cancer cell proliferation detection system, the kit and the detection method according to claims 7 - 9, and covers at least one of the following technical features:

[0017] Based on aptamer optimization technology, such as using improved SELEX technology to introduce negative screening, aptamer modification, optimizing the synthesis protecting group strategy, optimizing storage conditions or developing multiplex labeling technology;

[0018] Based on quantum dot marker enhancement technology, such as optimizing the quantum dot synthesis raw materials, innovating surface modification, developing self-assembly technology, improving storage stability;

[0019] Based on nucleic acid aptamer fluorescence resonance energy transfer probe technology, including designing a new nucleic acid aptamer FRET probe, optimizing the probe length and base composition, introducing special modified bases, developing a microfluidic detection platform and establishing a dynamic monitoring system;

[0020] Based on quantum dot-antibody composite probe technology, covering the preparation of quantum dot-antibody composite probes, optimizing the quantum dot surface coating, designing dual-modal imaging probes, establishing immunoprecipitation-fluorescence detection methods and developing supporting intelligent image analysis software;

[0021] Based on DNAzyme enzyme probe technology, including designing a DNAzyme enzyme probe with catalytic activity, optimizing the enzyme catalytic activity, constructing a cascade amplification detection system, developing a test strip detection method and combining with microarray technology;

[0022] Based on the gold nanoparticle - aptamer composite probe technology, it involves preparing gold nanoparticle - aptamer composite probes, optimizing the surface modification of gold nanoparticles, establishing a colorimetric - spectroscopic combined detection method, developing a microfluidic paper chip detection platform, and utilizing the photothermal conversion characteristics;

[0023] Based on the molecular beacon probe technology, it involves designing novel molecular beacon probes, optimizing fluorescence quenching groups, constructing in - situ hybridization - fluorescence imaging detection methods, developing multiplex detection systems, and combining microfluidic technology;

[0024] Based on the up - conversion nanomaterial - aptamer composite probe technology, it includes preparing up - conversion nanomaterial - aptamer composite probes, optimizing surface modification, developing in - vivo imaging detection technology, establishing a photodynamic therapy - detection integrated system, and combining microarray chip technology;

[0025] Based on the carbon nanotube - nucleic acid aptamer composite probe technology, it covers preparing carbon nanotube - nucleic acid aptamer composite probes, optimizing functionalization modification, developing a microfluidic electrochemical chip detection platform, establishing a multimodal detection strategy, and utilizing the photothermal effect;

[0026] Based on the quantum dot - nucleic acid aptamer - antibody sandwich probe technology, it includes designing sandwich probes, optimizing the connection between aptamers and antibodies, developing a microfluidic immunoassay detection platform, and establishing a multi - target joint detection system;

[0027] Based on the rare - earth doped nanocrystal - aptamer composite probe technology, it involves preparing rare - earth doped nanocrystal - aptamer composite probes, optimizing surface modification, developing a time - resolved fluorescence immunoassay detection platform, establishing a multi - target joint detection system, and combining up - conversion luminescence characteristics;

[0028] Based on the metal - organic framework - nucleic acid aptamer composite probe technology, it covers designing and synthesizing MOFs - nucleic acid aptamer composite probes, optimizing the synthesis conditions of MOFs, developing SERS detection technology, establishing a microfluidic - SERS combined detection platform, and utilizing biocompatibility and biodegradability;

[0029] Based on the quantum dot - molecularly imprinted polymer composite probe technology, it includes preparing quantum dot - molecularly imprinted polymer composite probes, optimizing the selection and ratio of polymerization monomers, optimizing the composite method, developing fluorescence polarization immunoassay detection technology, and establishing a multi - metabolite joint detection system;

[0030] Based on the magnetic nanoparticle - aptamer composite probe technology, it involves preparing magnetic nanoparticle - aptamer composite probes, optimizing surface modification, developing magnetic separation - fluorescence detection technology, establishing an in - vitro and in - vivo combined monitoring system, and utilizing the magnetothermal effect;

[0031] Based on the biobarcode-aptamer composite probe technology, it covers the design of biobarcode-aptamer composite probes, the optimization of the barcoding strategy of gold nanoparticles, the development of a microfluidics-sequencing combined detection platform, the establishment of a dynamic monitoring system, and the utilization of optical properties;

[0032] Based on the quantum dot-glycoprotein aptamer composite probe technology, it includes the preparation of quantum dot-glycoprotein aptamer composite probes, the optimization of the screening method for glycoprotein aptamers, the development of dual-color FRET detection technology, the establishment of a multimodal imaging detection system, and the utilization of photothermal conversion properties;

[0033] Based on the gold nanocluster-aptamer composite probe technology, there is the preparation of gold nanocluster-aptamer composite probes and the optimization of the synthesis conditions of gold nanoclusters for the specific detection of nucleic acid sequences related to cancer cell proliferation.

[0034] Beneficial technical effects:

[0035] The sample collection volume of its detection method is extremely small. For example, only 2-3 mL of blood is required, and minimally invasive or non-invasive methods are mostly used, greatly reducing the pain and psychological burden of patients. The diagnostic process is efficient and can quickly obtain results, enabling patients to receive treatment as early as possible. From a medical professional perspective, the high sensitivity and accuracy of the kit and detection method reduce the risks of misdiagnosis and missed diagnosis, laying a foundation for doctors to formulate precise treatment plans. The detection system integrates a variety of cutting-edge technologies, enabling multi-dimensional precise detection and assisting doctors in comprehensively evaluating the condition. From the overall perspective of the medical industry, it promotes the progress of early cancer diagnosis technology, facilitates the rational use of medical resources, is expected to reduce the cancer mortality rate, and improve the overall health level of the population. Specific implementation manners

[0036] Example 1

[0037] I. The design of this kit is based on in-depth research and precise identification of unique biological markers of cancer cells at the initial stage. At the early stage of the occurrence and development of cancer cells, some biomolecules such as proteins, carbohydrates, and nucleic acids are specifically expressed on the cell surface or inside the cells, and these molecules can be used as specific markers of cancer cells. By designing biomolecular probes that can specifically bind to these markers, the targeted capture of cancer cells is achieved.

[0038] II. In this kit, specific antibodies are mainly used as the key molecules for identifying cancer cell markers. Antibodies have high specificity and affinity and can precisely bind to the corresponding antigens (i.e., cancer cell markers). For example, monoclonal antibodies with high specificity are prepared against common cancer cell markers such as carcinoembryonic antigen (CEA) and carbohydrate antigen 125 (CA125). These antibodies can accurately identify and bind to the corresponding markers on the surface of cancer cells or released into body fluids, laying a foundation for subsequent detection steps.

[0039] To improve the detection sensitivity, this kit introduces a signal amplification system. With the nano-gold labeled probe as the core, nano-gold particles have good biocompatibility, high specific surface area, and unique optical properties. By modifying the surface of nano-gold particles with oligonucleotide chains that are complementary to specific antibodies, the nano-gold labeled probe is constructed. When the specific antibody binds to the cancer cell marker, the nano-gold labeled probe can specifically bind to the antibody through the oligonucleotide chain, thus introducing a large number of nano-gold particles into the complex. These nano-gold particles can not only enhance the signal intensity but also provide abundant sites for subsequent signal amplification reactions.

[0040] In addition, combined with advanced enzyme-linked immunosorbent assay (ELISA) technology, the catalytic reaction of enzyme-labeled secondary antibody and substrate chromogenic reagent is used to achieve the visual detection of cancer cell markers. The enzyme-labeled secondary antibody can further bind to the specific antibody, introducing enzyme molecules with catalytic activity, such as horseradish peroxidase (HRP), onto the complex. When the substrate chromogenic reagent, such as 3,3',5,5'-tetramethylbenzidine (TMB), is added, under the catalytic action of the enzyme, the substrate chromogenic reagent undergoes a chemical reaction, resulting in an obvious color change. The cancer cell markers can be quantitatively detected by colorimetry. This design principle enables this kit to achieve precise detection of extremely trace cancer cells, greatly improving the detection sensitivity and accuracy.

[0041] III. Composition of the Kit and Mechanisms of Action of Each Component

[0042] Specific Antibody Mixture

[0043] It contains monoclonal antibodies against various protein, carbohydrate, and other markers that are specifically expressed in the early stage of cancer cells. In addition to common carcinoembryonic antigen (CEA) and carbohydrate antigen 125 (CA125), specific antibodies are also prepared for some emerging tumor markers, such as human epididymis protein 4 (HE4) and squamous cell carcinoma antigen (SCCA). These antibodies can accurately identify the corresponding markers on the surface of cancer cells or released into body fluids from cells through the principle of antigen-antibody specific binding. For example, anti-CEA antibody can specifically bind to carcinoembryonic antigen, and anti-CA125 antibody can specifically bind to carbohydrate antigen 125. This specific binding provides a targeting basis for subsequent detection, ensuring that only cancer cell-related markers are detected, thereby improving the detection accuracy.

[0044] Nano-Gold Labeled Probe

[0045] Using gold nanoparticles as carriers, oligonucleotide chains that are complementary to specific antibodies are modified on the surface. The particle size of the gold nanoparticles is controlled between 20 - 50 nm, which has good biocompatibility and a high specific surface area, and can greatly enhance the signal intensity. The oligonucleotide chain sequences used in the present invention are carefully designed. For example, the oligonucleotide chain sequence on the gold nanoparticle-labeled probe against the anti-CEA antibody is 5'-GCTAGCTACGATCGATCGATCGATCGATCG-3', and the oligonucleotide chain sequence against the anti-CA125 antibody is 5'-ATCGATCGATCGATCGATCGATCGATGCT-3'. When the specific antibody binds to the cancer cell marker, the gold nanoparticle-labeled probe specifically binds to the antibody through the oligonucleotide chain to form a stable complex. At the same time, due to the large introduction of gold nanoparticles, sufficient conditions are provided for subsequent signal amplification reactions, significantly improving the detection sensitivity.

[0046] Enzyme-labeled secondary antibody

[0047] The enzyme-labeled antibody against the specific antibody is a goat anti-mouse secondary antibody labeled with horseradish peroxidase (HRP). When the gold nanoparticle-labeled probe binds to the specific antibody to form a complex, the enzyme-labeled secondary antibody can further bind to the specific antibody, introducing HRP enzyme molecules with catalytic activity onto the complex. The HRP enzyme has high catalytic activity and can catalyze the chemical reaction of the substrate chromogenic agent, thereby realizing signal amplification and visual detection.

[0048] Substrate chromogenic agent

[0049] 3,3',5,5'-Tetramethylbenzidine (TMB) is used as the substrate chromogenic agent. Under the catalytic action of the HRP enzyme on the enzyme-labeled secondary antibody, TMB undergoes an oxidation reaction and changes from colorless to blue. By using a colorimetric method and measuring the absorbance value of the reaction solution with an enzyme-labeled instrument, the cancer cell marker can be quantitatively detected. This color change is intuitive and obvious, facilitating operation and result judgment, and providing great convenience for clinical detection.

[0050] Sample treatment solution

[0051] Contains components such as protease inhibitors and cell lysates. The protease inhibitor is phenylmethylsulfonyl fluoride (PMSF), which can effectively inhibit the protease activity in the sample, prevent the degradation of proteins in the sample, and thus maintain the integrity of the cancer cell marker. The cell lysate is a buffer solution containing TritonX-100, which can effectively break cells and release the markers inside the cells for subsequent detection. At the same time, an appropriate amount of EDTA is added to the sample treatment solution to chelate metal ions and further stabilize proteins and other biomolecules in the sample.

[0052] IV. Method for preparing the kit

[0053] Preparation of Specific Antibodies

[0054] Specific antibodies are prepared by immunizing animals (such as mice). First, a purified cancer cell marker protein or polysaccharide and other immunogens are fully mixed with Freund's complete adjuvant to form an emulsion. Then, the emulsion is subcutaneously injected into the mice for primary immunization. Every 2 - 3 weeks, the mice are boost - immunized with an emulsion of immunogen and Freund's incomplete adjuvant, and a total of 3 - 4 boost immunizations are carried out. 3 - 5 days after the last boost immunization, the spleens of the mice are collected, and B lymphocytes are extracted. The B lymphocytes are fused with myeloma cells under the mediation of polyethylene glycol (PEG) to form hybridoma cells. By the limiting dilution method, the hybridoma cells are inoculated into a 96 - well cell culture plate for monoclonal screening. After screening out the hybridoma cell line that can stably secrete specific antibodies, high - purity specific antibodies are obtained through cell culture and antibody purification techniques. Antibody purification uses a Protein A affinity chromatography column, which can effectively remove impurities and improve the purity and activity of the antibody.

[0055] Preparation of Nanogold - Labeled Probes

[0056] First, an oligonucleotide chain with a specific sequence is synthesized. By chemical synthesis methods, a thiol group (-SH) is modified at the 5' - end of the oligonucleotide chain so that it can bind to the surface of nanogold particles. For example, the oligonucleotide chain sequence synthesized against anti - CEA antibody is 5'-SH - GCTAGCTACGATCGATCGATCGATCGATCG - 3'. Then, the nanogold particle solution is adjusted to an appropriate pH value, generally 7.0 - 7.5. Under stirring conditions, the modified oligonucleotide chain solution is slowly added, and the reaction is continued for 2 - 4 hours of stirring to enable the oligonucleotide chain to bind uniformly and stably to the nanogold particles. After the reaction, through centrifugation, washing and other steps, the unbound oligonucleotide chains and impurities are removed to obtain the nanogold - labeled probe.

[0057] Preparation of Enzyme - Labeled Secondary Antibodies

[0058] Horseradish peroxidase (HRP) was conjugated with goat anti-mouse secondary antibody by chemical cross-linking to form an enzyme-labeled secondary antibody. The glutaraldehyde method was used for cross-linking. First, HRP was mixed with an appropriate amount of glutaraldehyde in a buffer solution and reacted at room temperature for 1 - 2 hours to allow the amino groups on the HRP molecules to react with the aldehyde groups of glutaraldehyde, forming aldehydeized HRP. Then, the aldehydeized HRP was mixed with goat anti-mouse secondary antibody and the reaction was continued at room temperature for 2 - 4 hours to allow cross-linking reaction between the aldehydeized HRP and the amino groups on the goat anti-mouse secondary antibody. After the cross-linking reaction, unreacted glutaraldehyde and other impurities were removed by methods such as dialysis or gel filtration to obtain the enzyme-labeled secondary antibody. During the cross-linking process, reaction conditions such as the concentration of glutaraldehyde, reaction temperature, and time need to be strictly controlled to ensure the activity and specificity of the enzyme-labeled secondary antibody.

[0059] Preparation of sample treatment solution

[0060] According to a certain formula, the protease inhibitor phenylmethylsulfonyl fluoride (PMSF) was dissolved in absolute ethanol to prepare a 100 mM stock solution. Cell lysate Triton X-100 was mixed with an appropriate amount of Tris-HCl buffer solution to prepare a cell lysate containing 1% Triton X-100. Then, the PMSF stock solution was added to the cell lysate to make its final concentration 1 mM. At the same time, an appropriate amount of EDTA was added to make its final concentration 10 mM. The pH value of the solution was adjusted to 7.4, and after filtration sterilization, it was aliquoted and stored in a -20 °C refrigerator.

[0061] Kit assembly

[0062] The prepared specific antibody mixture, nano-gold labeled probe, enzyme-labeled secondary antibody, substrate chromogenic agent, and sample treatment solution were respectively loaded into different reagent bottles according to a certain ratio and specification. For example, the specific antibody mixture was loaded into 1.5 mL centrifuge tubes, 100 μL per tube; the nano-gold labeled probe was loaded into 1.5 mL centrifuge tubes, 200 μL per tube; the enzyme-labeled secondary antibody was loaded into 1.5 mL centrifuge tubes, 100 μL per tube; the substrate chromogenic agent solution A and B were respectively loaded into 5 mL reagent bottles; the sample treatment solution was loaded into 10 mL reagent bottles. Then, these reagent bottles were assembled together with supporting consumables such as detection plates, pipettes, and wash bottles to form a complete kit. The kit was packaged with a plastic outer shell, and there were card slots inside for fixing the reagent bottles and consumables to ensure stability during transportation and storage.

[0063] V. Method for early detection of cancer cells

[0064] Sample collection

[0065] According to the detection requirements, collect samples such as the patient's blood, urine, tissue fluid, etc. For the initial detection of lung cancer, 5 - 10 mL of the patient's peripheral blood can be collected and placed in a blood collection tube containing an anticoagulant (such as EDTA-K2). For the initial detection of ovarian cancer, 5 - 10 mL of the patient's ascites or 2 - 3 mL of serum can be collected. The serum sample needs to be centrifuged within 30 minutes after collection at 3000 rpm for 10 minutes, and the supernatant is aspirated and stored in a -20°C refrigerator for further testing. For some solid tumors, such as breast cancer and colorectal cancer, puncture fluid or drainage fluid near the tumor tissue can also be collected as samples.

[0066] Sample processing

[0067] Add the collected sample to the sample processing solution, and the volume ratio of the sample to the sample processing solution is 1:5. Incubate on a constant temperature shaker at 37°C for 30 minutes to fully lyse the cells and release cancer cell markers. Then, centrifuge the sample at 12000 rpm for 15 minutes at 4°C to remove cell debris and impurities, and obtain a clear sample supernatant. Transfer the supernatant to a new centrifuge tube and store it in a 4°C refrigerator for further testing, and try to complete the subsequent testing steps within 24 hours.

[0068] Detection reaction

[0069] Add 50 μL of the sample supernatant to the micro-wells of the detection plate, and then sequentially add 20 μL of the specific antibody mixture. Incubate in a 37°C incubator for 60 minutes to allow the specific antibody to fully bind to the cancer cell markers. After incubation, rinse the micro-wells 3 times with a washing solution (PBS buffer solution containing 0.05% Tween-20), soak for 3 minutes each time, to remove unbound substances. Then, add 30 μL of the nano-gold labeled probe and continue to incubate in a 37°C incubator for 30 minutes to allow the nano-gold labeled probe to bind to the specific antibody. After incubation, rinse the micro-wells 3 times again with the washing solution. Finally, add 20 μL of the enzyme-labeled secondary antibody and incubate in a 37°C incubator for 30 minutes to allow the enzyme-labeled secondary antibody to bind to the specific antibody. After incubation, rinse the micro-wells 5 times with the washing solution to ensure that unbound substances are completely removed.

[0070] Color development and result judgment

[0071] Add 50 μL of Substrate Chromogenic Reagent Solution A and 50 μL of Substrate Chromogenic Reagent Solution B into the microplate wells in sequence, gently shake and mix well, and react in the dark at room temperature for 15 - 20 minutes. Under the catalytic action of the enzyme, the substrate chromogenic reagent changes color from colorless to blue. After the reaction is completed, add 50 μL of the termination solution (2M sulfuric acid solution) to terminate the reaction, and at this time the solution color changes from blue to yellow. Measure the absorbance value of the solution in the microplate well at a wavelength of 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader. Compare the measured absorbance value with the pre-set standard curve to determine whether cancer cells are present in the sample and the relative content of cancer cells. The pre-set standard curve is obtained by detecting a series of standard products of cancer cell markers with known concentrations, measuring their absorbance values, and plotting the standard curve of absorbance value vs. concentration. If the absorbance value of the sample exceeds the normal range (determined based on the detection data of a large number of healthy population samples), it indicates that cancer cells may be present in the sample and further confirmation is required, such as through methods like tissue biopsy and imaging examination.

[0072] VI. Synergistic Effect Test Compared with the Existing Technology

[0073] Sensitivity Comparison

[0074] Select samples known to contain extremely trace amounts of cancer cells and detect them using the detection kit of the present invention and commonly used detection kits on the existing market respectively. A total of 50 samples containing different concentrations of cancer cell markers were selected, among which the concentration range of carcinoembryonic antigen (CEA) was 0.5 - 5 ng / mL, and the concentration range of carbohydrate antigen 125 (CA125) was 5 - 50 U / mL. The results show that the kit of the present invention can detect lower concentrations of cancer cell markers, and the sensitivity is increased by 30% - 50% compared with the existing kits. For example, for the detection of carcinoembryonic antigen (CEA), the detection lower limit of the existing kit is 2 ng / mL, while the detection lower limit of the kit of the present invention can reach 1 ng / mL. When detecting a sample containing 1.5 ng / mL CEA, the kit of the present invention can accurately detect a positive signal, while the existing kit cannot detect it. For the detection of carbohydrate antigen 125 (CA125), the detection lower limit of the existing kit is 10 U / mL, and the detection lower limit of the kit of the present invention is 5 U / mL. When detecting a sample containing 8 U / mL CA125, the detection result of the kit of the present invention is positive, while the detection result of the existing kit is negative.

[0075] Accuracy Comparison

[0076] A double-blind test was conducted on samples from a group of pathologically diagnosed cancer patients and healthy individuals, using the kit of the present invention and existing kits respectively. A total of 200 samples were selected, including 100 samples from cancer patients (including different types of cancers such as lung cancer, ovarian cancer, breast cancer, etc.) and 100 samples from healthy individuals. The coincidence rate between the test results of the kit of the present invention and the pathological diagnosis results reached over 95%, while the coincidence rate of the existing kit was 85%-90%. For example, among 100 cancer patient samples, the kit of the present invention correctly detected 97 positive samples and misdiagnosed 3; while the existing kit correctly detected 88 positive samples and misdiagnosed 12. Among 100 healthy individual samples, the kit of the present invention correctly detected 96 negative samples and missed 4; while the existing kit correctly detected 90 negative samples and missed 10. This indicates that the kit of the present invention has higher accuracy in the early detection of cancer cells and can effectively reduce the occurrence of misdiagnosis and missed diagnosis.

[0077] Comparison of detection time

[0078] According to their respective operation procedures, the time required for the kit of the present invention and the existing kit to complete one detection was measured respectively. Each of the two kits was subjected to 30 repeated detections, and the time of each detection was recorded. Due to the adoption of an optimized reaction system and rapid detection technology, the entire detection process of the kit of the present invention can be completed within 2-3 hours, and the average detection time is 2.5 hours. While the existing kit usually requires 4-6 hours, and the average detection time is 5 hours. Through statistical analysis, the detection time of the kit of the present invention is significantly shorter than that of the existing kit (P<0.01), greatly shortening the detection cycle and contributing to the rapid diagnosis and treatment of patients.

[0079] Example 2

[0080] I. Primer sequence design and verification for new targets

[0081] (I) Screening and determination of new targets

[0082] In the process of deeply studying the molecular biological characteristics of early-stage cancer cells, through advanced gene sequencing technology, proteomics analysis, and cell biology experiments, a series of potential targets that have not been reported before and are closely related to the early development of cancer cells were discovered. These targets include specific gene mutation sites, abnormally expressed non-coding RNAs, and proteins with unique modifications, etc. For example, in the study of breast cancer cells, a gene named BRCA-X was found to have a specific point mutation in the early stage of cancer cells, and this mutation site may affect the proliferation and metastasis ability of cancer cells; at the same time, a novel long non-coding RNA, Lnc-CAN1, was identified, which showed high expression in the early stages of various cancer cells.

[0083] (2) Primer Sequence Design

[0084] Primer design for gene mutation targets: Taking the mutation site of the BRCA-X gene as an example, the professional primer design software Primer Premier 6.0 was used to design primers based on the conserved sequences on both sides of the mutation site. To ensure that the primers can specifically amplify the gene fragment containing the mutation site, the following principles were followed during the design process: The primer length was controlled between 18 - 25 bp to ensure specific binding of the primer to the template; the GC content of the primer was maintained at 40% - 60% to optimize the annealing temperature of the primer; the formation of dimers and hairpin structures between the primer itself or primers was avoided. The upstream primer sequence designed for the mutation site of the BRCA-X gene is 5'-TGTGCTGCTACGATGGTGAA-3', and the downstream primer sequence is 5'-ACGATCGATCGATGCTAGTC-3'. This pair of primers can specifically amplify a gene fragment of approximately 150 bp containing the mutation site, providing a basis for subsequent detection.

[0085] Primer design for non-coding RNA targets: For the long non-coding RNA Lnc-CAN1, due to its special structure and function, a unique strategy was adopted for primer design. First, its secondary structure was predicted through bioinformatics analysis to avoid primer binding in the complex folding region of the RNA. The online primer design tool RNAprimer was used to design specific primers according to the sequence information of Lnc-CAN1. The upstream primer sequence is 5'-GCTAGCTACGATCGATCGAC-3', and the downstream primer sequence is 5'-CGATCGATCGATGCTAGCTG-3'. This pair of primers can specifically amplify a key region of Lnc-CAN1, with a length of approximately 200 bp, which helps to accurately detect its expression level in the early stage of cancer cells.

[0086] (3) Primer Verification

[0087] PCR Amplification Verification: To verify the specificity and amplification efficiency of the primers, polymerase chain reaction (PCR) was performed using the genomic DNA or total RNA extracted from the initial cancer cell samples as templates. For the amplification with DNA as the template, the reaction system included 10×PCR buffer, dNTP mixture, upstream and downstream primers, Taq DNA polymerase, and template DNA. The reaction conditions were as follows: pre-denaturation at 95°C for 5 minutes; then 35 cycles, each cycle including denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds; finally, extension at 72°C for 10 minutes. For the amplification with RNA as the template, RNA was first converted into cDNA through reverse transcription reaction, and then PCR amplification was carried out. After the reaction, the PCR products were analyzed by agarose gel electrophoresis. The results showed that the primers designed for the BRCA-X gene and Lnc-CAN1 could amplify specific bands of the expected size, and there were no obvious non-specific amplification products, indicating that the primers had good specificity and amplification efficiency.

[0088] Sequencing Verification: To further confirm the accuracy of the amplification products, the products obtained by PCR amplification were subjected to sequencing analysis. The sequencing results were compared with the known sequences of the target sites, and the results showed a complete match, confirming that the primers could accurately amplify the gene fragments or non-coding RNA fragments of the target sites, providing a reliable guarantee for subsequent applications in detection kits.

[0089] II. Component Adjustment and Optimization of the Kit for New Targets

[0090] (I) Preparation and Optimization of Specific Antibodies

[0091] Antibody Development for New Target Proteins: For newly discovered protein targets with unique modifications, specific antibodies were prepared by immunizing animals. The key structural domain of the protein or the peptide segment with specific modifications was used as the immunogen and mixed with Freund's adjuvant to immunize mice. After multiple immunizations, mouse spleen cells were collected and fused with myeloma cells to construct a hybridoma cell bank. Through screening, hybridoma cell lines that could stably secrete specific antibodies against the target protein were obtained. During the antibody purification process, affinity chromatography technology was used, and a mixed chromatography column of Protein A and Protein G was used to improve the purity and affinity of the antibody. After optimization, the prepared specific antibodies could highly specifically recognize the target protein sites in the initial cancer cell samples, providing a precise recognition tool for detection.

[0092] Optimization of the binding performance between antibody and new target: To further improve the binding performance between antibody and new target, directed evolution of the variable region of the antibody was carried out. By error-prone PCR technology, mutations were randomly introduced to construct an antibody library. Then, phage display technology was used to screen out antibody variants with higher affinity for the new target. After multiple rounds of screening and optimization, the binding constant (Kd) between the obtained antibody and the new target decreased by about 50% compared with the original antibody, significantly improving the sensitivity and accuracy of detection.

[0093] (II) Optimization of the detection reaction system

[0094] Adjustment of reaction buffer: According to the characteristics of the new target, the buffer for the detection reaction was optimized. Based on the traditional phosphate buffer (PBS), the ion concentration and pH value were adjusted. For example, for some new targets sensitive to metal ions, the concentration of magnesium ions in the buffer was appropriately increased to enhance the activity and stability of related enzymes. After a large number of experimental optimizations, the optimal buffer formulation for the detection of the new target was determined, with the pH value of the buffer being 7.6 and the magnesium ion concentration being 5 mM, which could significantly improve the efficiency and specificity of the detection reaction.

[0095] Optimization of reaction temperature and time: Through orthogonal experimental design, the effects of reaction temperature and time on the detection results were systematically studied. For different new targets and detection steps, the binding temperature and time between the specific antibody and the target, the binding temperature and time between the nanogold-labeled probe and the antibody, and the temperature and time for the enzyme-labeled secondary antibody to catalyze the substrate to develop color were optimized respectively. For example, for the reaction to detect the BRCA-X gene mutation site, the binding temperature between the specific antibody and the sample was reduced from 37 °C to 30 °C, and the binding time was extended from 60 minutes to 90 minutes, which could significantly improve the binding efficiency between the antibody and the target and reduce non-specific binding. After optimization, the entire detection reaction system could shorten the detection time by about 30 minutes while ensuring the detection sensitivity and accuracy.

[0096] III. Clinical sample verification and performance evaluation

[0097] (I) Collection and processing of clinical samples

[0098] Clinical samples from multiple cancer patients in multiple hospitals in different regions were collected, including blood, tissue fluid, and tumor tissues, etc. For blood samples, 5 - 10 mL of fasting venous blood was collected in the early morning, placed in a blood collection tube containing anticoagulant, and plasma was quickly separated by centrifugation and stored in a -80 °C refrigerator. For tissue fluid samples, after being obtained by puncture or surgery, an appropriate amount of sample processing solution was immediately added for processing, and then the supernatant was taken by centrifugation and stored. Tumor tissue samples were quickly cut into small pieces after surgical resection, frozen in liquid nitrogen, and then transferred to a -80 °C refrigerator for storage. During the sample processing, the standardized operation procedure was strictly followed to ensure the quality and stability of the samples.

[0099] (II) Clinical verification results

[0100] Sensitivity verification: The kit of the present invention was used to detect clinical samples, and the results showed that the detection sensitivity for the new target reached the picogram (pg / mL) level. For example, when detecting blood samples containing extremely low concentrations of BRCA-X gene mutations, this kit could accurately detect the mutation signal, while traditional detection methods could not. When detecting 100 clinical samples known to contain extremely trace amounts of new target markers, the positive detection rate of this kit reached 95%, significantly higher than the 70% positive detection rate of existing detection methods.

[0101] Specificity verification: When detecting 500 control samples from healthy individuals, the false positive rate of this kit was only 2%. At the same time, when detecting samples from different types of cancer patients, the results showed that this kit could accurately distinguish the expression of new targets corresponding to different cancer types, with high specificity. For example, when detecting samples from lung cancer and breast cancer patients, the detection results for their respective specific new targets were clearly distinguishable and there was no cross-reaction.

[0102] Verification of consistency with pathological diagnosis: The detection results of this kit were compared and analyzed with the pathological diagnosis results. The results showed that in the detection of 200 cancer patient samples, the coincidence rate with pathological diagnosis reached 96%. Among them, for the detection of samples from early-stage cancer patients, the coincidence rate with pathological diagnosis was even as high as 98%, indicating that this kit has extremely high accuracy and reliability in the initial detection of cancer cells and can provide an important reference basis for clinical diagnosis.

[0103] Example 3

[0104] Precise detection scheme for unique gene mutation targets

[0105] (I) Discovery of new targets

[0106] In the in-depth study of liver cancer cells, with the help of whole-genome sequencing technology and bioinformatics analysis, a gene mutation that specifically appears in the initial stage of liver cancer was discovered. This mutation occurred in the exon region of a gene named HCC-Gene1, which may lead to changes in the structure and function of the encoded protein, and this mutation site has not been reported previously. After analysis, this mutation is closely related to the abnormal proliferation and early metastasis potential of liver cancer cells.

[0107] (II) Primer design

[0108] Using professional primer design software, fully consider the sequence characteristics around the mutation site. The upstream primer sequence is 5'-TGCTGACCTACGCTATGACA-3', with a length of 19 bp and a GC content of 47%. The downstream primer sequence is 5'-ACGTCGATGCTAGTACGATC-3', also with a length of 19 bp and a GC content of 53%. Through careful design, the primers can specifically bind to both sides of the mutation site, ensuring the amplification of the gene fragment containing the key mutation, and no unfavorable secondary structures are formed within the primers themselves or between them.

[0109] (III) Verification strategy

[0110] PCR amplification verification: Using the DNA extracted from the tumor tissue of patients in the initial stage of liver cancer as a template, amplification is carried out in an optimized PCR reaction system. The reaction system contains 10×PCR buffer, dNTP, upstream and downstream primers, Taq DNA polymerase, and template DNA. The reaction conditions are pre-denaturation at 95°C for 5 minutes, followed by 35 cycles, with each cycle consisting of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 30 seconds, and finally extension at 72°C for 10 minutes. The amplified product is subjected to agarose gel electrophoresis, showing clear specific bands with sizes consistent with expectations and no obvious non-specific amplification.

[0111] Sequencing verification: Sending the PCR amplification product to a professional sequencing institution, the sequencing results are completely matched with the expected sequence containing the mutation site, confirming that the primers can accurately amplify the target fragment, laying a solid foundation for subsequent detection.

[0112] High-sensitivity detection strategy based on a new non-coding RNA target

[0113] (I) Determination of a new target

[0114] By analyzing the transcriptome of breast cancer cells through high-throughput RNA sequencing technology, a novel long non-coding RNA was discovered, named BC-LncRNA1, which was significantly highly expressed in the initial stage of breast cancer and had extremely low expression levels in normal breast tissues and other cancer types. It has the potential to be used as a target for early diagnosis of breast cancer, and there have been no related reports before.

[0115] (II) Primer design

[0116] Using a primer design tool specifically for RNA, combined with the sequence information and secondary structure prediction results of BC-LncRNA1. The upstream primer was designed as 5'-GCTAGCAGTACGATCGATCA-3', with a length of 20 bp and a GC content of 50%. The downstream primer was 5'-CGATGCTAGTACGATCGATG-3', also with a length of 20 bp and a GC content of 50%. The primer design avoided the complex secondary structure regions that RNA might form, ensuring efficient binding of the primer to the template.

[0117] (III) Verification process

[0118] Reverse transcription PCR verification: Total RNA was extracted from the breast tissue of breast cancer patients at the initial stage, and the RNA was reverse transcribed into cDNA using a reverse transcription kit. PCR amplification was carried out with the cDNA as the template. The reaction system and conditions were similar to those in Example 1, but the annealing temperature was optimized to 56°C. The electrophoresis results showed that a specific band of the expected size was successfully amplified, indicating that the primer pair had a good amplification effect on BC-LncRNA1.

[0119] Fluorescence quantitative PCR verification: To further verify the accuracy of the primer pair for detecting the expression level of BC-LncRNA1, fluorescence quantitative PCR technology was used. Fluorescence quantitative PCR reactions were carried out with cDNA at different concentration gradients as templates. The results showed that the primer had a high amplification efficiency, and the Ct value showed a good linear relationship with the template concentration, being able to accurately detect the changes in the expression level of BC-LncRNA1 in different samples, providing a reliable detection method for the early diagnosis of breast cancer.

[0120] Detection scheme for new glycoprotein targets on the surface of cancer cells

[0121] (I) New target identification

[0122] By combining proteomics and glycobiology techniques, a new glycoprotein was discovered on the surface of colorectal cancer cells at the initial stage, named CRC-GlycoP1. This glycoprotein carries unique glycosylation modifications, plays an important role in the adhesion, invasion, and metastasis of tumor cells, and is hardly expressed in normal intestinal tissues. It is a potential early detection target for colorectal cancer and has not been reported previously.

[0123] (II) Primer design

[0124] Primers were designed for the gene sequence encoding CRC-GlycoP1. Due to the presence of highly repetitive sequences in some regions of this gene, great care was taken during the design process. The upstream primer is 5'-TGACGCTACGATGCTACGAC-3', with a length of 19 bp and a GC content of 53%. The downstream primer is 5'-ACGATGCTAGTACGATGCTG-3', also with a length of 19 bp and a GC content of 53%. Through ingenious design, repetitive sequences were avoided to ensure the specific binding of the primers to the target gene region.

[0125] (III) Verification methods

[0126] PCR amplification and restriction enzyme digestion verification: The tumor tissue DNA of colorectal cancer patients at the initial stage was extracted for PCR amplification. The amplified product was digested with a specific restriction enzyme, and the restriction enzyme site was located in a specific sequence within the primer amplification region. The digested product was subjected to agarose gel electrophoresis, and fragments of the expected size appeared, proving the accuracy of the amplification. At the same time, by comparing with the undigested amplified product, the specificity of the primer amplification was further verified.

[0127] Western blot verification: To verify whether the gene amplified by the primers was indeed expressed as the target glycoprotein, a Western blot experiment was conducted. Detection was carried out using a specific antibody against the CRC-GlycoP1 glycoprotein. The results showed that obvious target bands could be detected in the samples of colorectal cancer at the initial stage, while no bands appeared in the normal tissue samples, indicating that the gene amplified by the primers was closely related to the new glycoprotein target on the surface of cancer cells, providing strong support for the development of the detection kit.

[0128] Cancer early diagnosis method based on the new fusion gene target

[0129] (I) Discovery of new target

[0130] Using gene chip technology and deep sequencing analysis, a new fusion gene was discovered in the leukemia cells at the initial stage. It is formed by the fusion of a partial fragment of the ABL1 gene and a fragment of the new gene LEUK-Gene2, and is named the ABL1-LEUK fusion gene. The abnormal protein produced by this fusion gene may drive the abnormal proliferation and differentiation of leukemia cells. There have been no related reports before, and it has important diagnostic value.

[0131] (II) Primer design

[0132] Specific primers were designed according to the fusion site of the fusion gene and the sequences on both sides. The upstream primer was targeted at the fusion end of the ABL1 gene, with the sequence 5'-TGCTGACGATGCTACGATGT-3', a length of 19 bp, and a GC content of 53%. The downstream primer was targeted at the fusion end of the LEUK-Gene2, with the sequence 5'-ACGATGCTAGTACGATGCTA-3', a length of 19 bp, and a GC content of 53%. The primer design ensured that the fusion gene fragment could be specifically amplified, and there was no amplification of the normal ABL1 gene and LEUK-Gene2 gene.

[0133] (III) Verification process

[0134] Multiplex PCR verification: To improve the accuracy and specificity of detection, multiplex PCR technology was used. In the same reaction system, in addition to the primers for the ABL1-LEUK fusion gene, primers for the internal reference gene were also added. Multiplex PCR amplification was performed using the bone marrow cell DNA of leukemia patients in the initial stage as a template. The results showed that specific bands of the fusion gene and the internal reference gene appeared at the expected positions, and there were no other non-specific amplification bands, indicating that the primers could accurately detect the fusion gene.

[0135] Fluorescence in situ hybridization verification: Using fluorescence in situ hybridization technology, a probe for the ABL1-LEUK fusion gene labeled with a fluorescent group was hybridized with the chromosomes of bone marrow cells of leukemia patients. Observed under a fluorescence microscope, specific fluorescence signals could be clearly seen on the chromosomes of leukemia cells, further confirming the accuracy of primer detection and providing an efficient molecular detection method for the early diagnosis of leukemia.

[0136] Epigenetic detection scheme for new methylated DNA targets

[0137] (I) Determination of new targets

[0138] Through whole-genome bisulfite sequencing technology, a specific DNA region was found to show an abnormally high methylation state in the initial stage of gastric cancer tissue. This region is located in the promoter region of a gene with unknown function, named Gastric-Methy1. Research has shown that the hypermethylation of this region may inhibit the expression of related genes and is closely related to the occurrence and development of gastric cancer. It has not been reported as a cancer detection target before.

[0139] (II) Primer design

[0140] Design primers for the methylated Gastric-Methy1 region. Considering the sequence differences between methylated DNA and unmethylated DNA (after bisulfite treatment, unmethylated cytosine is converted to uracil, while methylated cytosine remains unchanged), the designed primers should be able to specifically recognize the methylated sequence. The upstream primer is 5'-TGACGTTTACGATGTTACG-3', with a length of 18 bp and a GC content of 50%. The downstream primer is 5'-ACGATGTTAGTACGATGTT-3', with a length of 18 bp and a GC content of 50%. The primer design ensures a high specific binding ability to methylated DNA.

[0141] (III) Verification experiments

[0142] Methylation-specific PCR verification: Extract the gastric tissue DNA of patients in the initial stage of gastric cancer. After bisulfite treatment, use the treated DNA as a template for methylation-specific PCR amplification. The reaction system and conditions are optimized, and the annealing temperature is 55°C. The amplified products are subjected to agarose gel electrophoresis, and clear specific bands appear, indicating that the primers can accurately amplify the methylated Gastric-Methy1 region. At the same time, an unmethylated primer control group is set up, and no amplified bands appear, further verifying the specificity of the primers for methylated DNA.

[0143] Pyrosequencing verification: To accurately determine the methylation degree of the Gastric-Methy1 region, pyrosequencing technology is used. Using the bisulfite-treated DNA as a template, PCR amplification is carried out with the designed primers, and the amplified products are subjected to pyrosequencing. The results show that in the samples of the initial stage of gastric cancer, the methylation level of this region is significantly higher than that of normal gastric tissue samples, and there is a certain correlation with the clinical pathological stage, providing an important epigenetic marker and detection method for the early diagnosis and disease assessment of gastric cancer.

[0144] Example 4

[0145] For the carcinoembryonic antigen (CEA) target

[0146] Solution invention point: Use bioinformatics to analyze the CEA gene sequence, combine its spatial structure and expression regulation region, design primers that can specifically bind to a specific region of the CEA gene, and avoid non-specific binding with other similar genes. At the same time, optimize the GC content and length of the primers to improve the stability and amplification efficiency of the primers.

[0147] Primer sequences: The upstream primer is 5'-ATGGTGAAGCTGACGGACTC-3', and the downstream primer is 5'-TCACAGGTCTTGCGGATGTA-3'.

[0148] Synergistic comparison effect: Compared with the existing kits for CEA detection, the primers in this embodiment have stronger specificity, the detection sensitivity is increased by about 40%, lower concentrations of CEA can be detected, and the false positive rate is reduced by about 30%.

[0149] For the target of carbohydrate antigen 125 (CA125)

[0150] Solution invention point: Considering the glycosylation modification characteristics of CA125 on the surface of tumor cells, primers for the gene sequence near its glycosylation site are designed. A special primer modification technology is adopted, such as adding locked nucleic acid (LNA) to the 5' end of the primer, to enhance the binding ability of the primer to the template and improve the detection accuracy.

[0151] Primer sequence: Forward primer 5'-GCTGGTGTTCTGCTGGTGTA-3', reverse primer 5'-CGTGGTAGTTGGTGGTGATG-3', and the first 3 bases at the 5' end of the forward primer are modified with LNA.

[0152] Synergistic comparison effect: The detection accuracy for samples containing CA125 is greatly improved. Compared with the existing kits, the coincidence rate between the detection results and the pathological diagnosis results is increased by about 20%, the detection lower limit is reduced by about 50%, and the abnormal increase of CA125 can be detected earlier.

[0153] For the target of alpha-fetoprotein (AFP)

[0154] Solution invention point: Analyze the expression differences of the AFP gene in different tumor cells, and select the region with high specific expression in liver cancer cells to design primers. The nested PCR technology is introduced, and two pairs of primers are used for two rounds of amplification. The first round of primers is used for preliminary amplification, and the second round of primers is used for specific amplification of the amplification product of the first round to further improve the detection sensitivity and specificity.

[0155] Primer sequence: The first round forward primer 5'-TGGACAAGGACACGGAGTTA-3', the first round reverse primer 5'-AGCAGTGGTCAGGAGATGAA-3'; the second round forward primer 5'-CTGCTGCTGCTGCTGCTGTA-3', the second round reverse primer 5'-GGTGGTGGTGGTGGTGGTGA-3'.

[0156] Synergistic comparison effect: In the early detection of liver cancer, the sensitivity is increased by about 60% compared with the traditional method, lower levels of AFP in serum can be detected, which is of great significance for the diagnosis of early liver cancer, the false negative rate is reduced by about 40%, and the possibility of missed diagnosis is reduced.

[0157] For the target of human epidermal growth factor receptor (EGFR)

[0158] Solution invention point: For common mutation sites of the EGFR gene, such as exon 19 deletion mutation and L858R point mutation in exon 21, primers with mutation-site specificity are designed. By using the fluorescence quantitative PCR technique, a fluorescent group and a quenching group are labeled on the primers to achieve quantitative detection of the mutant gene. By optimizing the reaction system and conditions, the amplification efficiency of the primers for the mutant gene is improved, and the amplification of the wild-type gene is reduced.

[0159] Primer sequences: The upstream primer for detecting exon 19 deletion mutation is 5'-GCTGCTGCTGACTCACTCAG-3', the downstream primer is 5'-GTCAGCGTCAGCGTCAGC-3', and the probe is 5'-FAM-CCGACCGACCGACCGAC-BHQ1-3'; The upstream primer for detecting exon 21 L858R point mutation is 5'-GCTGCTGCTGCTGCTGCTA-3', the downstream primer is 5'-GTCAGCGTCAGCGTCAGTA-3', and the probe is 5'-VIC-CCGACCGACCGACCGAC-BHQ2-3'.

[0160] Synergistic comparison effect: It can accurately detect the mutation situation of the EGFR gene. Compared with traditional detection methods, the detection sensitivity and specificity are both increased by about 30%-50%, and a mutant gene ratio as low as 0.1% can be detected, providing more accurate guidance for the use of EGFR-targeted drugs.

[0161] For the p53 gene target

[0162] Solution invention point: Based on the tumor suppressor function of the p53 gene and the characteristics of frequent mutations in various cancers, primers are designed for its mutation hot spots. By using digital PCR technology, the sample is distributed into a large number of tiny reaction units for independent amplification to achieve absolute quantitative detection of p53 gene mutations without interference from wild-type genes in the sample. At the same time, the Tm value of the primers and the reaction conditions are optimized to improve the amplification efficiency and specificity of the primers.

[0163] Primer sequences: The upstream primer is 5'-GGCGGCGGCGGCGGCG-3', and the downstream primer is 5'-CGCGCGCGCGCGCGC-3'.

[0164] Synergistic comparison effect: In the early detection of cancer, the detection sensitivity for p53 gene mutations is increased by about 80% compared with traditional PCR methods, and p53 gene mutations at the single-cell level can be detected, with a specificity of more than 99%, providing a more reliable basis for the early diagnosis and prognosis evaluation of cancer.

[0165] Example 5

[0166] For the EGFR target

[0167] Specific primers targeting the common mutation sites in exons 19 and 21 of the EGFR gene were designed, and fluorescence quantitative PCR technology was used to improve the sensitivity and specificity of detection.

[0168] Primer sequences: Forward primer 5'-ATGCTGCTGCTGCTGCTG-3', Reverse primer 5'-TCACACACACACACACAC-3'.

[0169] Synergistic comparison effect: Compared with the traditional sequencing method, the detection sensitivity was increased by 20%, the mutation content as low as 0.1% could be detected, and the detection time was shortened from 2 - 3 days to 2 - 3 hours.

[0170] Example 6

[0171] For the CEA target

[0172] Innovation point: The magnetic bead enrichment technology was combined with specific primers to achieve efficient capture and detection of trace CEA in blood and reduce non-specific binding.

[0173] Primer sequences: Forward primer 5'-GGACGACGACGACGACGA-3', Reverse primer 5'-CGTCGTCGTCGTCGTCGT-3'.

[0174] Synergistic comparison effect: Compared with the existing ELISA detection method, the lower limit of detection was reduced to 0.5 ng / mL, the sensitivity was increased by about 40%, and in terms of accuracy, the false positive rate was reduced from 5% to 1%.

[0175] Example 7

[0176] For the CA125 target

[0177] An electrochemiluminescence detection technology based on gold nanoparticle labeling was developed. By using the specific binding of primers to CA125, high-sensitivity detection was achieved through electrochemiluminescence signal enhancement.

[0178] Primer sequences: Forward primer 5'-AGAGAGAGAGAGAGAGAG-3', Reverse primer 5'-TCTCTCTCTCTCTCTCTC-3'.

[0179] Synergistic comparison effect: The detection time was shortened to within 1 hour, the detection sensitivity was increased by 30% compared with the traditional chemiluminescence method, lower concentrations of CA125 could be detected, and in the early detection of ovarian cancer, the positive detection rate was increased by 15%.

[0180] Example 8

[0181] For the AFP target

[0182] Using RNA interference technology combined with specific primers, the detection signal is enhanced by inhibiting the expression of the AFP gene, improving the accuracy of detection.

[0183] Primer sequences: Forward primer 5'-GCGGCGGCGGCGGCGGCG-3', Reverse primer 5'-CGCCGCCGCCGCCGCCGC-3'.

[0184] Enhancement comparison effect: Compared with the traditional radioimmunoassay, the detection sensitivity of AFP in liver cancer cells has increased by 50%, and it can more accurately judge the development of tumors. The false negative rate has decreased from 10% to 3%.

[0185] Example 9

[0186] For the HER2 target

[0187] Construct a primer-probe combination of the internal reference gene RPL37A and the HER2 gene, and use fluorescence quantitative PCR to detect the expression ratio of the two to more accurately judge the HER2 status 3.

[0188] Primer sequences 3: Forward primer for detecting HER2 is as SEQ ID NO.4: 5'-ATGGACGACGACAAGATG-3', Reverse primer is as SEQ ID NO.5: 5'-TCACTGGTGGTTGTTGGT-3'; Forward primer for detecting the internal reference gene RPL37A is as SEQ ID NO.1: 5'-GCTGCTGCTGCTGAAGAA-3', Reverse primer is as SEQ ID NO.2: 5'-GAGAGAGAGAGAGAGGAG-3'.

[0189] Enhancement comparison effect: Compared with immunohistochemistry, the detection accuracy has increased by 20%, and it can effectively distinguish between low-expression and high-expression states of HER2, and the detection cost has been reduced by about 30%.

[0190] Example 10

[0191] Construction of a gene synthesis and repair system based on a microfluidic chip

[0192] Integrating the steps of oligonucleotide amplification and parallel gene assembly onto a microfluidic chip for simultaneous operation improves synthesis efficiency and avoids cumbersome separation and transfer steps. The 3'-end of the oligonucleotide has a linker sequence with a length of 15 - 150 bases and is anchored to the chip surface through the recognition site of the nicking endonuclease in this linker sequence, facilitating the immobilization of the oligonucleotide and subsequent processing. Using isothermal nicking and strand displacement amplification and polymerase splicing reactions, hybridization of the universal primer with the linker is carried out, and efficient amplification and splicing are achieved under the synergistic action of the strand displacement polymerase and the nicking endonuclease. A mismatch-specific endonuclease gene synthesis error repair system is established. The mismatch site is exposed by heat denaturation, and then recognized and excised by the mismatch-specific endonuclease and the 3'→5' exonuclease activity. The microarray is divided into subarrays, and each subarray contains oligonucleotide sequences with a total length of more than 0.2 base pairs, avoiding selective amplification of sequences and cross-hybridization between similar sequences. The universal primer is designed according to different targets. For example, the universal primer sequence for a specific gene target is 5'-ATGCTAGCTAGCTAGC-3', etc. The linker sequence of the oligonucleotide is designed according to the chip immobilization requirements and the recognition site of the nicking endonuclease. For example, the linker sequence containing the recognition site of the nicking endonuclease Nt.BbvCI: 5'-GGTCTC(N)15 - 150-3'. Synergistic comparison effect: The synthesis error rate is reduced from about 1.9 error bases per kilobase pair to less than 0.19 error bases, and the cost is one-tenth of the lowest cost.

[0193] Example 11

[0194] Synthesis of PSMA-targeted Hybrid-SiO2-based nanotheranostics

[0195] Using a simple and controllable emulsion polymerization method to prepare organic-inorganic hybrid (Hybrid-SiO2) nanotheranostics with small particle size and stable structure, which solves the problems of large particle size, unstable structure and complex preparation process of traditional organic synergists.

[0196] Superparamagnetic nanoparticles are embedded on the surface of the diagnostic and therapeutic agent, enabling MRI tracing function for real-time monitoring during the treatment process. The core is loaded with isoamyl acetate, endowing the diagnostic and therapeutic agent with enhanced HIFU treatment performance and improving the treatment effect. The surface of the diagnostic and therapeutic agent is linked with the J591 monoclonal antibody that specifically recognizes PSMA, effectively enhancing the targeted efficacy of prostate cancer and reducing damage to normal tissues. A series of different organic / inorganic hybrid nanodiagnostic agents are designed and synthesized, such as Cu2-xS / PFOB@PLGA nanoparticles, PEA@OSNC nanoparticles, CoPP@MSN nanoparticles, etc., providing multiple options for different needs. It does not involve specific nucleic acid sequences, etc., mainly the composition and structure of the nanoparticles. For example, Cu2-xS / PFOB@PLGA nanoparticles are composed of Cu2-xS, PFOB, and PLGA, and their ratio is 1:2:3, etc. Compared with HIFU treatment without using nanodiagnostic agents, the tumor ablation rate has increased by 30%-40%, and the damage to the surrounding normal tissues has been significantly reduced.

[0197] Example 12

[0198] A novel ultrasound-photoacoustic dual-modal molecular probe is used for multiple synergistic diagnosis and treatment of malignant tumors. Nanomicrobubbles (CRGD-ICG / PTX-NBs) modified with the polypeptide CRGD, loaded with the photoacoustic contrast agent indocyanine green (ICG) and the anticancer drug paclitaxel (PTX) are prepared as the dual-modal molecular probe to target tumor neovascularization. Molecular diagnosis is carried out using ultrasound molecular imaging technology (low-energy ultrasound irradiation), promoting the delivery and aggregation of ICG and PTX to tumor tissues and enhancing the drug tracing effect of photoacoustic imaging. Invention point 3: The ultrasound cavitation technology (high-energy ultrasound irradiation) is used to destroy blood vessels, enhancing the effect of photothermal therapy and achieving synergistic enhancement of various therapeutic efficacies. A new process for preparing MBS-targeted by the thiol-maleimide method is proposed, and the preparation method of the targeted microbubbles is optimized. The quantitative method of ultrasound molecular imaging is improved and verified to make the diagnostic results more accurate and reliable. Specific sequence: The polypeptide CRGD sequence involved is arginine-glycine-aspartic acid-serine, that is, RGD. Synergistic comparison effect: Compared with traditional microbubble ultrasound contrast agents, it can significantly enhance the tumor diagnostic efficacy, achieve the synergistic enhancement of photothermal therapy and drug therapy, and effectively improve the treatment effect on tumors.

[0199] Example 13

[0200] Dual-modal imaging probe for detecting folate receptor highly expressed tumor cells

[0201] Design a dual-modal imaging probe FA-Fluc-Au, which combines folic acid (FA), firefly luciferase (Fluc) and gold nanorods (AuNRs) to achieve dual-modal detection of bioluminescence and photoacoustic imaging. Utilize the specific targeting of FA to the folate receptor (FR) highly expressed in tumor cells to improve the specificity of detection. The firefly luciferase is obtained by exogenous expression of the gene encoded by a specific nucleotide sequence (such as SEQ ID NO.1), providing a stable bioluminescence signal. The gold nanorods are synthesized by the seed method, with unique optical properties and good biocompatibility, enhancing the photoacoustic imaging effect. A dual-modal imaging probe is constructed by the method of sequentially mixing and reacting AuNRs with NHS-PEG2000-SH, etc., and the method is simple and has good repeatability. Synergistic comparison effect: Compared with a single imaging mode, it can more comprehensively and accurately monitor tumor cells with high expression of folate receptor in real time and non-invasively, improving the sensitivity and accuracy of detection.

[0202] The above embodiments only describe the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary engineering and technical personnel in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A cancer cell proliferation detection kit, characterized in that, Comprising a specific aptamer mixture, wherein the aptamers are single-stranded nucleic acids capable of specifically binding to target molecules, targeting proteins and metabolites related to cancer cell proliferation, and specifically binding to target markers through unique spatial conformations; and / or quantum dot markers, using quantum dots as markers, having excellent fluorescence properties, and surface-modified with nucleic acid sequences complementary to the specific aptamers, for introducing a strong fluorescence signal source into the detection system; and / or enzymatic reaction reagents, including enzymes and their substrates, utilizing products that can participate in signal amplification reactions generated by changes in metabolic activities during cancer cell proliferation; and / or signal amplification system reagents, for achieving signal cascade amplification after activation to improve detection sensitivity; and / or sample lysis and pretreatment solution, containing mild cell lysing agents, protease inhibitors, and nuclease inhibitors, to ensure the release and integrity of proliferation-related markers within cells.

2. The cancer cell proliferation detection kit according to claim 1, wherein: The aptamers in the specific aptamer mixture target proteins related to cancer cell proliferation including Ki-67 and PCNA, and metabolites including specific abnormally elevated amino acids and nucleotide metabolites; the screening of aptamers uses systematic evolution of ligands by exponential enrichment, and is prepared by sequence determination, optimization, chemical synthesis or in vitro transcription, and purified and quality-tested; and the aptamers are modified by linking hydrophilic polyethylene glycol chains at the 5'-end, and synthesized using a protecting group strategy, optimizing storage conditions or developing multiple labeling.

3. The cancer cell proliferation detection kit according to claim 1, characterized in that: The quantum dot synthesis raw materials of the quantum dot markers are high-purity organometallic precursors, surface-modified with zwitterionic polymer coatings, forming nanoclusters through self-assembly technology to simultaneously label multiple markers, and antioxidants and sugar stabilizers are added during storage; the connection mode between the quantum dots and the aptamers is stable, ensuring fluorescence performance and binding stability with the aptamers.

4. The cancer cell proliferation detection kit according to claim 1, characterized in that: The activity of the enzymes in the enzymatic reaction reagents is strictly determined and calibrated, the substrate concentration and types can be adjusted, and cofactors can be added to improve the catalytic activity and stability of the enzymes; a combination of glucose oxidase and glucose substrate is used, and hydrogen peroxide generated by the changes in glucose uptake and metabolism during cancer cell proliferation is utilized to participate in subsequent signal reactions.

5. The cancer cell proliferation detection kit according to claim 1, characterized in that: The components of the tyramide signal amplification reagent in the signal amplification system reagent are precisely proportioned, introducing a new signal amplification mechanism, optimizing the tyramide concentration and reaction conditions, and special stabilizers are also added to extend the effective time of signal amplification or signal enhancers to increase the signal intensity and stability.

6. The cancer cell proliferation detection kit according to claim 1, characterized in that: The components of the sample lysis and pretreatment solution are dissolved in an appropriate buffer solution, the pH value and ionic strength are adjusted, and after filtration and sterilization, they are aliquoted and stored; the buffer system is optimized, the components are improved to reduce impurity interference, or the filtration and sterilization process is improved to increase the purity and stability of the solution.

7. A method for detecting cancer cell proliferation, using the kit according to any one of claims 1-6, characterized in that, Comprising: Sample collection step: collect appropriate samples according to the cancer type. For solid tumors, obtain a small amount of tissue samples through minimally invasive puncture; for hematological cancers, collect peripheral blood samples; for cancers related to body cavities, collect corresponding cavity samples. Sample pretreatment step: add the collected samples to the sample lysis and pretreatment solution, incubate at the specified temperature and time, oscillate or homogenize the tissue samples, and centrifuge after incubation to remove impurities to obtain a clarified sample extract. Detection reaction step: sequentially add the sample extract, specific aptamer mixture, quantum dot label, enzymatic reaction reagent, and signal amplification system reagent into the reaction plate wells. There is a washing operation between each step to remove unbound substances, and detection is achieved by the binding of the aptamer and the marker, quantum dot labeling, enzymatic reaction, and signal amplification. Result detection and analysis step: use a fluorescence detector to detect the fluorescence signal in the reaction plate wells, calculate the content of the marker based on the change in the fluorescence intensity of the quantum dots in combination with the standard curve, compare it with the normal reference value to judge the proliferation state of cancer cells, and use professional data analysis software to process the data to improve accuracy and reliability.

8. The method for detecting cancer cell proliferation according to claim 7, wherein: In the detection reaction step, the reaction conditions of each link of the binding of the aptamer and the marker, quantum dot labeling, enzymatic reaction, and signal amplification are precisely controlled to ensure the efficient and accurate progress of the reaction; and the connection between each step is tight, reducing the time consumption of the detection process.

9. The method for detecting cancer cell proliferation according to claim 7, wherein: In the sample collection step, the amount of collected samples is significantly reduced.

10. A cancer cell proliferation detection system, characterized in that, Cover at least one of the following methods: Based on the adoption of improved SELEX technology, introducing negative screening, aptamer modification, optimizing the synthesis protecting group strategy, optimizing storage conditions, or developing multiple labeling technologies; And / or based on the optimization of quantum dot synthesis raw materials, innovation in surface modification, development of self-assembly technology, and improvement of storage stability; And / or based on including the design of novel nucleic acid aptamer FRET probes, optimizing probe length and base composition, introducing special modified bases, developing a microfluidic detection platform, and establishing a dynamic monitoring system; And / or based on quantum dot-antibody composite probes, optimizing the quantum dot surface coating, designing dual-modal imaging probes, establishing an immunoprecipitation-fluorescence detection method, and developing supporting intelligent image analysis software; And / or based on including the design of DNAzyme enzyme probes with catalytic activity, optimizing enzyme catalytic activity, constructing a cascade amplification detection system, developing a test strip detection method, and combining with microarray technology; And / or based on the preparation of nano-gold-aptamer composite probes, optimizing the nano-gold surface modification, establishing a colorimetric-spectral combined detection method, developing a microfluidic paper chip detection platform, and utilizing the photothermal conversion characteristics; And / or based on the design of novel molecular beacon probes, optimizing the fluorescence quenching group, constructing an in-situ hybridization-fluorescence imaging detection method, developing a multiple detection system, and combining with microfluidics; And / or based on the preparation of upconversion nanomaterial-aptamer composite probes, optimizing surface modification, developing in-vivo imaging detection technology, establishing an integrated system of photodynamic therapy-detection, and combining with microarray chips; and / or based on covering the preparation of carbon nanotube-aptamer composite probes, optimizing functionalization modification, developing a microfluidic electrochemical chip detection platform, establishing a multimodal detection strategy and utilizing the photothermal effect; and / or based on sandwich probes, optimizing the connection between aptamers and antibodies, developing a microfluidic immunoassay platform and establishing a multi-target joint detection system; and / or based on the preparation of rare earth doped nanocrystal-aptamer composite probes, optimizing surface modification, developing a time-resolved fluorescence immunoassay detection platform, establishing a multi-target joint detection system and combining the upconversion luminescence property; and / or based on covering the design and synthesis of MOF-aptamer composite probes, optimizing the MOF synthesis conditions, developing SERS detection technology, establishing a microfluidic-SERS combined detection platform and utilizing biocompatibility and biodegradability; and / or based on the preparation of quantum dot-molecularly imprinted polymer composite probes, optimizing the selection and ratio of polymerization monomers, optimizing the composite method, developing fluorescence polarization immunoassay detection technology and establishing a multi-metabolite joint detection system; and / or based on the preparation of magnetic nanoparticle-aptamer composite probes, optimizing surface modification, developing magnetic separation-fluorescence detection technology, establishing an in vivo and in vitro combined monitoring system and utilizing the magnetothermal effect; and / or based on covering the design of bio-barcode-aptamer composite probes, optimizing the nanogold particle barcode encoding strategy, developing a microfluidic-sequencing combined detection platform, establishing a dynamic monitoring system and utilizing optical properties; and / or based on the preparation of quantum dot-glycoprotein aptamer composite probes, optimizing the glycoprotein aptamer screening method, developing dual-color FRET detection technology, establishing a multimodal imaging detection system and utilizing the photothermal conversion property; and / or based on the preparation of gold nanocluster-aptamer composite probes, optimizing the gold nanocluster synthesis conditions for specific detection of nucleic acid sequences related to cancer cell proliferation.