OMICRON coronavirus vaccine constructs and methods of making and using same

Abstract

Provided herein are adenoviral vectors encoding spike protein variants of an SARS-CoV2 coronavirus, and compositions comprising the vectors. Also provided are methods of preventing and treating SARS-CoV2 using the provided compositions.

Description

[0001] Government Support

[0002] This invention was made with government support under CA211096 awarded by the National Institutes of Health. The government has certain rights in the invention. Field of the Invention

[0003] The present disclosure generally relates to the fields of biotechnology and medicine, and more particularly, to nucleic acid constructs, polypeptides, and vectors that can be used in vaccines to enhance therapies against respiratory virus infections, and methods of using the same.

[0004] Cross - Reference to Related Applications

[0005] This application claims the benefit of U.S. Provisional Application No. 63 / 434,815, filed Dec. 22, 2022, U.S. Provisional Application No. 63 / 384,075, filed Nov. 16, 2022, U.S. Provisional Application No. 63 / 375,803, filed Sep. 15, 2022, and U.S. Provisional Application No. 63 / 305,979, filed Feb. 2, 2022, the disclosures of which are incorporated herein by reference in their entireties. Background of the Invention

[0006] Viral infections cause hundreds of thousands of deaths each year. However, treatment options for many viruses are limited. In addition, virus carriers may be asymptomatic, leading to a high transmission rate among infected but asymptomatic individuals. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is the pathogen of the COVID-19 syndrome, which can rapidly progress to pneumonia, respiratory failure, and systemic inflammatory disease. SARS-CoV-2 is a positive-sense single-stranded RNA virus. As a betacoronavirus, SARS-CoV-2 is related to two other highly pathogenic respiratory viruses, SARS-CoV and Middle East respiratory syndrome coronavirus (MERS-CoV). SARS-CoV-2 infection leads to a clinical syndrome that can progress to respiratory failure and also presents cardiac pathology, gastrointestinal diseases, coagulopathy, and hyperinflammatory syndromes. The elderly, immunocompromised individuals, and those with comorbidities (such as obesity, diabetes, and hypertension) are at greatest risk of dying from COVID-19. Since the start of the pandemic, more than 669 million infections and 6.8 million deaths have been recorded globally.

[0007] The widespread morbidity, mortality, and socio-economic destabilizing consequences of COVID-19 highlight the urgent need to deploy effective SARS-CoV-2 vaccines to mitigate the severity of infection, contain transmission, end the pandemic, and prevent its recurrence. Summary of the Invention

[0008] One aspect of the present technology encompasses an adenovirus vector that contains the genome of a non-human adenovirus. The genome of the adenovirus has been modified such that the vector lacks the native E1 and optionally the E3 or E3B loci and contains a nucleic acid sequence encoding a SARS-CoV-2 spike (S) protein that has an amino acid sequence with at least 80% identity to any one of SEQ ID NOS: 10, 12, 20, or 21 or an immunogenic portion or fragment thereof.

[0009] Another aspect of the present technology encompasses an adenovirus vector that contains a nucleic acid sequence encoding an amino acid sequence with at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identity to any one of SEQ ID NO: 10 - 12, 20, 21 or an immunogenic portion or fragment thereof.

[0010] Another aspect of the present technology encompasses an adenovirus vector that contains or consists of a nucleic acid sequence having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% sequence identity to any one of SEQ ID NO: 13 - 19.

[0011] Another aspect of the present technology encompasses an adenovirus vector comprising a nucleic acid sequence, wherein the nucleic acid sequence encodes an amino acid sequence having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identity to SEQ ID NO:3, and the amino acid sequence comprises at least 10, or at least 15, or at least 20, or at least 25, or at least 30 mutations from the list consisting of: T19I, L24S, del25-27, 69-70del, G142D, V213G, G339D, S371F, S373P, S375F, T376A, K417N, N440K, S477N, T478K, E484A, Q493R, L452R, F486V, Q498R, N501Y, D614G, H655Y, N679K, P681H, R682G, R683S, R685S, N764K, D796Y, A942P Q954H, N969K, K988P and V989P.

[0012] Another aspect encompasses a pharmaceutical composition comprising the adenovirus vector described herein. Similarly, one aspect encompasses an immunogenic composition comprising the adenovirus vector described herein.

[0013] Some aspects of the present technology encompass host cells transduced with the adenovirus vector described herein, or packaging cell lines that produce the adenovirus vector described herein.

[0014] Other aspects of the present technology encompass kits. Generally, the kits include: (i) one or more of the host cells described herein, the packaging cell lines described herein, the adenovirus vectors described herein, the pharmaceutical compositions described herein, or the immunogenic compositions described herein, and (ii) instructions for use.

[0015] Certain aspects of the present technology encompass a coronavirus vaccine comprising the adenovirus vector as detailed herein. In certain aspects, the present technology encompasses a composition comprising the serum of a first subject who has previously received the adenovirus vector described herein, the pharmaceutical composition described herein, or the immunogenic composition described herein. The present technology further encompasses a method of treating a second subject suffering from a coronavirus infection, the method comprising administering to the second subject an immunogenically effective amount of a composition comprising the serum of the first subject.

[0016] In another aspect, the technology encompasses a method of inducing an immune response against a coronavirus in a subject in need thereof. The method includes administering to the subject an immunogenically effective amount of a composition comprising the adenoviral vector described herein, the pharmaceutical composition described herein, or the immunogenic composition described herein.

[0017] Other aspects and iterations will be described in more detail below. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Those skilled in the art will understand that the drawings described below are for illustrative purposes only. The drawings are not intended to limit the scope of the teachings in any way.

[0019] The application file contains at least one color drawing. After a request and payment of the necessary fees, the Patent Office will provide a copy of the color drawing of the present patent application disclosure.

[0020] Figure 1A Diagram showing the transgene cassette: ChAd-control has no transgene insert; ChAd-SARS-CoV-2-S encodes the SARS-CoV-2 S protein with two proline mutations shown.

[0021] Figure 1B Showing the binding of ChAd-SARS-CoV-2-S-transduced 293 cells to anti-S mAb. (Left) Overview: +, ++, +++, - indicate <25%, 25 - 50%, >50% and no binding, respectively. (Right) Representative flow cytometry histograms of two experiments.

[0022] Figure 1C Showing four-week-old female BALB / c mice immunized intramuscularly with ChAd-control or ChAd-SARS-CoV-2-S and boosted four weeks later. The antibody responses in the sera of immunized mice were evaluated on day 21 after the primary immunization or boost.

[0023] Figure 1D Showing the anti-S and RBD IgG levels measured by ELISA.

[0024] Figure 1E Showing the neutralizing activity determined by FRNT. Data pooled from two experiments (n = 15 to 30; Mann-Whitney test: ****, P < 0.0001).

[0025] Figure 1F Showing the analysis of the cell-mediated response after restimulation with an S protein peptide pool on day 7 after the boost immunization. The IFNγ and granzyme B expression in CD8+ T cells of splenocytes and the granzyme B expression only in CD4 + T cells were determined by flow cytometry.

[0026] Figure 1G Shows the frequency and number summary of the positive cell population (n = 5; Mann-Whitney test: *, P < 0.05; **, P < 0.01; ***, P < 0.001). Bars represent the median, and the dotted line is the measured limit of detection (LOD).

[0027] Figure 1H Shows the spleen harvested 7 days after boost and the frequency of cells secreting SARS-CoV-2 spike-specific IgG+ antibodies (ASC) measured by ELISPOT (Mann-Whitney test: ****, P < 0.0001). Bars and columns show the median, and the dotted line represents the measured limit of detection (LOD).

[0028] Figure 2A Shows the S-specific IgG response of sera collected from ChAd control-immunized mice (as described in Figure 1) at day 21 after prime or boost, determined by ELISA. Four-week-old female BALB / c mice were primed or primed and boosted via the intramuscular route with ChAd control or ChAd-SARS-CoV-2-S.

[0029] Figure 2B Shows serum samples collected from mice vaccinated with ChAd-control or ChAd-SARS-CoV-2 at day 21 after prime. Four-week-old female BALB / c mice were primed or primed and boosted via the intramuscular route with ChAd-control or ChAd-SARS-CoV-2-S.

[0030] Figure 2C Shows serum samples collected from mice vaccinated with ChAd-control or ChAd-SARS-CoV-2 at day 21 after boost and the neutralization activity determined by FRNT. Serum neutralization curves corresponding to individual mice for the indicated vaccines are shown (n = 15 - 30 per group). Each point represents the mean of two technical replicates, and the error bars represent the standard deviation (SD). The ChAd-SARS-CoV-2-S vaccine induces neutralizing antibodies as measured by focus reduction neutralization test (FRNT).

[0031] Figure 2D Shows the anti-SARS-CoV-2NP IgG response measured by ELISA in paired sera obtained 5 days before and 8 days after SARS-CoV-2 challenge in ChAd-control or ChAd-SARS-CoV-2-S mice vaccinated via the intramuscular route (n = 5: **P < 0.01; ***P < 0.001; paired t-test). The dotted line represents the mean IgG titer from untreated sera.

[0032] Figure 3 Show the gating strategy for analyzing T cell responses. Four-week-old female BALB / c mice were immunized with ChAd-control or ChAd-SARS-CoV-2-S and boosted four weeks later. T cell responses in splenocytes were analyzed on day 7 after boost. Cells were gated on lymphocytes (FSC-A / SSC-A), single cells (SSC-W / SSC-H), live cells (Aqua-), CD45+, CD19-, and then CD4+ or CD8+ cell populations expressing IFNγ or granzyme B.

[0033] Figure 4A Show the neutralization activity of Hu-AdV5-hACE2 in sera from the indicated vaccine groups by FRNT assay after prime immunization only. Four-week-old female BALB / c mice were primed or primed and boosted. Serum samples were collected one day before Hu-AdV5-hACE2 transduction.

[0034] Figure 4B Show the neutralization activity of Hu-AdV5-hACE2 in sera from the indicated vaccine groups by FRNT assay after prime immunization and boost. Each symbol represents an individual animal; each dot represents two technical replicates, and the bars represent the range. A positive control (anti-Hu-Adv5 serum) was included as a reference frame.

[0035] Figure 5A Is a vaccination and challenge protocol for studying the protective efficacy of intramuscularly delivered ChAd-SARS-CoV-2-S against SARS-CoV-2 infection. Four-week-old BALB / c female mice were immunized with ChAd-control or ChAd-SARS-CoV-2-S. Some mice received a booster dose of the homologous vaccine. On day 35 after immunization, mice were challenged with SARS-CoV-2 as follows: animals were treated with anti-Ifnar1 mAb and transduced with Hu-AdV5-hACE2 via the intranasal route one day later. Five days later, mice were challenged with 4×10 5 plaque-forming units (FFU) of SARS-CoV-2 via the intranasal route.

[0036] Figure 5B Show that tissues were harvested at 4 and 8 dpi for analysis. Infectious virus in the lungs was measured by plaque assay.

[0037] Figure 5C Show that viral RNA levels in the lungs, spleens, and hearts at 4 and 8 dpi were measured by RT-qPCR (C) (n = 3 - 7, Mann-Whitney test: ***P < 0.001).

[0038] Figure 5DShowing in situ hybridization for viral RNA in lungs harvested at 4 dpi using SARS-CoV-2 probes (brown). Images show low magnification (top; scale bar 100 μm) and medium magnification (middle; scale bar 100 μm) as well as high magnification insets (representative images of n = 3 per group).

[0039] Figure 5E Showing fold changes in gene expression of the indicated cytokines and chemokines from lung homogenates at 4 dpi determined by RT-qPCR after normalization relative to Gapdh levels and comparison to unvaccinated, unstimulated controls (n = 7; Mann-Whitney test: ***, P < 0.001).

[0040] Figure 5F Showing that prime-boost immunized mice were challenged on day 35 after boost. Tissues were collected at 4 dpi for analysis. Infectious virus in the lungs was determined by plaque assay.

[0041] Figure 5G Showing that prime-boost immunized mice were challenged on day 35 after boost and viral RNA (G) in the lungs, spleens, and hearts was measured using RT-qPCR (n = 6 - 7; Mann-Whitney test: **, P < 0.01). (B - C and E - G) Bars show median and dashed lines indicate the LOD of the assay.

[0042] Figure 6 Showing that single-dose intramuscular vaccination with ChAd-SARS-CoV-2-S protected mice from SARS-CoV-2-induced pulmonary inflammation. Four-week-old female BALB / c mice were immunized with ChAd-control and ChAd-SARS-CoV-2-S and challenged according to the protocol described in Fig. 5. Lungs were harvested at 8 dpi. Sections were stained with hematoxylin and eosin and imaged at 40× (left; scale bar 250 μm), 200× (middle; scale bar 50 μm), and 400× (right; scale bar 25 μm) magnification. Each image represents a group of 3 mice.

[0043] Figure 7A Showing the experimental protocol for studying the immune response after intranasal immunization with ChAd-SARS-CoV-2-S. Five-week-old female BALB / c mice were immunized via the intranasal route with ChAd-control or ChAd-SARS-CoV-2-S.

[0044] Figure 7B Showing the evaluation of the antibody response in sera of immunized mice one month after priming. ELISA measured SARS-CoV-2 S-specific and RBD-specific IgG.

[0045] Figure 7C Shows the SARS-CoV-2 S-specific and RBD-specific IgA levels measured by ELISA.

[0046] Figure 7D Shows the neutralization activity measured by FRNT. Data were pooled from two experiments, n = 10 - 25 mice per group (Mann-Whitney test: ****, P < 0.0001).

[0047] Figure 7E Shows that mice receiving the booster dose were sacrificed one week later to evaluate mucosal and cell-mediated immune responses. SARS-CoV-2 S-specific and RBD-specific IgG.

[0048] Figure 7F Shows the SARS-CoV-2 S-specific and RBD-specific IgA levels in BAL fluid measured by ELISA.

[0049] Figure 7G Shows the neutralization activity of BAL fluid against SARS-CoV-2 measured by FRNT.

[0050] Figure 7H Shows the IFNγ and granzyme B expression of CD8+ T cells in the lung measured by flow cytometry after restimulation with the S protein peptide pool.

[0051] Figure 7I Shows the phenotypic analysis of CD8+ T cells in the lung also for the expression of CD103 and CD69.

[0052] Figure 7J Shows the frequency of cells secreting SARS-CoV-2 spike-specific IgG+ and IgA+ antibodies (ASC) in the spleen harvested one week after boost measured by ELISPOT. Data for mucosal and cell-mediated responses were pooled from two experiments (E-I: n = 7 - 9 per group; Mann-Whitney test: ***, P < 0.001); J: n = 5 per group; Mann-Whitney test: **, P < 0.01; ***, P < 0.001). (B-J) Bars and columns show the median, and the dashed line indicates the LOD of the assay.

[0053] Figure 8AThe neutralization activity of serum samples from mice vaccinated with ChAd-control or ChAd-SARS-CoV-2-S was tested using the SARS-CoV-2 strain 2019n-CoV / USA_WA1 / 2020 (n = 8-10 per group). Five-week-old female BALB / c mice were immunized with ChAd-control or ChAd-SARS-CoV-2-S via the intranasal inoculation route. The neutralization activity of serum samples collected one month after immunization was determined by FRNT. Mice were boosted on day 30 after the primary immunization and sacrificed one week later to evaluate the immune response.

[0054] Figure 8B Shows the neutralization of SARS-CoV-2 virus expressing recombinant luciferase (wild type (left) and D614G variant (middle)) by serum samples from mice vaccinated with ChAd-SARS-CoV-2-S. (Right) Indicates the paired EC50 values (n = 5; n.s. not significant, paired t-test).

[0055] Figure 8C Shows that BAL fluid was collected from mice vaccinated with ChAd control or ChAd-SARS-CoV-2-S, and the neutralization against the SARS-CoV-2 strain 2019n-CoV / USA_WA1 / 2020 was measured using FRNT (n = 8-10 per group). Each point represents the mean of two technical replicates, and error bars represent SD.

[0056] Figure 9A Shows that tissues and nasal washes were collected at 4 and 8 dpi for analysis. Infectious virus in the lungs was measured by plaque assay. Five-week-old BALB / c female mice were immunized with ChAd-control or ChAd-SARS-CoV-2-S via the intranasal route. On day 35 after immunization, the mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and transduced with Hu-AdV5-hACE2 via the intranasal route one day later. Five days later, the mice were challenged intranasally with 4×10 5 FFU of SARS-CoV-2.

[0057] Figure 9B Shows the viral RNA levels in the lungs, spleens, hearts, turbinates, and nasal washes at 4 and 8 dpi measured by RT-qPCR. Five-week-old BALB / c female mice were immunized with ChAd-control or ChAd-SARS-CoV-2-S via the intranasal route. On day 35 after immunization, the mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and transduced with Hu-AdV5-hACE2 via the intranasal route one day later. Five days later, the mice were challenged intranasally with 4×10 5 FFU of SARS-CoV-2.

[0058] Figure 9C Fold change in gene expression of the indicated cytokines and chemokines determined by RT-qPCR in lung homogenates at 4 dpi (normalized to Gapdh and compared to untreated controls) (2 experiments, n = 6 - 9; median shown: *, P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; Mann-Whitney test). Bars show the median, and the dotted line represents the measured LOD. Five-week-old BALB / c female mice were immunized via the intranasal route with ChAd-control or ChAd-SARS-CoV-2-S. At day 35 post-immunization, the mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and transduced via the intranasal route with Hu-AdV5-hACE2 one day later. Five days later, the mice were challenged intranasally with 4 × 10 5 FFU of SARS-CoV-2.

[0059] Figure 9D Lungs were harvested at 8 dpi. Sections were stained with hematoxylin and eosin and imaged at magnifications of 40× (left; scale bar 250 μm), 200× (middle; scale bar 50 μm), and 400× (right; scale bar 25 μm). Each image represents a group of 3 mice. Five-week-old BALB / c female mice were immunized via the intranasal route with ChAd-control or ChAd-SARS-CoV-2-S. At day 35 post-immunization, the mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and transduced via the intranasal route with Hu-AdV5-hACE2 one day later. Five days later, the mice were challenged intranasally with 4 × 10 5 FFU of SARS-CoV-2.

[0060] Figure 9E Anti-SARS-CoV-2NP IgM (left) and IgG (right) antibody responses measured by ELISA in paired sera obtained 5 days before and 8 days after SARS-CoV-2 challenge in ChAd-control or ChAd-SARS-CoV-2-S mice vaccinated via the intranasal route (n = 6; ns: not significant; **P < 0.01, ****P < 0.0001; paired t-test). Dotted lines represent the mean IgM and IgG titers from untreated sera (n = 6). Five-week-old BALB / c female mice were immunized via the intranasal route with ChAd-control or ChAd-SARS-CoV-2-S. At day 35 post-immunization, the mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and transduced via the intranasal route with Hu-AdV5-hACE2 one day later. Five days later, the mice were challenged intranasally with 4 × 10 5SARS-CoV-2 nasal challenge of mice with FFU.

[0061] Figure 10A Shows the immunization protocol. Five-week-old female BALB / c mice were vaccinated via the IN or IM route with 10 10 ChAd control virus particles or decreasing doses (10 10 、10 9 and 10 8 vp) of ChAd-SARS-CoV-2-S.

[0062] Figure 10B Shows the evaluation of the humoral response in the sera of immunized mice (n = 6 - 14). The anti-S and RBD IgG levels measured by ELISA from IN-immunized mice at 100 days are provided. One-way ANOVA and Dunnett's post hoc test were used to compare the vaccine groups with the control group: ns, not significant; **, P < 0.01; ****, P < 0.0001).

[0063] Figure 10C Shows the evaluation of the humoral response in the sera of immunized mice (n = 6 - 14). The IgA levels measured by ELISA from IN-immunized mice at 100 days are provided. One-way ANOVA and Dunnett's post hoc test were used to compare the vaccine groups with the control group: ns, not significant; **, P < 0.01; ****, P < 0.0001). One-way ANOVA and Dunnett's post hoc test were used to compare the vaccine groups with the control group: ns, not significant; **, P < 0.01; ****, P < 0.0001). One-way ANOVA and Dunnett's post hoc test were used to compare the vaccine groups with the control group: ns, not significant; **, P < 0.01; ****, P < 0.0001).

[0064] Figure 10D Shows the neutralizing activity of sera from IN-immunized mice measured by FRNT at 100 days post-vaccination. One-way ANOVA and Dunnett's post hoc test were used to compare the vaccine groups with the control group: ns, not significant; **, P < 0.01; ****, P < 0.0001).

[0065] Figure 10E Shows the anti-S and RBD IgG levels measured by ELISA from IN-immunized mice at 100 days post-vaccination or from IM-immunized mice at 100 days. One-way ANOVA and Dunnett's post hoc test were used to compare the vaccine groups with the control group: ns, not significant; **, P < 0.01; ****, P < 0.0001).

[0066] Figure 10FShows anti-S and RBD IgA levels measured by ELISA from IN-immunized mice at 100 days post-vaccination or from IM-immunized mice at 100 days. One-way ANOVA and Dunnett's post hoc test were used to compare the vaccine group and the control group: ns, not significant; **, P < 0.01; ****, P < 0.0001).

[0067] Figure 10G Shows neutralization activity of sera from IM-immunized mice at 100 days post-vaccination measured by FRNT. One-way ANOVA and Dunnett's post hoc test were used to compare the vaccine group and the control group: ns, not significant; **, P < 0.01; ****, P < 0.0001).

[0068] Figure 10H Shows the evaluation of the humoral response in sera of immunized mice (n = 6 - 14). Anti-S and RBD IgG levels measured by ELISA from IN-immunized mice at 200 days are provided. One-way ANOVA and Dunnett's post hoc test were used to compare the vaccine group and the control group: ns, not significant; **, P < 0.01; ****, P < 0.0001).

[0069] Figure 10I Shows the evaluation of the humoral response in sera of immunized mice (n = 6 - 14). Anti-S and RBD IgA levels measured by ELISA from IN-immunized mice at 200 days are provided. One-way ANOVA and Dunnett's post hoc test were used to compare the vaccine group and the control group: ns, not significant; **, P < 0.01; ****, P < 0.0001).

[0070] Figure 10J Neutralization activity of sera from IN-immunized mice at 200 days post-vaccination measured by FRNT. One-way ANOVA and Dunnett's post hoc test were used to compare the vaccine group and the control group: ns, not significant; **, P < 0.01; ****, P < 0.0001).

[0071] Figure 10K Shows anti-S and RBD IgG levels measured by ELISA from IN-immunized mice at 200 days post-vaccination or from IM-immunized mice at 100 days. One-way ANOVA and Dunnett's post hoc test were used to compare the vaccine group and the control group: ns, not significant; **, P < 0.01; ****, P < 0.0001).

[0072] Figure 10LShown are the anti-S and RBD IgA levels measured by ELISA from IN-immunized mice at 200 days post-vaccination or from IM-immunized mice at 100 days. One-way ANOVA and Dunnett's post hoc test were used to compare the vaccine groups with the control group: ns, not significant; **, P < 0.01; ****, P < 0.0001).

[0073] Figure 10M Shown is the neutralization activity of sera from IM-immunized mice at 200 days post-vaccination as determined by FRNT. One-way ANOVA and Dunnett's post hoc test were used to compare the vaccine groups with the control group: ns, not significant; **, P < 0.01; ****, P < 0.0001).

[0074] Figure 10N Shown is the frequency of LLPCs producing S-specific IgG or IgA in the bone marrow as measured by ELISPOT assay (n = 4). Mann-Whitney test: *, P < 0.05. B-N, bars show the median and the dashed line represents the limit of detection (LOD) of the assay.

[0075] Figure 11A Shown are serum samples collected from ChAd-SARS-CoV-2-S-vaccinated mice at day 100. Five-week-old female BALB / c mice were immunized with a single 10 10 、10 9 or 10 8 dose of ChAd-SARS-CoV-2-S via the IN or IM route.

[0076] Figure 11B Shown are serum samples collected from ChAd-SARS-CoV-2-S-vaccinated mice at day 200 post-immunization and the neutralization activity was determined by FRNT. Five-week-old female BALB / c mice were immunized with a single 10 10 、10 9 or 10 8 dose of ChAd-SARS-CoV-2-S via the IN or IM route. Shown are the serum neutralization curves corresponding to individual mice for the indicated vaccines (n = 6 - 14 per group). Each point represents the mean of two technical replicates.

[0077] Figure 12A Shown is the analysis of sera from intranasally vaccinated ChAd-SARS-CoV-2-S mice by the Luminex platform to quantify the amounts of anti-SARS-CoV-2 (WA1 / 2020 D614G) spike and RBD IgG1. Bars represent the mean.

[0078] Figure 12BShowing the quantification of anti-SARS-CoV-2 IgG1 against different SARS-CoV-2 protein variants by analyzing sera via Luminex. Polar plots represent the median percentile rank of IgG1 for each SARS-CoV-2 protein and variant.

[0079] Figure 12C Showing a heatmap that displays the IgG titers and FcγR binding titers for each vaccine regimen against the SARS-CoV-2 spike or RBD protein. Each square represents the mean z-score within a disease condition group.

[0080] Figure 12D Showing the incubation of sera with primary murine neutrophils (mADNP) or J774A.1 cells (mADCP) and beads coated with SARS-CoV-2 spike, and measuring phagocytosis after 1 hour. Bars represent the mean and error bars represent the standard deviation.

[0081] Figure 12E Showing the incubation of sera with primary murine neutrophils (mADNP) or J774A.1 cells (mADCP) and beads coated with WA1 / 2020 D614G, B.1.1.7 or B1.351 spike, and measuring phagocytosis after 1 hour. Polar plots represent the median percentile rank of mADNP or mADCP for each SARS-CoV-2 protein and variant. For (A and D): One-way ANOVA and Dunnett's post hoc test were used to compare the vaccine groups with the control group: **, P < 0.01; ***, P < 0.001; ****, P < 0.0001). (A and D): Bars represent the median.

[0082] Figure 13A Showing the persistence of the protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized via the IN route with 10 10 vp of ChAd-control or 10 10 、10 9 and 10 8 vp of ChAd-SARS-CoV-2-S. On day 100, the mice were challenged as follows: animals were treated with an anti-Ifnar1 mAb and transduced via the IN route with Hu-AdV5-hACE2 one day later. Five days later, with 5×10 4Mice were inoculated intranasally with SARS-CoV-2 WA1 / 2020 of FFU. Tissues as shown in the figure were harvested at 4 dpi, and viral RNA levels from challenged mice 100 days after immunization were measured by RT-qPCR (n = 6 - 14, Kruskal Wallis and Dunn's post hoc test: ns, not significant; **, P < 0.01; *, P < 0.1; ***, P < 0.001; ****, P < 0.0001). Bars show the median, and the dashed line indicates the measured LOD.

[0083] Figure 13B Show the persistence of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized intranasally with 10 10 vp of ChAd-control or 10 10 、10 9 and 10 8 vp of ChAd-SARS-CoV-2-S. At 100 days post-immunization, the mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and transduced with Hu-AdV5-hACE2 via the IN route one day later. Five days later, mice were inoculated intranasally with 5 × 10 4 FFU of SARS-CoV-2 WA1 / 2020. Tissues as shown in the figure were harvested at 4 dpi, and viral RNA levels from challenged mice 100 days after immunization were measured by RT-qPCR (n = 6 - 14, Kruskal Wallis and Dunn's post hoc test: ns, not significant; **, P < 0.01; *, P < 0.1; ***, P < 0.001; ****, P < 0.0001). Bars show the median, and the dashed line indicates the measured LOD.

[0084] Figure 13C Show the persistence of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized intranasally with 10 10 vp of ChAd-control or 10 10 、10 9 and 10 8 vp of ChAd-SARS-CoV-2-S. At 100 days post-immunization, the mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and transduced with Hu-AdV5-hACE2 via the IN route one day later. Five days later, mice were inoculated intranasally with 5 × 10 4Mice were inoculated intranasally with SARS-CoV-2 WA1 / 2020 of FFU. Tissues as shown in the figure were harvested at 4 dpi, and viral RNA levels from challenged mice 100 days after immunization were measured by RT-qPCR (n = 6 - 14, Kruskal Wallis and Dunn's post hoc test: ns, not significant; **, P < 0.01; *, P < 0.1; ***, P < 0.001; ****, P < 0.0001). Bars show the median, and the dotted line indicates the measured LOD.

[0085] Figure 13D Show the persistence of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized via the IM route with 10 10 vp of ChAd-control or 10 10 vp of ChAd-control. At day 100, the mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and transduced via the IN route with Hu-AdV5-hACE2 one day later. Five days later, the mice were inoculated intranasally with 5 × 10 4 FFU of SARS-CoV-2 WA1 / 2020. Tissues as shown in the figure were harvested at 4 dpi, and viral RNA levels from challenged mice 100 days after immunization were measured by RT-qPCR (n = 6 - 14, Kruskal Wallis and Dunn's post hoc test: ns, not significant; **, P < 0.01; *, P < 0.1; ***, P < 0.001; ****, P < 0.0001). Bars show the median, and the dotted line indicates the measured LOD.

[0086] Figure 13E Show the persistence of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized via the IM route with 10 10 vp of ChAd-control or 10 10 、10 9 and 10 8 vp of ChAd-SARS-CoV-2-S. At day 100 after immunization, the mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and transduced via the IN route with Hu-AdV5-hACE2 one day later. Five days later, the mice were inoculated with 5 × 10 4Mice were inoculated intranasally with SARS-CoV-2 WA1 / 2020 of FFU. Tissues as shown in the figure were harvested at 4 dpi, and viral RNA levels from challenged mice 100 days after immunization were measured by RT-qPCR (n = 6 - 14, Kruskal Wallis and Dunn's post-test: ns, not significant; **, P < 0.01; *, P < 0.1; ***, P < 0.001; ****, P < 0.0001). Bars show the median, and the dotted line indicates the measured LOD.

[0087] Figure 13F Shows the persistence of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized via the IM route with 10 10 vp of ChAd-control or 10 10 、10 9 and 10 8 vp of ChAd-SARS-CoV-2-S. At 100 days post-immunization, mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and transduced via the IN route with Hu-AdV5-hACE2 one day later. Five days later, mice were inoculated intranasally with 5×10 4 FFU of SARS-CoV-2 WA1 / 2020. Tissues as shown in the figure were harvested at 4 dpi, and viral RNA levels from challenged mice 100 days after immunization were measured by RT-qPCR (n = 6 - 14, Kruskal Wallis and Dunn's post-test: ns, not significant; **, P < 0.01; *, P < 0.1; ***, P < 0.001; ****, P < 0.0001). Bars show the median, and the dotted line indicates the measured LOD.

[0088] Figure 13G Shows the persistence of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized via the IN route with 10 10 vp of ChAd-control or 10 10 、10 9 and 10 8 vp of ChAd-SARS-CoV-2-S. At day 200, mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and transduced via the IN route with Hu-AdV5-hACE2 one day later. Five days later, mice were inoculated with 5×10 4Mice were inoculated intranasally with SARS-CoV-2 WA1 / 2020 of FFU. Tissues as shown in the figure were harvested at 4 dpi, and the viral RNA levels from the challenged mice 200 days after immunization were measured by RT-qPCR (n = 6 - 14, Kruskal Wallis and Dunn's post hoc test: ns, not significant; **, P < 0.01; *, P < 0.1; ***, P < 0.001; ****, P < 0.0001). Bars show the median, and the dashed line indicates the measured LOD.

[0089] Figure 13H Shows the durability of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized intranasally (IN) with 10 10 vp of ChAd-control or 10 10 、10 9 and 10 8 vp of ChAd-SARS-CoV-2-S. On day 200 after immunization, the mice were challenged as follows: the animals were treated with anti-Ifnar1 mAb and transduced with Hu-AdV5-hACE2 via the IN route one day later. Five days later, mice were inoculated intranasally with 5 × 10 4 FFU of SARS-CoV-2 WA1 / 2020. Tissues as shown in the figure were harvested at 4 dpi, and the viral RNA levels from the challenged mice 200 days after immunization were measured by RT-qPCR (n = 6 - 14, Kruskal Wallis and Dunn's post hoc test: ns, not significant; **, P < 0.01; *, P < 0.1; ***, P < 0.001; ****, P < 0.0001). Bars show the median, and the dashed line indicates the measured LOD.

[0090] Figure 13I Shows the durability of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized intranasally (IN) with 10 10 vp of ChAd-control or 10 10 、10 9 and 10 8 vp of ChAd-SARS-CoV-2-S. On day 200 after immunization, the mice were challenged as follows: the animals were treated with anti-Ifnar1 mAb and transduced with Hu-AdV5-hACE2 via the IN route one day later. Five days later, mice were inoculated intranasally with 5 × 10 4Mice were inoculated intranasally with SARS-CoV-2 WA1 / 2020 of FFU. Tissues as shown in the figure were harvested at 4 dpi, and viral RNA levels from challenged mice 200 days after immunization were measured by RT-qPCR (n = 6 - 14, Kruskal Wallis and Dunn's post hoc test: ns, not significant; **, P < 0.01; *, P < 0.1; ***, P < 0.001; ****, P < 0.0001). Bars show the median, and the dashed line indicates the measured LOD.

[0091] Figure 13J Show the persistence of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized intramuscularly with 10 10 vp of ChAd-control or 10 10 vp of ChAd-control. At day 200, the mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and transduced via the intranasal (IN) route with Hu-AdV5-hACE2 one day later. Five days later, the mice were inoculated intranasally with 5 × 10 4 FFU of SARS-CoV-2 WA1 / 2020. Tissues as shown in the figure were harvested at 4 dpi, and viral RNA levels from challenged mice 200 days after immunization were measured by RT-qPCR (n = 6 - 14, Kruskal Wallis and Dunn's post hoc test: ns, not significant; **, P < 0.01; *, P < 0.1; ***, P < 0.001; ****, P < 0.0001). Bars show the median, and the dashed line indicates the measured LOD.

[0092] Figure 13K Show the persistence of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized intramuscularly with 10 10 vp of ChAd-control or 10 10 、10 9 and 10 8 vp of ChAd-SARS-CoV-2-S. At day 200 after immunization, the mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and transduced via the intranasal (IN) route with Hu-AdV5-hACE2 one day later. Five days later, the mice were inoculated intranasally with 5 × 10 4Mice were inoculated intranasally with SARS-CoV-2 WA1 / 2020 of FFU. Tissues as shown in the figure were harvested at 4 dpi, and viral RNA levels from the challenged mice 200 days after immunization were measured by RT-qPCR (n = 6 - 14, Kruskal Wallis and Dunn's post hoc test: ns, not significant; **, P < 0.01; *, P < 0.1; ***, P < 0.001; ****, P < 0.0001). Bars show the median, and the dashed line indicates the measured LOD.

[0093] Figure 13L Show the durability of the protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized intramuscularly with 10 10 vp of ChAd-control or 10 10 、10 9 and 10 8 vp of ChAd-SARS-CoV-2-S. On day 200 after immunization, the mice were challenged as follows: the animals were treated with anti-Ifnar1 mAb and transduced via the intranasal (IN) route with Hu-AdV5-hACE2 one day later. Five days later, mice were inoculated intranasally with 5 × 10 4 FFU of SARS-CoV-2 WA1 / 2020. Tissues as shown in the figure were harvested at 4 dpi, and viral RNA levels from the challenged mice 200 days after immunization were measured by RT-qPCR (n = 6 - 14, Kruskal Wallis and Dunn's post hoc test: ns, not significant; **, P < 0.01; *, P < 0.1; ***, P < 0.001; ****, P < 0.0001). Bars show the median, and the dashed line indicates the measured LOD.

[0094] Figure 14A Show the SARS-CoV-2 S-specific and RBD-specific IgG levels measured by ELISA. Five-week-old K18-hACE2 female mice were immunized intranasally with 10 9 vp of ChAd-control or ChAd-SARS-CoV-2-S. The antibody response in the sera of the mice 6 weeks after immunization was evaluated. Mann-Whitney test: ***, P < 0.001; ****, P < 0.0001.

[0095] Figure 14B Show the SARS-CoV-2 S-specific and RBD-specific IgA levels measured by ELISA. Five-week-old K18-hACE2 female mice were immunized intranasally with 10 9Five-week-old K18-hACE2 female mice were immunized via the intranasal (IN) route with ChAd-control or ChAd-SARS-CoV-2-S at 10 vp. The antibody responses in the sera of the mice were evaluated 6 weeks after immunization. Mann-Whitney test: ***, P < 0.001; ****, P < 0.0001.

[0096] Figure 14C Shows the neutralization activity determined by FRNT in the sera of the mice at 6 weeks. With 10 9 Five-week-old K18-hACE2 female mice were immunized via the IN route with ChAd-control or ChAd-SARS-CoV-2-S at 10 vp. A paired analysis of the serum neutralization activity of the immunized mice against WA1 / 2020 and Wash-B.1.351 collected at 6 weeks was provided. Two-tailed Wilcoxon paired signed-rank test: *, P < 0.05; ****, P < 0.0001.

[0097] Figure 14D Shows the neutralization activity determined by FRNT in the sera of the mice at 6 weeks. With 10 9 Five-week-old K18-hACE2 female mice were immunized via the IN route with ChAd-control or ChAd-SARS-CoV-2-S at 10 vp. A paired analysis of the serum neutralization activity of the immunized mice against WA1 / 2020 and Wash-B.1.1.28 collected at 6 weeks was provided. Two-tailed Wilcoxon paired signed-rank test: *, P < 0.05; ****, P < 0.0001.

[0098] Figure 14E Shows the SARS-CoV-2 S-specific and RBD-specific IgG levels measured by ELISA. With 10 9 Five-week-old K18-hACE2 female mice were immunized via the IN route with ChAd-control or ChAd-SARS-CoV-2-S at 10 vp. The antibody responses in the sera of the mice were evaluated 9 weeks after immunization. Mann-Whitney test: ***, P < 0.001; ****, P < 0.0001.

[0099] Figure 14F Shows the SARS-CoV-2 S-specific and RBD-specific IgA levels measured by ELISA. With 10 9 Five-week-old K18-hACE2 female mice were immunized via the IN route with ChAd-control or ChAd-SARS-CoV-2-S at 10 vp. The antibody responses in the sera of the mice were evaluated 9 weeks after immunization. Mann-Whitney test: ***, P < 0.001; ****, P < 0.0001.

[0100] Figure 14G Neutralization activity determined by FRNT in mouse sera at 6 weeks. Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 9 vp of ChAd-control or ChAd-SARS-CoV-2-S. Paired analysis of serum neutralization activity of immunized mice against WA1 / 2020 and Wash-B.1.351 collected at 9 weeks is provided. Two-tailed Wilcoxon paired signed-rank test: *, P < 0.05; ****, P < 0.0001.

[0101] Figure 14H Neutralization activity determined by FRNT in mouse sera at 6 weeks. Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 9 vp of ChAd-control or ChAd-SARS-CoV-2-S. Paired analysis of serum neutralization activity of immunized mice against WA1 / 2020 and Wash-B.1.1.28 collected at 9 weeks is provided. Two-tailed Wilcoxon paired signed-rank test: *, P < 0.05; ****, P < 0.0001.

[0102] Figure 15A The experimental protocol is shown. Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 10 vp of ChAd-control or ChAd-SARS-CoV-2-S.

[0103] Figure 15B Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 10 vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, mice were challenged with 10 4 FFU of SARS-CoV-2 of Wash-B.1.351. The graph of body weight over time is shown. Data are mean ± SEM for comparison of vaccine group with control group (n = 6 - 9 per group; unpaired t-test for area under the curve, ****P < 0.0001).

[0104] Figure 15C Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 10 vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, mice were challenged with 10 4Mice were challenged with SARS-CoV-2 Wash-B.1.351 of the FFU. Viral RNA levels in the lungs at 6 dpi were measured by RT-qPCR (n = 6 - 9; Mann-Whitney test: **P < 0.01, ***P < 0.001). Bars represent the median, and the dashed line represents the measured LOD.

[0105] Figure 15D Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 10 vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, the mice were challenged with 10 4 FFU of SARS-CoV-2 Wash-B.1.351. Viral RNA levels in the heart at 6 dpi were measured by RT-qPCR (n = 6 - 9; Mann-Whitney test: **P < 0.01, ***P < 0.001). Bars represent the median, and the dashed line represents the measured LOD.

[0106] Figure 15E Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 10 vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, the mice were challenged with 10 4 FFU of SARS-CoV-2 Wash-B.1.351. Viral RNA levels in the nasal washes at 6 dpi were measured by RT-qPCR (n = 6 - 9; Mann-Whitney test: **P < 0.01, ***P < 0.001). Bars represent the median, and the dashed line represents the measured LOD.

[0107] Figure 15F Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 10 vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, the mice were challenged with 10 4 FFU of SARS-CoV-2 Wash-B.1.351. Six weeks after immunization, the mice were challenged with 10 4 Mice were challenged with SARS-CoV-2 Wash-B.1.351 of the FFU. Viral RNA levels in the brain at 6 dpi were measured by RT-qPCR (n = 6 - 9; Mann-Whitney test: **P < 0.01, ***P < 0.001). Bars represent the median, and the dashed line represents the measured LOD.

[0108] Figure 15G Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 10Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 4 vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, the mice were challenged with 10

[0109] Figure 15H FFU of SARS-CoV-2 of Wash-B.1.1.28. The graph showing the change in body weight over time is presented. Data are mean ± SEM for comparison of vaccine groups with control groups (n = 6 - 9 per group; unpaired t-test for area under the curve, ****P < 0.0001). 10 Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 4 vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, the mice were challenged with 10

[0110] Figure 15I FFU of SARS-CoV-2 of Wash-B.1.1.28. The viral RNA levels in the lungs at 6 dpi were measured by RT-qPCR (n = 6 - 9; Mann-Whitney test: **P < 0.01, ***P < 0.001). Bars show the median, and the dotted line represents the measured LOD. 10 Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 4 vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, the mice were challenged with 10

[0111] Figure 15J FFU of SARS-CoV-2 of Wash-B.1.1.28. The viral RNA levels in the heart at 6 dpi were measured by RT-qPCR (n = 6 - 9; Mann-Whitney test: **P < 0.01, ***P < 0.001). Bars show the median, and the dotted line represents the measured LOD. 10 Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 4 vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, the mice were challenged with 10

[0112] Figure 15K FFU of SARS-CoV-2 of Wash-B.1.1.28. The viral RNA levels in the nasal washes at 6 dpi were measured by RT-qPCR (n = 6 - 9; Mann-Whitney test: **P < 0.01, ***P < 0.001). Bars show the median, and the dotted line represents the measured LOD. 10Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 4 vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, the mice were challenged with 10 4 FFU of SARS-CoV-2 of Wash-B.1.1.28. Six weeks after immunization, the mice were challenged with 10

[0113] Figure 15L FFU of SARS-CoV-2 of Wash-B.1.351. The viral RNA levels in the brain at 6 dpi were measured by RT-qPCR (n = 6 - 9; Mann-Whitney test: **P < 0.01, ***P < 0.001). Bars show the median, and the dotted line indicates the measured LOD. 10 Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 4 vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, the mice were challenged with 10

[0114] Figure 15M FFU of SARS-CoV-2 of WA1 / 2020. A graph showing the change in body weight over time is presented. Data are mean ± SEM comparing the vaccine group with the control group (n = 6 - 9 per group; unpaired t-test for area under the curve, ****P < 0.0001). 10 Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 4 vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, the mice were challenged with 10

[0115] Figure 15N FFU of SARS-CoV-2 of WA1 / 2020. The viral RNA levels in the lung at 6 dpi were measured by RT-qPCR (n = 6 - 9; Mann-Whitney test: **P < 0.01, ***P < 0.001). Bars show the median, and the dotted line indicates the measured LOD. 10 Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 4 vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, the mice were challenged with 10

[0116] Figure 15O with 10 10 Five-week-old K18-hACE2 female mice were immunized via the IN route with ChAd-control or ChAd-SARS-CoV-2-S at 10 4 FFU of SARS-CoV-2 WA1 / 2020. Six weeks after immunization, the mice were challenged with 10

[0117] Figure 15P with 10 10 FFU of SARS-CoV-2 Wash-B.1.351. A graph showing body weight over time is presented. Data are mean ± SEM comparing vaccine groups to control groups (n = 6 - 9 per group; unpaired t-test for area under the curve, ****P < 0.0001). 4 Five-week-old K18-hACE2 female mice were immunized via the IN route with ChAd-control or ChAd-SARS-CoV-2-S at 10

[0118] Figure 15Q with 10 10 FFU of SARS-CoV-2 Wash-B.1.351. Six weeks after immunization, the mice were challenged with 10 4 FFU of SARS-CoV-2 Wash-B.1.351. Viral RNA levels in the lungs at 6 dpi were measured by RT-qPCR (n = 6 - 9; Mann-Whitney test: **P < 0.01, ***P < 0.001). Bars represent the median, and the dashed line represents the measured LOD.

[0119] Figure 15R with 10 10 FFU of SARS-CoV-2 Wash-B.1.351. Nine months after immunization, the mice were challenged with 10 4 FFU of SARS-CoV-2 Wash-B.1.351. Viral RNA levels in the heart at 6 dpi were measured by RT-qPCR (n = 6 - 9; Mann-Whitney test: **P < 0.01, ***P < 0.001). Bars represent the median, and the dashed line represents the measured LOD.

[0120] Figure 15S with 1010 Five-week-old K18-hACE2 female mice were immunized via the intranasal (IN) route with 10 4 vp of ChAd-control or ChAd-SARS-CoV-2-S. Nine months after immunization, the mice were challenged with 10

[0121] Figure 15T FFU of SARS-CoV-2 of Wash-B.1.351. Viral RNA levels in nasal washes at 6 dpi were measured by RT-qPCR (n = 6 - 9; Mann-Whitney test: **P < 0.01, ***P < 0.001). Bars show the median, and the dashed line indicates the measured limit of detection (LOD). 10 Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 4 vp of ChAd-control or ChAd-SARS-CoV-2-S. Nine months after immunization, the mice were challenged with 10 4 FFU of SARS-CoV-2 of Wash-B.1.351. Viral RNA levels in the brain at 6 dpi were measured by RT-qPCR (n = 6 - 9; Mann-Whitney test: **P < 0.01, ***P < 0.001). Bars show the median, and the dashed line indicates the measured LOD.

[0122] Figure 16A The ChAd-SARS-CoV-2-S vaccine induced neutralizing activity against WA1 / 2020, Wash-B.1.351, or Wash-B.1.1.28, as measured by FRNT. Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 9 vp of ChAd-control or ChAd-SARS-CoV-2-S, and serum samples were collected at six weeks. Serum neutralization curves corresponding to individual mice for the indicated vaccines are shown (n = 7 - 20 per group). Each point represents the mean of two technical replicates.

[0123] Figure 16B The ChAd-SARS-CoV-2-S vaccine induced neutralizing activity against WA1 / 2020, Wash-B.1.351, or Wash-B.1.1.28, as measured by FRNT. Five-week-old K18-hACE2 female mice were immunized via the IN route with 10 9Five-week-old K18-hACE2 female mice were immunized via the IN route with ChAd-control or ChAd-SARS-CoV-2-S, and serum samples were collected at 9 months. Serum neutralization curves corresponding to individual mice for the indicated vaccines are shown (n = 7 - 20 per group). Each point represents the mean of two technical replicates.

[0124] Figure 17 A sequence alignment of a stable variant of the SARS-Cov2-Omicron S protein with the SARS-CoV2-Wuhan S protein is shown.

[0125] Figure 18 An evaluation of SARS-CoV-2 spike gene expression mediated by ChAd vector derivatives including Omicron BA.5 is shown.

[0126] Figure 19A The protocol and timeline for vaccination, blood sampling, virus challenge, and necropsy are shown.

[0127] Figure 19B Binding of anti-SARS-CoV-2 IgG to the SARS-CoV-2 Wuhan-1 S protein is shown. Kruskal Wallis and Dunn post hoc tests: ns, not significant; *, P < 0.05, **, P < 0.01; ***, P < 0.001; ****, P < 0.0001).

[0128] Figure 19C Binding of anti-SARS-CoV-2 IgA to the SARS-CoV-2 Wuhan-1 S protein is shown. Kruskal Wallis and Dunn post hoc tests: ns, not significant; *, P < 0.05, **, P < 0.01; ***, P < 0.001; ****, P < 0.0001).

[0129] Figure 19D Binding of anti-SARS-CoV-2 IgG to the BA.5 S protein is shown. Kruskal Wallis and Dunn post hoc tests: ns, not significant; *, P < 0.05, **, P < 0.01; ***, P < 0.001; ****, P < 0.0001).

[0130] Figure 19E Binding of anti-SARS-CoV-2 IgA to the BA.5 S protein is shown. Kruskal Wallis and Dunn post hoc tests: ns, not significant; *, P < 0.05, **, P < 0.01; ***, P < 0.001; ****, P < 0.0001).

[0131] Figure 19F Shows the binding of anti-SARS-CoV-2 IgG to the SARS-CoV-2 BQ.1.1 S protein. Kruskal Wallis and Dunn's post hoc tests: ns, not significant; *, P < 0.05, **, P < 0.01; ***, P < 0.001; ****, P < 0.0001).

[0132] Figure 19G Shows the binding of anti-SARS-CoV-2 IgA to the SARS-CoV-2 BQ.1.1 S protein. Kruskal Wallis and Dunn's post hoc tests: ns, not significant; *, P < 0.05, **, P < 0.01; ***, P < 0.001; ****, P < 0.0001).

[0133] Figure 20A Shows the neutralizing activity of FRNT against WA1 / 2020. Using 10 9 vp of ChAd-control or ChAd-SARS-CoV-2-S vaccine was used to immunize 7-week-old K18-hACE2 female mice via the IN route, and sera were obtained 28 days later. Each point represents data from a single mouse and is the average of two technical replicates.

[0134] Figure 20B Shows the neutralizing activity of FRNT against BA.5. Using 10 9 vp of ChAd-control or ChAd-SARS-CoV-2-S vaccine was used to immunize 7-week-old K18-hACE2 female mice via the IN route, and sera were obtained 28 days later. Each point represents data from a single mouse and is the average of two technical replicates.

[0135] Figure 20C Shows the neutralizing activity of FRNT against BF.7. Using 10 9 vp of ChAd-control or ChAd-SARS-CoV-2-S vaccine was used to immunize 7-week-old K18-hACE2 female mice via the IN route, and sera were obtained 28 days later. Each point represents data from a single mouse and is the average of two technical replicates.

[0136] Figure 20D Shows the neutralizing activity of FRNT against BQ.1.1. Using 10 9 vp of ChAd-control or ChAd-SARS-CoV-2-S vaccine was used to immunize 7-week-old K18-hACE2 female mice via the IN route, and sera were obtained 28 days later. Each point represents data from a single mouse and is the average of two technical replicates.

[0137] Figure 20E showed the neutralizing activity of FRNT against XBB.1.1. Seven-week-old K18-hACE2 female mice were immunized via the IN route with 10 9 vp of ChAd-control or ChAd-SARS-CoV-2-S vaccine, and sera were obtained 28 days later. Each point represents data from a single mouse and is the average of two technical replicates.

[0138] Figure 20F Neutralization data are shown, plotted as a direct comparison of the given vaccine (ChAd-SARS-CoV-2S (Wuhan-1)) against the indicated SARS-CoV-2 strains used for infection.

[0139] Figure 20G Neutralization data are shown, plotted as a direct comparison of the given vaccine ChAd-SARS-CoV-2-S (BA.5) against the indicated SARS-CoV-2 strains used for infection.

[0140] Figure 20H Neutralization data are shown, plotted as a direct comparison of the given vaccine ChAd-SARS-CoV-2-S (bivalent) against the indicated SARS-CoV-2 strains used for infection.

[0141] Figure 21A Viral RNA levels in the lungs at 6 dpi after challenge with SARS-CoV-2 WA1 / 2020 D614G (left) or Omicron BQ.1.1 (right) are shown. Animals were unvaccinated (control) or immunized via the intranasal route with a single dose (total of 10 9 viral particles) of ChAd-control, ChAd-SARS-CoV-2S (Wuhan-1), ChAd-SARS-CoV-2-S (BA.5), or bivalent (ChAd-SARS-CoV-2S (Wuhan-1) + ChAd-SARS-CoV-2-S (BA.5)). Kruskal Wallis and Dunn's post hoc test: ns, not significant; *, P < 0.05, **, P < 0.01; ***, P < 0.001; ****, P < 0.0001).

[0142] Figure 21B Viral RNA levels in the turbinates ( Figure 21B ) and nasal washes at 6 dpi after challenge with SARS-CoV-2 WA1 / 2020 D614G (left) or Omicron BQ.1.1 (right) are shown. Animals were unvaccinated (control) or immunized via the intranasal route with a single dose (total of 10 9ChAd-control, ChAd-SARS-CoV-2S (Wuhan-1), ChAd-SARS-CoV-2-S (BA.5), or bivalent (ChAd-SARS-CoV-2S (Wuhan-1) + ChAd-SARS-CoV-2-S (BA.5)) immunization (total 10

[0143] Figure 21C Showing viral RNA levels in nasal washings at 6 dpi after challenge with SARS-CoV-2 WA1 / 2020 D614G (left) or Omicron BQ.1.1 (right). Animals were unvaccinated (control) or immunized via the intranasal route with a single dose (total 10 9 ChAd-control, ChAd-SARS-CoV-2S (Wuhan-1), ChAd-SARS-CoV-2-S (BA.5), or bivalent (ChAd-SARS-CoV-2S (Wuhan-1) + ChAd-SARS-CoV-2-S (BA.5)) immunization (total 10

[0144] Figure 22 Showing a heatmap of cytokine induction in vaccinated mice at 6 dpi after challenge with SARS-CoV-2 WA1 / 2020 D614G (left) or Omicron BQ.1.1 (right). The vaccination status of the mice (unvaccinated, ChAd-control, ChAd-SARS-CoV-2S, ChAd-SARS-CoV-2-S, or bivalent (ChAd-SARS-CoV-2S (Wuhan-1) + ChAd-SARS-CoV-2-S (BA.5))) is shown at the bottom. The colors of the figure reflect the log2 fold change compared to untreated mice.

[0145] Figure 23 Showing a sequence alignment of the stabilized variant of the BA.5 S protein relative to the "original" strain. Detailed implementation

[0146] The present disclosure is at least in part based on the development of recombinant non-human adenovirus vector compositions and immunogenic compositions therefor for the treatment or prevention of coronavirus infections. In addition, the present disclosure provides methods of administering the compositions disclosed herein to provide durable cell- and humoral-mediated immunity against coronavirus infections.

[0147] The severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1) that caused the 2002–2004 SARS epidemic, the Middle East respiratory syndrome coronavirus (MERS-CoV) first reported in 2012, and the SARS-CoV-2 that caused the recent coronavirus disease 2019 (Covid-19) pandemic all bind to angiotensin-converting enzyme 2 (ACE2) on the cell surface to infect cells. Generally, ACE-2 is the functional receptor for SARS-CoV-1, SARS-CoV-2, and MERS-COV, and most likely future SARS-COV variants. ACE-2 is an important component of the renin–angiotensin–aldosterone system (RAAS). ACE-2 converts angiotensin 2 to angiotensin 1–7. High levels of angiotensin 2 are associated with vasoconstriction, inflammation, and acute lung injury. ACE2 is expressed in various organs, including the lung, heart, kidney, liver, intestine, and other tissues. The SARS-CoV virus binds to ACE-2 and enters cells.

[0148] The SARS-CoV-2 RNA genome is approximately 30,000 nucleotides in length. Two-thirds of the 5' end encodes nonstructural proteins that enable genome replication and viral RNA synthesis. The remaining one-third encodes structural proteins, such as the spike (S), envelope, membrane, and nucleocapsid protein (NP) that form the spherical virion, as well as accessory proteins that modulate cellular responses. The S protein forms homotrimeric spikes on the virion and engages the cell surface receptor angiotensin-converting enzyme 2 (ACE2) to facilitate coronavirus entry into human cells. The SARS-CoV and SARS-CoV-2 S proteins are sequentially cleaved during entry, generating S1 and S2 fragments, and then S2 is further processed to generate a smaller S2' protein (Hoffmann et al., 2020). The S1 protein includes the receptor-binding domain (RBD), and the S2 protein facilitates membrane fusion. The structure of the soluble, stable prefusion form of the SARS-CoV-2 S protein has been resolved by cryo-electron microscopy, revealing substantial similarity to the SARS-CoV S protein. This form of the S protein is recognized by potent neutralizing monoclonal antibodies and can serve as a promising vaccine target.

[0149] The release of the SARS-CoV-2 genomic sequence prompted academic, government, and industry groups to immediately begin developing vaccine candidates that primarily target the viral S protein. Improved genomic sequencing capabilities also provided a wealth of information about the SARS-CoV-2 variants circulating at any given point in time. SARS-CoV-2 mutates over time, resulting in the emergence of new variants that differ in sequence, transmissibility, and severity of infection. A variety of SARS-CoV-2 variants have emerged. The original form of SARS-CoV-2 is commonly referred to as the "wild-type" strain. Subsequently, variants including alpha (B.1.1.7), beta (B.1.351), gamma (P.1), and delta (B.1.617.2 and AY sublineages) emerged between December 2020 and April 2021. However, the current dominant variant is the Omicron variant (B.1.1.529 and BA sublineages), which emerged around November 2021. As used herein, the term "variant" in the context of a virus is a viral genome (genetic code) that can contain one or more mutations. In some cases, a group of variants with similar genetic changes can emerge, such as a lineage or group of lineages. As used herein, a "lineage" is a group of closely related viruses with a common ancestor. The terms "sublineage" or "subvariant" as used herein are a group of similar viruses within a lineage. Sublineages or subvariants of Omicron, as well as other variants, continue to emerge.

[0150] Multiple platforms have been developed to deliver the SARS-CoV-2 S protein, including DNA plasmids, lipid nanoparticle-encapsulated mRNA, inactivated virions, and viral vector vaccines. Several vaccines have entered clinical trials to assess safety, and some have advanced to trials evaluating immunogenicity and efficacy. Due to the urgency of the pandemic, most vaccines advanced to human trials without substantial in vivo efficacy data. This occurred in part because the design and development of vaccines outpaced the generation of preclinical disease models of SARS-CoV-2 infection and pathogenesis.

[0151] Previous adenovirus (Ad)-based vaccines against β-coronaviruses have been evaluated. A single dose of a chimpanzee Ad vector vaccine encoding the full-length S protein of MERS-CoV protected human dipeptidyl peptidase 4 (hDPP4) transgenic mice from infection, reduced viral shedding and improved survival in camels, and was safe and immunogenic in humans in a phase 1 clinical trial. A human Ad-based vaccine expressing the MERS S1-CD40L fusion protein was also protective in transgenic hDPP4 mice. An Ad-based SARS-CoV vaccine expressing the full-length S protein prevented pneumonia in ferrets after challenge and was highly immunogenic in rhesus macaques. A chimpanzee Ad vector (Y25, which is simian Ad-23) encoding the wild-type SARS-CoV-2 S protein (ChAdOx1 nCoV-19) is currently being evaluated in humans as a single intramuscular injection (NCT04324606). Preliminary preprint analysis indicates that this vaccine protects against lung infection and pneumonia but not against upper respiratory tract infection and nasal viral shedding (doi.org / 10.1101 / 2020.05.13.093195). However, this vaccine failed as a nasal vaccine.

[0152] The present disclosure provides compositions, methods, and treatment regimens for treating individuals at risk of contracting a respiratory viral infection, having mild respiratory viral infection symptoms, or having severe respiratory viral infection symptoms. The compositions of the present disclosure can be used to treat, prevent, or reduce the infectivity of a respiratory viral infection. The treatment regimen can include administering the compositions of the present disclosure to an individual at risk of contracting a respiratory viral infection or having a viral infection, thereby preventing or treating the viral infection. In some embodiments, viral transmission can be prevented or reduced by reducing viral infection in the upper respiratory tract. The compositions and methods of the present disclosure provide robust antigen-specific antibodies, neutralizing antibodies, and B cell and T cell responses. This confers protection against infection, significantly reducing viral production, inflammation, and pathology in the lung. The compositions and methods of the present disclosure generate robust mucosal immunity, including high levels of neutralizing and anti-RBD IgA and IgG in serum and lung and SARS-CoV-2-specific resident memory T cells in the lung. The disclosed compositions and methods provide complete protection against SARS-CoV-2 infection in the nasal passages, upper airway, lung tissue, and all other sites of possible transmission. Based on measurements of the anti-NP and anti-ORF8 responses, a single intranasal dose of the compositions of the present disclosure confers sterilizing immunity, which has not been described in any COVID-19 vaccine, let alone single-dose administration.

[0153] The compositions of the present disclosure can be formulated for topical administration, such as intranasally (e.g., as a nasal spray or inhalant), or systemically (e.g., intravenously or intraperitoneally), and administered to treat or prevent respiratory viral infections (e.g., coronavirus infections, such as SARS-CoV-2). The compositions of the present disclosure (e.g., compositions formulated for nasal delivery or inhalation) can be administered to subjects who may be at risk of contracting a viral infection (e.g., SARS-CoV-2). For example, the compositions of the present disclosure can be administered to individuals in high-risk environments (e.g., healthcare workers), individuals who have been exposed to or suspected of being exposed to a virus (e.g., SARS-CoV-2), or individuals who test positive for a viral infection. The compositions of the present disclosure can be administered to individuals who exhibit symptoms of a respiratory infection (e.g., SARS-CoV-2 infection) or are asymptomatic at the time of administration. In some embodiments, the compositions of the present disclosure can be self-administered by an individual (e.g., as a nasal spray or inhalant) and can be administered outside of a healthcare facility (e.g., at home).

[0154] The methods and compositions disclosed herein can be used to treat, prevent, or reduce the infectivity of a respiratory viral infection. In some embodiments, the viral infection can be a coronavirus infection. Pathogens with a long incubation period, such as SARS-CoV-2 with a median incubation period of about five days, can have a high risk of transmission because many infected individuals may not know that they have been infected. In addition, coronavirus carriers may often be asymptomatic or have mild symptoms, resulting in undetected contact between the viral host and other members of the population. Subjects at risk of a coronavirus infection may be exposed to asymptomatic carriers of the coronavirus infection and thus inadvertently contract the coronavirus. There is a need for methods and compositions for preventing coronavirus infection in individuals at risk (e.g., individuals who have been in contact with or may come into contact with a coronavirus carrier). In some embodiments, the compositions, methods, or treatment regimens disclosed herein can treat or prevent SARS-CoV-2 infection (e.g., COVID-19).

[0155] The components for preparing the disclosed compositions and the compositions themselves used in the methods disclosed herein are discussed below. These materials and other materials are disclosed herein, and it should be understood that while specific mention of each different individual and collective combination and permutation of these compounds may not be explicitly disclosed when combinations, subsets, interactions, groups, etc. of these materials are disclosed, each and every one of them is specifically contemplated and described herein. For example, if a particular compound is disclosed and discussed, and various modifications that can be made to multiple molecules of that compound are discussed, then each combination and permutation of that compound and the possible modifications are specifically contemplated, unless the contrary is explicitly stated. Thus, if a class of molecules A, B, and C is disclosed, and a class of molecules D, E, and F is disclosed, and an example of the combined molecule A-D is disclosed, then each of these is considered individually and collectively, even if each is not listed separately, which means that the combinations A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered disclosed. Similarly, any subset or combination of these is also disclosed. Thus, for example, a subgroup of A-E, B-F, and C-E would be considered disclosed. This concept applies to all aspects of this application, including but not limited to the steps in the methods of making and using the disclosed compositions. Thus, if various additional steps can be performed, it should be understood that each of these additional steps can be performed in conjunction with any particular embodiment or combination of embodiments of the disclosed methods.

[0156] Various aspects of the present invention will be described in further detail in the following sections.

[0157] I. Definitions

[0158] For easier understanding of the present invention, certain terms are first defined. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the embodiments of the present invention pertain. Many methods and materials similar to, modified from, or equivalent to those described herein can be used to practice the embodiments of the present invention without undue experimentation, and the preferred materials and methods are described herein. When describing and claiming the embodiments of the present invention, the following terms will be used in accordance with the definitions set forth below.

[0159] The language and terms used herein are for descriptive purposes only and should not be regarded as limiting. For example, the use of singular terms (such as "a") is not intended to limit the number of items. Additionally, the use of relational terms (such as but not limited to "top", "bottom", "left", "right", "upper", "lower", "downward", "upward", and "side") in the specification is for clarity when specifically referring to the drawings and is not intended to limit the scope of the inventive concept or the appended claims.

[0160] Any degree term, such as but not limited to "substantially" as used in the specification and the appended claims, shall be understood to include an exact configuration or a similar but inexact configuration. For example, "substantially flat surface" means a surface having an exact flat surface or a similar but inexact flat surface. Similarly, terms such as "about" or "approximately" as used in the specification and the appended claims shall be understood to include the listed value or a value that is three times or one-third of the listed value. For example, about 3 mm includes all values from 1 mm to 9 mm, and approximately 50 degrees includes all values from 16.6 degrees to 150 degrees. For example, they may refer to less than or equal to ±5%, such as less than or equal to ±2%, such as less than or equal to ±1%, such as less than or equal to ±0.5%, such as less than or equal to ±0.2%, such as less than or equal to ±0.1%, such as less than or equal to ±0.05%.

[0161] The terms "comprising", "including" and "having" are used interchangeably in this disclosure. The terms "comprising", "including" and "having" mean including but not necessarily limited to the thing(s) described.

[0162] As used herein, the terms "or" and "and / or" shall be interpreted inclusively or to mean any one or any combination. Thus, "A, B or C" or "A, B and / or C" means any of the following: "A", "B" or "C"; "A and B"; "A and C"; "B and C"; "A, B and C". An exception to this definition occurs only when the combination of elements, functions, steps or acts is in some way mutually exclusive by nature.

[0163] Unless otherwise defined, all technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art to which this invention belongs. The following references provide a general definition of many of the terms used in this invention to those skilled in the art: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991), all of which are incorporated herein by reference. As used herein, the following terms have the meanings given to them below, unless otherwise indicated.

[0164] The terminology and phraseology used herein are for descriptive purposes and should not be construed as limiting. When introducing elements of the present disclosure or its preferred aspects, the articles "a", "an", "the", and "said" are intended to mean that there is one or more than one element. The terms "comprising", "including", and "having" are intended to be inclusive and mean that there may be additional elements in addition to the listed elements. Whenever the terms "comprising" or "including" are used, it should be understood that the present disclosure also explicitly contemplates and encompasses an additional aspect "consisting of the disclosed elements", in which there are no additional elements other than the listed elements.

[0165] As used herein, the term "about" or "approximately" may refer to an acceptable error range of a particular value determined by a person of ordinary skill in the art, which will depend in part on how the value is measured or determined, such as the limitations of the measuring system. For example, "about" may refer to within 1 or more standard deviations in accordance with the practice for a given value. When describing a particular value in this application and the claims, unless otherwise stated, the term "about" may refer to an acceptable error range of the particular value, such as 10% of the value modified by the term "about". As used herein, the term "about" may refer to ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, or ±1% relative to the stated value (e.g., amount, dose, temperature, time, percentage, etc.).

[0166] In addition, since the inventive concept is susceptible to many different forms of "aspects" or "embodiments" that can be used interchangeably, it is intended that the present disclosure be regarded as an example of the principles of the inventive concept and not intended to limit the inventive concept to the specific aspects shown and described. Any one of the features of the inventive concept can be used alone or in combination with any other feature. The mention of the term "aspect" and / or a similar term in the specification means that one and / or more of the recited features are included in at least one aspect of the specification. The separate mention of the terms "aspect" and / or a similar term in the specification does not necessarily refer to the same aspect and is not mutually exclusive, unless so stated and / or unless it is readily apparent to a person of ordinary skill in the art from the specification. For example, a feature, structure, process, step, action, etc. described in one aspect may also be included in other aspects, but not necessarily. Thus, the inventive concept can include various combinations and / or integrations of the aspects described herein. In addition, all aspects of the present disclosure as described herein are not essential for its practice. Similarly, other systems, methods, features, and advantages of the inventive concept will be or become apparent to a person of ordinary skill in the art upon viewing the drawings and the specification. It is intended that all such additional systems, methods, features, and advantages be included in this specification, be within the scope of the inventive concept, and be covered by the claims.

[0167] The term "nucleic acid" or "polynucleotide" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) in single-stranded or double-stranded form, and polymers thereof. Unless specifically restricted, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to the naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses its conservatively modified variants (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences, as well as the explicitly recited sequence. Specifically, degenerate codon substitutions can be achieved by generating sequences in which one or more selected (or all) codons' third positions are substituted with a mixture of bases and / or deoxyinosine residues. See, e.g., Batzer et al., Nucleic Acid Res. 19:5081 (1991), the entire disclosure of which is incorporated herein by reference. In some aspects, a nucleic acid sequence can encode a polypeptide sequence.

[0168] As used herein, the term "encoding" broadly refers to any process that uses the information in a polymeric macromolecule to direct the production of a second molecule that is different from the first molecule. The second molecule can have a chemical structure that is chemically different from that of the first molecule. For example, in some aspects, the term "encoding" describes the process of semi-conservative DNA replication, in which one strand of a double-stranded DNA molecule is used as a template to encode a newly synthesized complementary sister strand by DNA-dependent DNA polymerase. In other aspects, a DNA molecule can encode an RNA molecule (e.g., by the process of transcription using DNA-dependent RNA polymerase). Additionally, an RNA molecule can encode a polypeptide, as in the process of translation. When used to describe the process of translation, the term "encoding" also extends to the triplet codons that encode amino acids. In some aspects, an RNA molecule can encode a DNA molecule, e.g., by the process of reverse transcription that binds to RNA-dependent DNA polymerase. In another aspect, a DNA molecule can encode a polypeptide, where it should be understood that in this case, the "encoding" used includes the processes of transcription and translation.

[0169] A nucleic acid is "operably linked" when placed into a structural or functional relationship with another nucleic acid sequence. For example, a DNA segment is operably linked to another DNA segment if the two are positioned relative to each other on the same continuous DNA molecule and have a structural or functional relationship, such as a promoter or enhancer positioned relative to a coding sequence to facilitate transcription of the coding sequence; a ribosome binding site positioned relative to a coding sequence to facilitate translation; or a presequence or secretion leader sequence positioned relative to a coding sequence to facilitate expression of a preprotein (e.g., a preprotein involved in the secretion of a polypeptide). In other instances, operably linked nucleic acid sequences are not continuous but are positioned in such a way that they have a functional relationship to each other as nucleic acids or as proteins expressed by them. For example, an enhancer need not be continuous. Ligation can be accomplished by ligation at convenient restriction sites or by using synthetic oligonucleotide linkers or adaptors.

[0170] In some aspects, a nucleic acid encoding a polypeptide can be operably linked to an expression control sequence.

[0171] An expression control sequence refers to a nucleic acid sequence that regulates the expression of a heterologous nucleic acid sequence operably linked to it. An expression control sequence is operably linked to a nucleic acid sequence when it controls and regulates the transcription of the nucleic acid sequence and, where appropriate, translation. Thus, an expression control sequence can include an appropriate promoter, enhancer, transcription terminator, start codon (ATG) preceding a protein-coding gene, splicing signals for introns, maintenance of the correct reading frame of the gene to allow proper translation of the mRNA, and a stop codon. The term "control sequence" is intended to include at least components whose presence can affect expression and can also include additional components whose presence is advantageous, such as a leader sequence and a fusion partner sequence. An expression control sequence can include a promoter.

[0172] A promoter is the minimal sequence sufficient to direct transcription. Also included are those promoter elements sufficient to render promoter-dependent gene expression controllable as cell type-specific, tissue-specific, or inducible by external signals or agents; such elements can be located in the 5' or 3' regions of the gene. Both constitutive and inducible promoters are included (see, e.g., Bitter et al., Methods in Enzymology 153:516-544, 1987). For example, when cloning in a bacterial system, inducible promoters such as pL of bacteriophage λ, plac, ptrp, ptac (ptrp-lac hybrid promoter), etc. can be used. In one embodiment, when cloning in a mammalian cell system, promoters derived from the mammalian cell genome (such as the metallothionein promoter) or from mammalian viruses (such as retroviral long terminal repeats; adenovirus late promoters; vaccinia virus 7.5K promoter) can be used. Promoters generated by recombinant DNA or synthetic techniques can also be used to provide transcription of the nucleic acid sequence. Expression vector: A vector containing a recombinant polynucleotide that contains an expression control sequence operably linked to a nucleotide sequence to be expressed. The expression vector contains sufficient cis-acting elements for expression; other elements for expression can be provided by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) into which the recombinant polynucleotide is incorporated.

[0173] The term "heterologous" refers to a genetic origin different from the source. A nucleic acid molecule heterologous to a cell is derived from a genetic source other than the cell in which it is expressed. In a specific non-limiting example, a heterologous nucleic acid molecule encoding a recombinant coronavirus S protein is expressed in a cell (such as a mammalian cell). Methods for introducing heterologous nucleic acid molecules into cells or organisms are well known in the art, such as transformation with nucleic acids, including electroporation, lipofection, particle gun acceleration, and homologous recombination

[0174] The terms "peptide", "polypeptide", and "protein" are used interchangeably and refer to a compound containing amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can make up the protein or peptide sequence. A polypeptide includes any peptide or protein containing two or more amino acids linked to each other by peptide bonds. As used herein, the term refers to both short chains (e.g., those commonly also referred to as peptides, oligopeptides, and oligomers in the art) and long chains (commonly referred to as proteins in the art, and there are many types of proteins). "Polypeptide" includes, for example, bioactive fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins, etc. Polypeptides include natural peptides, recombinant peptides, or combinations thereof.

[0175] In the context of the present application, a protein is represented by an amino acid sequence and, correspondingly, a nucleic acid molecule or polynucleotide is represented by a nucleic acid sequence. Identity and similarity between sequences: Throughout the present application, whenever a specific amino acid sequence SEQ ID NO (exemplified by SEQ ID NO:Y) is referred to, it can be replaced by: a polypeptide represented by an amino acid sequence comprising a sequence having at least 60% sequence identity or similarity to the amino acid sequence SEQ ID NO:Y. Another preferred level of sequence identity or similarity is 65%. Another preferred level of sequence identity or similarity is 70%. Another preferred level of sequence identity or similarity is 75%. Another preferred level of sequence identity or similarity is 80%. Another preferred level of sequence identity or similarity is 85%. Another preferred level of sequence identity or similarity is 90%. Another preferred level of sequence identity or similarity is 95%. Another preferred level of sequence identity or similarity is 98%. Another preferred level of sequence identity or similarity is 99%.

[0176] Each amino acid sequence described herein, by virtue of its percentage identity or similarity to a given amino acid sequence, in a further preferred aspect has, respectively, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity or similarity to a given nucleotide or amino acid sequence. The terms "homology", "sequence identity", etc. are used interchangeably herein. Sequence identity is described herein as the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences as determined by comparing the sequences. In a preferred aspect, sequence identity is calculated based on the full length or a portion of two given SEQ ID NOs. The portion is preferably at least 50%, 60%, 70%, 80%, 90% or 100% of the two SEQ ID NOs. In the art, depending on the circumstances, "identity" also refers to the degree of sequence relatedness between amino acid or nucleic acid sequences, as determined by the matches between strings of such sequences. For example, the degree of sequence identity between two sequences can be determined by comparing the two sequences using computer programs commonly used for this purpose, such as global or local alignment algorithms. Non-limiting examples include BLASTp, BLASTn, Clustal W, MAFFT, ClustalOmega, AlignMe, Praline, GAP, BESTFIT or other suitable methods or algorithms. The Needleman and Wunsch global alignment algorithm can be used to align two sequences over their entire length or a portion thereof (the portion can refer to at least 50%, 60%, 70%, 80%, 90% of the sequence length), maximizing the number of matches and minimizing the number of gaps.The default settings can be used, and the preferred programs are Needle for pairwise sequence alignment (in one aspect, using EMBOSS Needle 6.6.0.0, gap open penalty 10, gap extension penalty: 0.5, end gap penalty: false, end gap open penalty: 10, end gap extension penalty: 0.5) and MAFFT for multiple sequence alignment (in one aspect, the MAFFT v7 default values are: BLOSUM62 [bl62], gap open: 1.53, gap extension: 0.123, order: alignment, number of tree reconstructions: 2, bootstrap tree output: on [true], maximum iterations: 2, perform FFTS: not used).

[0177] "Similarity" between two amino acid sequences is determined by comparing the amino acid sequence of one polypeptide and its conservative amino acid substitutions with the sequence of a second polypeptide. Similar algorithms for determining sequence identity can also be used to determine sequence similarity. Optionally, when determining amino acid similarity, one of ordinary skill in the art can also consider so-called conservative amino acid substitutions. As used herein, a "conservative" amino acid substitution refers to the interchangeability of residues having similar side chains.

[0178] For example, the group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; the group of amino acids having aliphatic hydroxyl side chains is serine and threonine; the group of amino acids having amide-containing side chains is asparagine and glutamine; the group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; the group of amino acids having basic side chains is lysine, arginine, and histidine; and the group of amino acids having sulfur-containing side chains is cysteine and methionine. Preferred groups of conservative amino acid substitutions are: valine - leucine - isoleucine, phenylalanine - tyrosine, lysine - arginine, alanine - valine, and asparagine - glutamine. Substitution variants of the amino acid sequences disclosed herein are those in which at least one residue in the disclosed sequence is removed and a different residue is inserted in its place. Preferably, the amino acid changes are conservative. The preferred conservative substitutions for each naturally occurring amino acid are as follows: Ala is substituted with Ser, Arg is substituted with Lys, Asn is substituted with Gln or His, Asp is substituted with Glu, Cys is substituted with Ser or Ala, Gln is substituted with Asn, Glu is substituted with Asp, Gly is substituted with Pro, His is substituted with Asn or Gln, Ile is substituted with Leu or Val, Leu is substituted with Ile or Val, Lys is substituted with Arg, Gln or Glu, Met is substituted with Leu or Ile, Phe is substituted with Met, Leu or Tyr, Ser is substituted with Thr, Thr is substituted with Ser, Trp is substituted with Tyr, Tyr is substituted with Trp or Phe, and Val is substituted with Ile or Leu.

[0179] An adjuvant refers to a vehicle used to enhance antigenicity. In some embodiments, the adjuvant can include a mineral suspension (alum, aluminum hydroxide, or aluminum phosphate) on which the antigen is adsorbed; or a water-in-oil emulsion, for example, in which an antigen solution is emulsified in a mineral oil (Freund's incomplete adjuvant), sometimes including killed mycobacteria (Freund's complete adjuvant) to further enhance antigenicity (inhibit antigen degradation and / or cause macrophage influx). In some embodiments, the adjuvant used in the disclosed immunogenic compositions is a combination of lecithin and a carbomer homopolymer (such as ADJUPLEX available from AdvancedBioAdjuvants, LLC). TM Adjuvants, see also Wegmann, Clin Vaccine Immunol, 22(9):1004-1012, 2015). Additional adjuvants for use in the disclosed immunogenic compositions include QS21 purified plant extract, Matrix M, AS01, MF59, and ALFQ adjuvant. Immunostimulatory oligonucleotides (such as those including CpG motifs) can also be used as adjuvants. Adjuvants include biomolecules ("biological adjuvants"), such as costimulatory molecules. Exemplary adjuvants include IL-2, RANTES, GM-CSF, TNF-a, IFN-γ, G-CSF, LFA-3, CD72, B7-1, B7-2, OX-40L, 4-1BBL, and toll-like receptor (TLR) agonists, such as TLR-9 agonists. Additional descriptions of adjuvants can be found, for example, in Singh (ed.) Vaccine Adjuvants and Delivery Systems. Wiley-Interscience, 2007. The adjuvant can be used in combination with the disclosed compositions.

[0180] The term "antibody" refers to an immunoglobulin, antigen-binding fragment, or derivative thereof that specifically binds and recognizes an analyte (antigen), such as the coronavirus S protein, an antigenic fragment thereof, or a dimer or multimer of the antigen. The term "antibody" is used herein in the broadest sense and encompasses various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, so long as they exhibit the desired antigen-binding activity. Non-limiting examples of antibodies include, for example, intact immunoglobulins and variants and fragments thereof that retain the binding affinity for the antigen. Examples of antibody fragments include but are not limited to Fv, Fab, Fab', Fab'-SH, F(ab')2; diabodies; linear antibodies; single-chain antibody molecules (e.g., scFv); and multispecific antibodies formed from antibody fragments. Antibody fragments include those produced by modifying intact antibodies or those synthesized de novo using recombinant DNA methods (see, e.g., Kontermann and Dubel (eds.), Antibody Engineering, Volumes 1-2, 2nd Edition, SpringerPress, 2010).

[0181] Coronaviruses are a family of positive-sense single-stranded RNA viruses known to cause severe respiratory diseases. Viruses from the coronavirus family that are currently known to infect humans come from the genera Alphacoronavirus and Betacoronavirus. In addition, it is believed that the genera Gammacoronavirus and Deltacoronavirus may infect humans in the future.

[0182] Non-limiting examples of betacoronaviruses include Middle East respiratory syndrome coronavirus (MERS-CoV), severe acute respiratory syndrome coronavirus (SARS-CoV), human coronavirus HKU1 (HKU1-CoV), human coronavirus OC43 (OC43-CoV), murine hepatitis virus (MHV-CoV), bat SARS-like coronavirus WIV1 (WIV1-CoV), and human coronavirus HKU9 (HKU9-CoV). Non-limiting examples of alphacoronaviruses include human coronavirus 229E (229E-CoV), human coronavirus NL63 (NL63-CoV), porcine epidemic diarrhea virus (PEDV), and transmissible gastroenteritis coronavirus (TGEV). A non-limiting example of a deltacoronavirus is porcine deltacoronavirus (SDCV).

[0183] The viral genome is capped, polyadenylated, and covered by a nucleocapsid protein. The coronavirus virion includes a viral envelope containing a type I fusion glycoprotein (called the spike (S) protein). Most coronaviruses have a common genomic organization in which the replicase genes are contained in the 5' portion of the genome and the structural genes are contained in the 3' portion of the genome.

[0184] Coronavirus spike (S) protein: It is a class I fusion glycoprotein initially synthesized as a precursor protein. The precursor S polypeptide alone forms a homotrimer and undergoes glycosylation in the Golgi apparatus and is processed to remove the signal peptide and is cleaved by cellular proteases to produce separate S1 and S2 polypeptide chains, which remain associated as an S1 / S2 protomer in the homotrimer and are thus a trimer of heterodimers. The S1 subunit is distal to the viral membrane and contains a receptor-binding domain (RBD) that mediates viral attachment to its host receptor. The S2 subunit contains a fusion protein machinery, such as a fusion peptide, two heptad-repeat sequences (HR1 and HR2) and a central helix unique to the fusion glycoprotein, a transmembrane domain, and a cytoplasmic tail domain.

[0185] The pre-fusion conformation of the coronavirus spike (S) protein is the structural conformation adopted by the extracellular domain of the coronavirus S protein after it is processed into the mature coronavirus S protein in the secretory system and before triggering a fusion event that causes the coronavirus S to transform into the post-fusion conformation. The three-dimensional structure of an exemplary coronavirus S protein (HKU1-CoV) in the pre-fusion conformation is disclosed herein and provided in Kirchdoerfer et al., "Pre-fusion structure of a human coronavirus spike protein," Nature, 531:118-121, 2016 (incorporated herein by reference).

[0186] The trimer of the extracellular domain of the coronavirus S that is "stabilized in the pre-fusion conformation" contains one or more amino acid substitutions, deletions, or insertions compared to the native coronavirus S sequence, which provides increased retention of the pre-fusion conformation compared to the trimer of the extracellular domain of the coronavirus S formed by the corresponding native coronavirus S sequence. The "stabilization" of the pre-fusion conformation by one or more amino acid substitutions, deletions, or insertions can be, for example, energetic stabilization (e.g., reducing the energy of the pre-fusion conformation relative to the post-fusion open conformation) and / or kinetic stabilization (e.g., reducing the rate of transition from the pre-fusion conformation to the post-fusion conformation). In addition, the stabilization of the trimer of the extracellular domain of the coronavirus S in the pre-fusion conformation compared to the corresponding native coronavirus S sequence can include increased resistance to denaturation. Methods for determining whether a trimer of the extracellular domain of the coronavirus S is in the pre-fusion conformation are provided herein and include (but are not limited to) negative stain electron microscopy and antibody binding assays using pre-fusion conformation-specific antibodies.

[0187] Degenerate variant: In the context of the present disclosure, a "degenerate variant" refers to a polynucleotide encoding a polypeptide that includes sequences that are degenerate due to the genetic code. There are 20 natural amino acids, most of which are specified by more than one codon. Thus, all degenerate nucleotide sequences encoding a peptide are included, so long as the amino acid sequence of the peptide encoded by the nucleotide sequence remains the same.

[0188] In one instance, the desired response is to inhibit or reduce or prevent CoV (such as SARS-CoV-2) infection. The CoV infection need not be completely eliminated or reduced or prevented for the method to be effective. For example, administration of an effective amount of an immunogen can induce an immune response that reduces CoV infection (e.g., as measured by infection of cells or by the number or percentage of subjects infected with CoV) by a desired amount, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98% or even at least 100% (elimination or prevention of detectable CoV infection) compared to a suitable control. Epitope: Antigenic determinant. These are specific chemical groups or peptide sequences on a molecule that have antigenicity such that they elicit a specific immune response. For example, an epitope is an antigenic region to which B cells and / or T cells respond. Antibodies can bind to specific antigenic epitopes, such as epitopes on the extracellular domain of the coronavirus S (such as the extracellular domain of SARS-CoV S). Epitopes can be formed by contiguous amino acids or by non-contiguous amino acids juxtaposed by the tertiary folding of a protein.

[0189] Expression refers to the transcription or translation of a nucleic acid sequence. For example, a gene is expressed when its DNA is transcribed into RNA or an RNA fragment, and in some instances, the RNA or RNA fragment is processed into mRNA. A gene is also expressed when the mRNA of the gene is translated into an amino acid sequence (such as a protein or protein fragment). In a particular instance, a heterologous gene is expressed when it is transcribed into RNA. In another instance, a heterologous gene is expressed when the RNA of the heterologous gene is translated into an amino acid sequence. The term "expression" is used herein to denote transcription or translation. Regulation of expression can include control of transcription, translation, RNA transport and processing, degradation of intermediate molecules (such as mRNA), or activation, inactivation, compartmentalization or degradation of a particular protein molecule after its production.

[0190] The term "host cell" refers to a cell into which exogenous nucleic acid has been introduced, including progeny of such cells. Host cells include "transformants" and "transformed cells", which include primary transformed cells and progeny derived therefrom, regardless of the number of passages. Host cells include cells within a subject (such as a mammalian subject (such as a human)) into which exogenous nucleic acid has been introduced.

[0191] "Immunogen" refers to any polypeptide that can induce an immune response in a subject upon administration. In some embodiments, the immunogen is encoded by a nucleic acid molecule that can be incorporated, for example, into a polynucleotide or vector for subsequent expression of the immunogen (e.g., a target gene product or a fragment thereof (e.g., a polypeptide)).

[0192] As used herein, the term "immunogenic composition" is defined as a material for stimulating an immune response and can confer immunity after the immunogenic composition is administered to a subject.

[0193] The term "immunostimulant" refers to a substance (e.g., a drug and a nutrient) that stimulates the immune system by inducing activation or increasing the activity of any of its components. Immunostimulants include cytokines (e.g., granulocyte macrophage colony-stimulating factor) and interferons (e.g., IFN-α and / or IFN-γ).

[0194] "Pharmaceutical composition" refers to any composition containing a therapeutic or bioactive agent (such as an immunogenic composition or a vaccine, which preferably includes a nucleotide sequence encoding a target antigen gene product or a fragment thereof) that is suitable for administration to a subject and treats or prevents a disease (e.g., CoV infection) or reduces or ameliorates one or more symptoms of the disease (e.g., CoV viral titer, viral dissemination, infection, and / or cell fusion). For the purposes of the present invention, the pharmaceutical composition includes a vaccine, and a pharmaceutical composition suitable for delivering a therapeutic or bioactive agent may include, for example, tablets, soft gelatin capsules, capsules, pills, powders, granules, suspensions, emulsions, solutions, gels, hydrogels, oral gels, pastes, eye drops, ointments, creams, plasters, infusions, delivery devices, suppositories, enemas, injections, implants, sprays, or aerosols. Any of these formulations can be prepared by methods well known and recognized in the art. See, for example, Remington: The Science and Practice of Pharmacy (21st Edition), edited by A.R. Gennaro, Lippincott Williams & Wilkins, 2005, and Encyclopedia of Pharmaceutical Technology, edited by J. Swarbrick, Informa Healthcare, 2006, each of which is incorporated herein by reference. An immune response is a response of the cells of the immune system (such as B cells, T cells, or monocytes) to a stimulus. In one embodiment, the response is a response specific to a particular antigen ("antigen-specific response"). In one embodiment, the immune response is a T cell response, such as a CD4+ response or a CD8+ response. In another embodiment, the response is a B cell response and results in the production of specific antibodies.

[0195] Prime-boost vaccination is an immunotherapy that involves administering a first immunogenic composition (prime vaccine) to a subject, followed by a second immunogenic composition (boost vaccine) to induce an immune response. The prime vaccine and / or the boost vaccine comprise a vector (such as a viral vector, RNA or DNA vector) that expresses an antigen against which the immune response is directed. The boost vaccine is administered to the subject after the prime vaccine; examples of suitable time intervals between the administration of the prime vaccine and the boost vaccine and such time ranges are disclosed herein. In some embodiments, the prime vaccine, the boost vaccine, or both the prime vaccine and the boost vaccine further comprise an adjuvant.

[0196] A vaccine is a pharmaceutical composition that induces a prophylactic or therapeutic immune response in a subject. In some cases, the immune response is a protective immune response. Generally, a vaccine induces an antigen-specific immune response to an antigen of a pathogen (such as a viral pathogen) or to a cellular component associated with a pathological condition. A vaccine can comprise a polynucleotide (such as a nucleic acid encoding a disclosed antigen), a peptide or polypeptide (such as a disclosed antigen), a virus, a cell, or one or more cellular components. In non-limiting examples, a vaccine induces an immune response that reduces the severity of symptoms associated with a coronavirus infection (such as SARS-CoV or MERS-CoV infection) and / or reduces the viral load, compared to a control. In another non-limiting example, a vaccine induces an immune response that reduces and / or prevents a coronavirus infection (such as SARS-CoV or MERS-CoV infection), compared to a control. In certain aspects, the vaccines of the present disclosure can be referred to as "bivalent" or "multivalent" because, as a single vector, they are capable of inducing an immune response against two or more viral pathogens (such as two coronavirus isolates) simultaneously.

[0197] A vector is an entity that contains a DNA or RNA molecule with a promoter operably linked to a coding sequence of a target antigen and capable of expressing the coding sequence. Non-limiting examples include naked or packaged (lipid and / or protein) DNA, naked or packaged RNA, subcomponents of a virus or bacterium or other microorganism that can be replication-defective, or a virus or bacterium or other microorganism that can be replication-defective. A vector is sometimes referred to as a construct. A recombinant DNA vector is a vector having recombinant DNA. A vector can comprise nucleic acid sequences that allow it to replicate in a host cell, such as an origin of replication. A vector can also comprise one or more selectable marker genes and other genetic elements known in the art. A viral vector is a recombinant nucleic acid vector having at least some nucleic acid sequences derived from one or more viruses.

[0198] Virus-like particles (VLPs) are non-replicating viral shells derived from any of several viruses. VLPs are typically composed of one or more viral proteins, such as, but not limited to, those proteins referred to as capsid, coat, shell, surface, and / or envelope proteins, or particulate-forming polypeptides derived from these proteins. VLPs can form spontaneously after the proteins are recombinantly expressed in a suitable expression system. Methods for producing specific VLPs are known in the art. The presence of VLPs after recombinant expression of viral proteins can be detected using conventional techniques known in the art, such as by electron microscopy, biophysical characterization, etc. In addition, VLPs can be isolated by known techniques, such as density gradient centrifugation, and identified by characteristic density bands. See, e.g., Baker et al. (1991) Biophys. J. 60:1445-1456; and Hagensee et al. (1994) / . Virol. 68:4503-4505; Vincente, J Invertebr Pathol., 2011; Schneider-Ohrum and Ross, Curr. Top. Microbiol. Immunol, 354:53073, 2012.

[0199] II. Compositions

[0200] The compositions of the present disclosure can comprise one or more active agents. In some embodiments, the active agent can be an agent that prevents, treats, or reduces the infectivity of a viral infection. In some embodiments, treating a viral infection can include reducing the infectivity and / or transmission of the virus. In some embodiments, preventing a viral infection can include reducing the infectivity and / or transmission of the virus. The compositions of the present disclosure can comprise an active agent that prevents a viral infection, an active agent that treats a viral infection, an active agent that reduces the infectivity of a viral infection, or a combination thereof. The compositions of the present disclosure can further comprise a pharmaceutically acceptable excipient, carrier, or diluent. In addition, the compositions of the present disclosure can contain preservatives, solubilizers, stabilizers, wetting agents, emulsifiers, sweeteners, colorants, odorants, salts (the substances of the present invention can be provided in the form of pharmaceutically acceptable salts), buffers, coating agents, or antioxidants.

[0201] The present disclosure relates to non-human adenovirus vector compositions and methods of treating or preventing respiratory viral infections using immunogenic compositions comprising an adenovirus vector and optionally one or more other active ingredients, pharmaceutically acceptable carriers, diluents, excipients or adjuvants. The Applicant has found that the use of simian adenovirus vectors overcomes the heterologous vector cross-immunity problems seen in the human adenovirus vector platform (PMID: 32450106). The Applicant has configured a chimpanzee adenovirus vector expressing a SARS-CoV-2 antigen (such as the stable form of the SARS-CoV-2 "S" protein) and shown that it can protect against COVID-19 in animal models of the disease. When expressed in an adenovirus vector, the SARS-CoV-2 antigen or an immunogenic portion thereof can stimulate an immune response after infection of a human and thereby confer immunity to the COVID-19 disease. The Applicant has further found that this adenovirus vector platform can be successfully used to deliver variants of the SARS-CoV-2 antigen that are effective in generating an immunogenic response against sub-lineages or sub-variants of SARS-CoV-2.

[0202] Other aspects of the invention will be described in further detail below.

[0203] a) an adenovirus vector

[0204] The present disclosure provides an adenovirus vector for delivering DNA encoding a SARS-CoV-2 antigen (such as the stable form of the SARS-CoV-2 "S" protein). The nucleotide sequence of the transgene encoding the SARS-CoV2-Wuhan S protein is provided as SEQ ID NO: 1, and the nucleotide sequence of an exemplary adenovirus vector comprising the transgene encoding the SARS-CoV2-Wuhan S protein is provided in SEQ ID NO: 2. The protein coding sequence of the SARS-CoV2-Wuhan S protein is provided in SEQ ID NO: 3.

[0205] Adenoviruses are non-enveloped viruses with a diameter of approximately 90-100 nm, which contain a nucleocapsid and a linear double-stranded DNA genome. The viral nucleocapsid contains pentons and hexons capsomers. Unique fibers are attached to each penton base and facilitate virus attachment to host cells via the coxsackievirus and adenovirus receptor on the host cell surface. More than 50 serotype strains of adenoviruses have been identified, most of which cause respiratory infections, conjunctivitis, and gastroenteritis in humans. Adenoviruses usually replicate as episomes in the nucleus of host cells rather than integrating into the host genome. The adenovirus genome contains four early transcription units (E1, E2, E3, and E4), which mainly have regulatory functions and prepare the host cell for viral replication. The genome also contains five late transcription units (L1, L2, L3, L4, and L5), which encode structural proteins including pentons (L2), hexons (L3), scaffolding proteins (L4), and fiber proteins (L5). These five late transcription units are controlled by a single promoter. Each end of the genome contains inverted terminal repeats (ITRs) essential for viral replication.

[0206] Recombinant adenoviruses were initially developed for gene therapy, but the strong and persistent transgene-specific immune responses elicited by these gene delivery agents have prompted their use as vaccine vectors. In addition to being highly immunogenic, adenoviruses offer many other advantages for clinical vaccine development. The adenovirus genome is relatively small (between 26 and 45 kbp), well-characterized, and easy to manipulate. The deletion of a single transcription unit, E1, renders the virus replication-deficient, which increases its predictability and reduces side effects in clinical applications. Recombinant adenoviruses can accommodate relatively large transgenes, up to 8 kb in some cases, which allows flexibility in subunit design, and recombinant adenoviruses have a relatively broad tropism, facilitating the delivery of transgenes to a variety of cells and tissues. Importantly for clinical applications, methods for the large-scale production and purification of high-titer recombinant adenoviruses have been well established. To date, serotype AdHu2 or AdHu5 of subgroup C has been mainly used as a vector. However, first-generation vaccine vectors based on the prototype human adenovirus AdHu5 have shown poor efficacy in clinical trials, despite encouraging preclinical data. Subsequently, it was found that a large proportion of adults contain significant titers of neutralizing antibodies against common human serotypes (such as AdHu2 and AdHu5) due to natural infection. Neutralizing antibodies can reduce the efficacy of viral vector vaccines by blocking virus entry into host cells and thus delivery of the target transgene.

[0207] The compositions described herein include vectors for delivering heterologous molecules to cells for therapeutic or vaccine purposes. As used herein, a vector can include any genetic element, including but not limited to naked DNA, phages, transposons, cosmids, episomes, plasmids, or viruses. In some embodiments, such vectors comprise simian adenovirus DNA (e.g., SAdV-36) and a transgene or nucleic acid sequence encoding a protein (e.g., the S-protein). As used herein, a "transgene" refers to a selected heterologous gene (a nucleic acid sequence encoding a heterologous polypeptide) in combination with other regulatory elements or expression control sequences necessary to drive the translation, transcription, and / or expression of the gene product in a host cell. In several embodiments, the viral vector can include an adenoviral vector expressing a transgene encoding a coronavirus S protein. Adenoviruses from various sources, subtypes, or mixtures of subtypes can be used as the source of the viral genome of the adenoviral vector. Non-human adenoviruses (e.g., simian, chimpanzee, gorilla, avian, canine, ovine, or bovine adenoviruses) can be used to generate the adenoviral vector. For example, a simian adenovirus can be used as the source of the viral genome of the adenoviral vector. The simian adenovirus can be serotype 1, 3, 7, 11, 16, 18, 19, 20, 27, 33, 36, 38, 39, 48, 49, 50, or any other simian adenovirus serotype. The simian adenovirus can be referred to by any suitable abbreviation known in the art, such as SV, SAdV, SAV, or sAV. In some instances, the simian adenovirus vector is a simian adenovirus vector of serotype 36.

[0208] Generally, SAdV-derived adenoviral vectors are designed such that the transgene is located in a nucleic acid molecule containing other adenoviral sequences in the region where the selected adenoviral gene originally belonged. If desired, the transgene can be inserted into an existing gene region to disrupt the function of that region. Alternatively, the transgene can be inserted at the site of a partially or completely deleted adenoviral gene. For example, the transgene can be located at sites such as sites with a selectable functional E1 deletion and / or functional E3 deletion (or E3B) and / or complete E3 deletion. The term "functionally deleted" or "functional deletion" means that a sufficient amount of the gene region has been removed or otherwise disrupted (e.g., by mutation or modification) such that the gene region can no longer produce a functional product of gene expression. If desired, the entire gene region can be removed. In one embodiment, an adenoviral vector useful according to the present disclosure is simian adenovirus SAd36, which has deletions in the E1 and E3B genes. In one aspect, the vector contains a complete E3 deletion. In one aspect, the adenoviral vector has the nucleic acid sequence of SEQ ID NO:4. In another aspect, the adenoviral vector has a nucleic acid sequence having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity to SEQ ID NO:4.

[0209] For example, for a production vector that can be used to generate a recombinant virus, the vector can contain the transgene and the 5' end of the adenoviral genome or the 3' end of the adenoviral genome, or both the 5' and 3' ends of the adenoviral genome. The 5' end of the adenoviral genome contains the 5' cis-elements necessary for packaging and replication, namely the 5' inverted terminal repeat (ITR) sequence (which serves as the origin of replication) and the native 5' packaging enhancer domain (which contains the sequences necessary for packaging the linear Ad genome and the enhancer elements of the E1 promoter). The 3' end of the adenoviral genome includes the 3' cis-elements necessary for packaging and encapsidation (including the ITR). Suitably, the recombinant adenovirus contains both the 5' and 3' adenoviral cis-elements, and the transgene is located between the 5' and 3' adenoviral sequences. Simian-based adenoviral vectors (e.g., SAdV-36) can also contain additional adenoviral sequences.

[0210] Suitably, these simian-based adenoviral vectors contain one or more adenoviral elements derived from the adenoviral genome. In one embodiment, the vector contains adenoviral sequences derived from an adenoviral serotype different from the adenoviral serotype that provides the ITRs. As defined herein, a pseudotyped adenovirus is an adenovirus in which the capsid proteins of the adenovirus are from an adenovirus different from the adenovirus that provides the ITRs. Chimeric or hybrid adenoviruses can be constructed using the adenoviruses described herein using techniques known to those of skill in the art. See, for example, US 7,291,498.

[0211] A transgene is a nucleic acid sequence heterologous to the vector sequences flanking the transgene that encodes a target polypeptide, protein, or other product. The nucleic acid coding sequence is operably linked to regulatory components in a manner that permits transcription, translation, and / or expression of the transgene in a host cell.

[0212] In some embodiments, the transgene encodes a SARS-CoV-2 antigen, such as a stabilized form of the SARS-CoV-2 "S" protein. In some embodiments, the transgene encodes a coronavirus spike protein portion (or an immunogenic portion or variant thereof) having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity to SEQ ID NO:3; or having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity to SEQ ID NO:3 with K986P and V987P mutations or SEQ ID NO:3 with D614G mutation, and at least a portion or an immunogenic fragment of the coronavirus spike (S) protein, or an immunogenic fragment or variant thereof. In some embodiments, the transgene encodes a spike protein of a SARS-CoV-2 variant, and in non-limiting examples, encodes a spike protein having D80G, 144del, F157S, L5F, T95I, A67V, S477N, 144del, Q677H, A701V, F888L, T791I, T859N, D950H, E484Q, D614G, E484K, N501Y, Δ69-70, L452R, or K417N or RBD E484K mutations relative to SEQ ID NO:3. In some embodiments, the transgene encodes a spike protein from variants WA1 / 2020, B.1.1.7, B.1.351, B.1.1.28, P.1, B.1.427, B.1.526, B.1.526.1, B.1.525, P.2, B.1.617, B.1.617.1, B.1.617.2, B.1.617.3, B.1.429, B.1.429, B.1.529. In each of the above embodiments, the spike protein is further modified to a pre-fusion stabilized form (e.g., having a double proline substitution between residues 1050 to 1069 or between residues 981 to 999).

[0213] The variant Omicron (B.1.1.529) with multiple spike protein mutations was initially detected in Botswana. Specifically, the genomes of some Omicron variants encode an S protein with the following mutations: A67V, Δ69-70, T95I, G142D / A143-145, A211 / L212I, 214EPE, G339D, S371L, S373P, S375F, K417N, N440K, G446S, S477N, T478K, E484A, Q493K, G496S, Q498R, N501Y, Y505H, T547K, D614G, H655Y, N679K, P681H, N764K, D796Y, N856K, Q954H, N969K, and L981F. In some embodiments, the exemplary strain and other emerging strains (e.g., additional important variants) are candidates for the methods and formulations disclosed herein. Thus, in some embodiments, the present disclosure also encompasses recombinant adenovirus vectors that contain a transgenic stable spike protein sequence derived from the Omicron B.1.1.529 strain or a variant thereof. Non-limiting examples of subvariants of the Omicron strain include BA1.1, BA.2, BA.3, BA.4, and BA.5. In an exemplary aspect, the BA.5 variant may have the following mutations: T19I, L24S, del25-27, 69-70del, G142D, V213G, G339D, S371F, S373P, S375F, T376A, K417N, N440K, S477N, T478K, E484A, Q493R, L452R, F486V, Q498R, N501Y, D614G, H655Y, N679K, P681H, R682G, R683S, R685S, N764K, D796Y, Q954H, N969K.

[0214] Thus, in some embodiments, the transgenic nucleic acid encodes a stable SARS-CoV2-Omicron-spike protein (SARS-CoV2-Omicron-S2P), as provided in SEQ ID NO:10; or a nucleic acid sequence encoding a protein having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% sequence identity to SEQ ID NO:10 (SARS-CoV-2-Omicron-S2P).

[0215] In some embodiments, the transgenic nucleic acid encodes the SARS-Cov2-Omicron-spike protein of SEQ ID.NO:11 (SARS-CoV-2-Omicron-S6P); or a nucleic acid sequence encoding a protein having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity to SEQ ID NO:11 (SARS-CoV2-Omicron-S6P).

[0216] In some embodiments, the transgenic nucleic acid encodes the SARS-Cov2-Omicron-spike protein of SEQ ID NO:12 (SARS-CoV-2-Omicron-S6PδF); or a nucleic acid sequence encoding a protein having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity to SEQ ID NO:12 (SARS-CoV2-Omicron-S6PδF).

[0217] In some embodiments, the transgenic nucleic acid encodes the SARS-Cov2-Omicron-spike protein of SEQ ID NO:20 (SARS-CoV-2-Omicron-S6PdF); or a nucleic acid sequence encoding a protein having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity to SEQ ID NO:20 (bivalent BA.5-S6PdF).

[0218] In some embodiments, the transgenic nucleic acid encodes the SARS-Cov2-Omicron-spike protein (SARS-CoV-2-Omicron-S6P) of SEQ ID NO:21; or a nucleic acid sequence encoding a protein having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity to SEQ ID NO:21 (bivalent BA.5-S6P).

[0219] In some aspects, the adenovirus vector contains a nucleic acid sequence (transgene), wherein the nucleic acid sequence encodes an amino acid sequence having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identity to SEQ ID NO: 3 or a variant thereof, the variant containing at least 5, or at least 10, or at least 15, or at least 20, or at least 25, or at least 30 or more of the following mutations and further containing at least 2, or at least 3, or at least 4, or at least 5 or 6 stabilizing mutations as provided in F819P, A894P, A901P, A944P, K988P and V989P: T19I, L24S, del25-27, 69-70del, G142D, V213G, G339D, S371F, S373P, S375F, T376A, K417N, N440K, S477N, T478K, E484A, Q493R, L452R, F486V, Q498R, N501Y, D614G, H655Y, N679K, P681H, R682G, R683S, R685S, N764K, D796Y, A942P Q954H, N969K, K988P and V989P. In some aspects, the adenovirus vector encodes a protein having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identity to SEQ ID.NO.3 or the Omicron variants provided in SEQ ID NOs: 10-11 and 20-21, the Omicron variant containing at least 2, or at least 3, or at least 4, or at least 5, or 6 stabilizing mutations as provided in F819P, A894P, A901P, A944P, K988P and V989P. Figure 23 Sequence alignments of SEQ ID NOs: 10, 11, 20, 21 relative to the Wuhan sequence are provided.

[0220] In some embodiments, the present disclosure also encompasses an adenovirus vector comprising a nucleic acid sequence encoding an immunogenic fragment of more than one coronavirus spike protein variant or a portion thereof. In some embodiments, the present disclosure also encompasses an adenovirus vector comprising a nucleic acid sequence encoding at least a portion or an immunogenic fragment of a coronavirus spike (S) protein or an immunogenic fragment or variant thereof having a sequence with at least 80% identity to SEQ ID NO: 3, 10, 11, 20, or 21, and a nucleic acid sequence encoding at least a portion or an immunogenic fragment or variant thereof having a sequence with at least about 80% identity to one or more additional proteins derived from SARS-CoV-2. In some aspects, the one or more additional proteins may be selected from non-structural proteins 1-16 (nsp1-16), structural proteins including the S protein, envelope (E), membrane (M), and nucleocapsid (N), and the following 11 accessory proteins: ORF3a, ORF3b, ORF3c, ORF3d, ORF6, ORF7a, ORF7b, ORF8, ORF9b, ORF9c, and ORF10. In some embodiments, the present disclosure also encompasses an adenovirus vector comprising a nucleic acid sequence of at least a portion or an immunogenic fragment of a coronavirus spike (S) protein or an immunogenic fragment or variant thereof having a sequence with at least 80% identity to SEQ ID NO: 3, 10, 11, 20, or 21, and a nucleic acid sequence encoding at least a portion or an immunogenic fragment of a protein derived from another virus (e.g., rabies, measles, RSV, or influenza). Examples of suitable proteins include, but are not limited to, influenza hemagglutinin, influenza nucleoprotein, influenza M2, tetanus toxin C fragment, anthrax protective antigen, anthrax lethal factor, anthrax germination factor, rabies glycoprotein, HBV surface antigen, HIV gp120, HIV gp160, human carcinoembryonic antigen, malaria CSP, malaria SSP, malaria MSP, malaria pfg, botulinum toxin A, and Mycobacterium tuberculosis HSP. In some embodiments, the adenovirus vector is described as expressing a bivalent, trivalent, or multivalent immunogenic protein, wherein it elicits an immune response against more than one virus or more than one SARS-CoV-2 lineage, variant, sub-lineage, or sub-variant.

[0221] In some embodiments, the present disclosure also encompasses plasmids and adenoviral vectors (vectors) comprising nucleic acid sequences encoding S protein sequences as disclosed herein. In some aspects, the nucleic acid has at least 80% identity with SEQ ID NO:2, SEQ ID NO:5 or SEQ ID NO:6. In some embodiments, the adenoviral vector or plasmid comprises or consists of a nucleic acid sequence having at least about 80% identity with SEQ ID NO:2, 5 or 6. In some embodiments, the nucleic acid sequence has at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identity with SEQ ID NO:2, 5 or 6.

[0222] In some embodiments, the vector comprises or consists of the nucleic acid sequence provided in SEQ ID NO:13 (ChAd-S6PdF529). In some embodiments, the vector comprises a nucleic acid sequence having at least about 80% identity with SEQ ID NO:13 or consists of the same. In some embodiments, the nucleic acid sequence has at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identity with SEQ ID NO:13.

[0223] In some embodiments, the vector comprises or consists of the nucleic acid sequence provided in SEQ ID NO:14 (ChAd-S2P529). In some embodiments, the vector comprises a nucleic acid sequence having at least about 80% identity with SEQ ID NO:14 or consists of the same. In some embodiments, the nucleic acid sequence has at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identity with SEQ ID NO:14.

[0224] In some embodiments, the vector comprises or consists of a nucleic acid sequence as provided in SEQ ID NO:15 (ChAd-S6P529). In some embodiments, the vector comprises or consists of a nucleic acid sequence having at least about 80% identity to SEQ ID NO:15. In some embodiments, the nucleic acid sequence has at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identity to SEQ ID NO:15.

[0225] In some embodiments, the plasmid comprises or consists of a nucleic acid sequence as provided in SEQ ID NO:16 (pSAd36E3E1stS) (wherein the entire E3 gene is deleted). In some embodiments, the vector comprises or consists of a nucleic acid sequence having at least about 80% identity to SEQ ID NO:16. In some embodiments, the nucleic acid sequence has at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identity to SEQ ID NO:16.

[0226] In some embodiments, the vector comprises or consists of a nucleic acid sequence as provided in SEQ ID NO:17 (SAd36E3E1stS) (wherein the entire E3 gene is deleted). In some embodiments, the vector comprises or consists of a nucleic acid sequence having at least about 80% identity to SEQ ID NO:17. In some embodiments, the nucleic acid sequence has at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identity to SEQ ID NO:17.

[0227] In some embodiments, the vector comprises or consists of a nucleic acid sequence as provided in SEQ ID NO:18 (ChAd.BA.5-S6PdF). In some embodiments, the vector comprises or consists of a nucleic acid sequence having at least about 80% identity to SEQ ID NO:18. In some embodiments, the nucleic acid sequence has at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identity to SEQ ID NO:18.

[0228] In some embodiments, the vector comprises or consists of a nucleic acid sequence as provided in SEQ ID NO:19 (ChAd.BA.5-S6P). In some embodiments, the vector comprises or consists of a nucleic acid sequence having at least about 80% identity to SEQ ID NO:19. In some embodiments, the nucleic acid sequence has at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identity to SEQ ID NO:19.

[0229] In addition to the major elements identified above for the transgene, the vector may also include conventional control elements that are operably linked to the transgene in a manner that permits transcription, translation and / or expression of the transgene in cells transfected with the plasmid vector produced by the present invention or infected with the virus produced by the present invention. As used herein, "operably linked" sequences include expression control sequences contiguous with the target gene and expression control sequences that act in trans or at a distance to control the expression of the target gene. Expression control sequences include appropriate transcriptional start, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and sequences that enhance secretion of the encoded product when desired.

[0230] A number of expression control sequences, including natural, constitutive, inducible and / or tissue-specific promoters, are known in the art and available for use. Examples of constitutive promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally together with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally together with the CMV enhancer) [see, e.g., Boshart et al., Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the phosphoglycerate kinase (PGK) promoter, and the EF-Ia promoter [Invitrogen].

[0231] Inducible promoters enable the regulation of gene expression and can be regulated by the presence of an exogenously provided compound, an environmental factor (such as temperature), or a specific physiological state (e.g., acute phase, a specific differentiation state of a cell, or only in replicating cells). Inducible promoters and inducible systems are available from a variety of commercial sources, including but not limited to Invitrogen, Clontech, and Ariad. Many other systems have been described and can be readily selected by those skilled in the art. For example, inducible promoters include the zinc-inducible sheep metallothionein (MT) promoter and the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter. Other inducible systems include the T7 polymerase promoter system [WO 98 / 10088]; the ecdysone insect promoter [No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)], the tetracycline repression system [Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)], the tetracycline induction system [Gossen et al., Science, 268:1766-1769 (1995), see also Harvey et al., Curr. Opin. Chem. Biol., 2:512-518 (1998)]. Other systems include the FK506 dimer, VP16 or p65 using castradiol, diphenolmurislerone, the RU486 inducible system [Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)] and the rapamycin inducible system [Magari et al., J. Clin. Invest., 100:2865-2872 (1997)]. The effectiveness of some inducible promoters increases over time. In such cases, the effectiveness of such systems can be enhanced by tandem insertion of multiple repressors (e.g., TetR linked to TetR via IRES). Alternatively, screening for the desired function can be done after waiting at least 3 days. The expression of the desired protein can be enhanced by known methods to enhance the effectiveness of this system. For example, using the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE).

[0232] In another embodiment, a transgenic native promoter can be used. A native promoter is preferred when the expression of the transgene is desired to mimic native expression. A native promoter can be used when the expression of the transgene must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to a specific transcriptional stimulus. In a further embodiment, other native expression control elements such as enhancer elements, polyadenylation sites or Kozak consensus sequences can also be used to mimic native expression. Another embodiment of a transgene comprises a transgene operably linked to a tissue-specific promoter. For example, if expression in skeletal muscle is desired, a promoter that is active in muscle should be used. These include promoters from genes encoding skeletal β-actin, myosin light chain 2A, dystrophin, muscle creatine kinase, and synthetic muscle promoters having higher activity than native promoters (see Li et al., Nat. Biotech., 17:241-245 (1999)). Examples of tissue-specific promoters that are known include liver (albumin, Miyatake et al., J. Virol., 71:5124-32 (1997); hepatitis B virus core promoter, Sandig et al., Gene Ther., 3:1002-9 (1996); α-fetoprotein (AFP), Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)), osteocalcin (Stein et al., Mol. Biol Rep., 24:185-96 (1997)); bone sialoprotein (Chen et al., J. Bone Miner. Res., 11:654-64 (1996)), lymphocytes (CD2, Hansal et al., J. Immunol, 161:1063-8 (1998); immunoglobulin heavy chain; T cell receptor chain), neurons, such as the neuron-specific enolase (NSE) promoter (Andersen et al., Cell. Mol. Neurobiol, 13:503-15 (1993)), neurofilament light chain gene (Piccioli et al., Proc. Natl Acad. Sci USA, 88:5611-5 (1991)) and neuron-specific vgf gene (Piccioli et al., Neuron, 15:373-84 (1995)) and the like. Optionally, a vector carrying a transgene encoding a therapeutically useful or immunogenic product may also include a selectable marker or reporter gene, which may include sequences encoding geneticin, hygromycin or puromycin resistance, etc. Such selectable reporters or marker genes (preferably outside the viral genome to be packaged into virus particles) can be used to indicate the presence of the plasmid in bacterial cells, such as ampicillin resistance. Other components of the vector may include an origin of replication.The selection of these and other promoters and vector elements is routine, and many such sequences are available [see, for example, Sambrook et al., and the references cited therein]. These vectors are produced using techniques known to those of skill in the art, in combination with the techniques and sequences provided herein. Such techniques can include conventional cloning techniques for cDNA, such as those described in the text [Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY], the use of overlapping oligonucleotide sequences of the adenovirus genome, polymerase chain reaction, and any suitable method for providing the required nucleotide sequences.

[0233] In some embodiments, the present disclosure provides virus-like particles (VLPs) that include the disclosed recombinant adenovirus vectors. The VLPs lack the viral components required for viral replication and thus represent highly attenuated, replication-defective viral forms. Virus-like particles and methods for their production are known and familiar to those of ordinary skill in the art, and it is known that viral proteins from several viruses form VLPs, including human papillomavirus, HIV (Kang et al., Biol. Chem. 380:353-64 (1999)), Semliki-Forest virus (Notka et al., Biol. Chem. 380:341-52 (1999)), human polyomavirus (Goldmann et al., J. Virol. 73:4465-9 (1999)), rotavirus (Jiang et al., Vaccine 17:1005-13 (1999)), parvovirus (Casal, Biotechnology and Applied Biochemistry, Vol. 29, Part 2, pp. 141-150 (1999)), canine parvovirus (Hurtado et al., J. Virol. 70:5422-9 (1996)), hepatitis E virus (Li et al., J. Virol. 71:7207-13 (1997)), and Newcastle disease virus. The formation of such VLPs can be detected by any suitable technique. Examples of suitable techniques known in the art for detecting VLPs in culture media include, for example, electron microscopy techniques, dynamic light scattering (DLS), selective chromatographic separations (e.g., ion exchange, hydrophobic interaction, and / or size exclusion chromatography of VLPs), and density gradient centrifugation.

[0234] b) Components of the composition

[0235] The present disclosure also provides pharmaceutical compositions. The pharmaceutical compositions contain the adenovirus compositions of the present disclosure as an active ingredient, and at least one pharmaceutically acceptable excipient.

[0236] Pharmaceutically acceptable excipients can be diluents, binders, fillers, buffers, pH regulators, disintegrants, dispersants, preservatives, lubricants, taste-masking agents, flavoring agents, or coloring agents. The amount and type of excipients used to form the pharmaceutical composition can be selected according to known pharmaceutical principles.

[0237] In each embodiment described herein, the compositions of the present invention, in addition to the adenovirus compositions disclosed herein, may optionally comprise one or more additional drugs or therapeutic agents. Thus, in addition to the therapies described herein, other therapies known to be effective in treating viral infections can be provided to a subject. In some embodiments, the second agent is selected from corticosteroids, non-steroidal anti-inflammatory drugs (NSAIDs), intravenous immunoglobulin, kinase inhibitors, fusion or recombinant proteins, monoclonal antibodies, or combinations thereof. In some embodiments, agents suitable for combination therapy include, but are not limited to, inhaled bronchodilators and inhaled steroids.

[0238] (i) Diluent

[0239] In one embodiment, the excipient can be a diluent. The diluent can be compressible (i.e., plastically deformable) or abrasively brittle. Non-limiting examples of suitable compressible diluents include microcrystalline cellulose (MCC), cellulose derivatives, cellulose powder, cellulose esters (i.e., mixed esters of acetate and butyrate), ethyl cellulose, methyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, sodium carboxymethyl cellulose, corn starch, phosphorylated corn starch, pregelatinized corn starch, rice starch, potato starch, tapioca starch, starch-lactose, starch-calcium carbonate, sodium starch glycolate, glucose, fructose, lactose, lactose monohydrate, sucrose, xylose, lactitol, mannitol, malitol, sorbitol, xylitol, maltodextrin, and trehalose. Non-limiting examples of suitable abrasively brittle diluents include calcium hydrogen phosphate (anhydrous or dihydrate), tricalcium phosphate, calcium carbonate, and magnesium carbonate.

[0240] (ii) Binder

[0241] In another embodiment, the excipient can be a binder. Suitable binders include, but are not limited to, starch, pregelatinized starch, gelatin, polyvinylpyrrolidone, cellulose, methyl cellulose, sodium carboxymethyl cellulose, ethyl cellulose, polyacrylamide, polyvinyl oxazolidone, polyvinyl alcohol, C 12 -C 18 fatty acid alcohols, polyethylene glycols, polyols, sugars, oligosaccharides, polypeptides, oligopeptides, and combinations thereof.

[0242] (iii) Filler

[0243] In another embodiment, the excipient can be a filler. Suitable fillers include, but are not limited to, carbohydrates, inorganic compounds, and polyvinylpyrrolidone. As non-limiting examples, the filler can be dibasic and tribasic calcium sulfate, starch, calcium carbonate, magnesium carbonate, microcrystalline cellulose, calcium hydrogen phosphate, magnesium carbonate, magnesium oxide, calcium silicate, talc, modified starch, lactose, sucrose, mannitol, or sorbitol.

[0244] (iv) Buffer

[0245] In yet another embodiment, the excipient can be a buffering agent. Representative examples of suitable buffering agents can include, but are not limited to, phosphates, carbonates, citrates, tris buffers, and buffered saline salts (e.g., Tris-buffered saline or phosphate-buffered saline).

[0246] (v) pH Regulator

[0247] In various embodiments, the excipient can be a pH regulator. As non-limiting examples, the pH regulator can be sodium carbonate, sodium bicarbonate, sodium citrate, citric acid, or phosphoric acid.

[0248] (vi) Disintegrant

[0249] In a further embodiment, the excipient can be a disintegrant. The disintegrant can be non-effervescent or effervescent. Suitable examples of non-effervescent disintegrants include, but are not limited to, starch, such as corn starch, potato starch, its pregelatinized and modified starches, sweeteners, clays, such as bentonite, microcrystalline cellulose, alginates, sodium starch glycolate, gums, such as agar, guar gum, locust bean gum, karaya gum, pectin, and tragacanth gum. Non-limiting examples of suitable effervescent disintegrants include sodium bicarbonate in combination with citric acid and sodium bicarbonate in combination with tartaric acid.

[0250] (vii) Dispersant

[0251] In yet another embodiment, the excipient can be a dispersing agent or a dispersion enhancer. Suitable dispersing agents can include, but are not limited to, starch, alginic acid, polyvinylpyrrolidone, guar gum, kaolin, bentonite, purified wood cellulose, sodium starch glycolate, isoamorphous silicate, and microcrystalline cellulose.

[0252] (viii) Excipient

[0253] In another alternative embodiment, the excipient can be a preservative. Non-limiting examples of suitable preservatives include antioxidants such as BHA, BHT, vitamin A, vitamin C, vitamin E or retinyl palmitate, citric acid, sodium citrate; chelating agents such as EDTA or EGTA; and antimicrobial agents such as parabens, chlorobutanol or phenol.

[0254] (ix) Lubricant

[0255] In a further embodiment, the excipient can be a lubricant. Non-limiting examples of suitable lubricants include minerals such as talc or silica; and fats such as vegetable stearin, magnesium stearate or stearic acid.

[0256] (x) Taste - Masking Agent

[0257] In yet another embodiment, the excipient can be a taste masking agent. Taste masking materials include cellulose ethers; polyethylene glycols; polyvinyl alcohols; copolymers of polyvinyl alcohol and polyethylene glycol; monoglycerides or triglycerides; acrylic polymers; mixtures of acrylic polymers and cellulose ethers; cellulose acetate phthalate; and combinations thereof.

[0258] (xi) Flavoring Agent

[0259] In an alternative embodiment, the excipient can be a flavoring agent. Flavoring agents can be selected from synthetic flavor oils and flavoring aromatics and / or natural oils, extracts from plants, leaves, flowers, fruits and combinations thereof.

[0260] (xii) Colorant

[0261] In yet another embodiment, the excipient can be a coloring agent. Suitable coloring additives include, but are not limited to, Food, Drug and Cosmetic pigments (FD&C), Drug and Cosmetic pigments (D&C) or External Drug and Cosmetic pigments (Ext.D&C).

[0262] (xiii) Adjuvant

[0263] In yet another embodiment, the formulation may comprise an adjuvant. Adjuvants are known in the art to further increase the immune response to the applied antigenic determinant, and pharmaceutical compositions comprising an adenovirus and a suitable adjuvant are disclosed, for example, in WO 2007 / 110409, which is incorporated herein by reference. Examples of suitable adjuvants include aluminum salts such as aluminum hydroxide and / or aluminum phosphate; oil-in-water emulsion compositions (or water-in-oil-in-water compositions), including squalene-water emulsions such as MF59 (see, for example, WO 90 / 14837); saponin formulations such as QS21 and immunostimulating complexes (ISCOMs); bacterial or microbial derivatives, examples of which are monophosphoryl lipid A (MPL), 3-O-desacylated MPL (3dMPL), oligonucleotides containing CpG motifs, ADP-ribosylated bacterial toxins or mutants thereof such as Escherichia coli (E. coli) heat-labile enterotoxin LT, cholera toxin CT, etc. Vector-encoded adjuvants may also be used, for example, by using a heterologous nucleic acid encoding an oligomerization domain of C4-binding protein (C4bp) fused to the target antigen. In certain embodiments, the compositions of the invention comprise aluminum as an adjuvant, for example, in the form of aluminum hydroxide, aluminum phosphate, potassium aluminum phosphate, or combinations thereof, at a concentration of 0.05 - 5 mg of aluminum per dose, for example, an aluminum content of 0.075 - 1.0 mg.

[0264] The weight fraction of the excipient or excipient combination in the composition may be about 99% or less, about 97% or less, about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, about 5% or less, about 2% or about 1% or less of the total weight of the composition.

[0265] The agents and compositions described herein may be formulated by any conventional means using one or more pharmaceutically acceptable carriers or excipients, as described, for example, in Remington’s Pharmaceutical Sciences (edited by A.R. Gennaro), 21st edition, ISBN: 0781746736 (2005), which is incorporated herein by reference in its entirety. Such formulations will contain a therapeutically effective amount of the bioactive agent described herein (which may be in purified form), as well as a suitable amount of carrier (to provide a form suitable for proper administration to a subject).

[0266] The term "formulation" refers to a drug prepared in a form suitable for administration to a subject, such as a human. Thus, a "formulation" may include pharmaceutically acceptable excipients, including diluents or carriers.

[0267] As used herein, the term "pharmaceutically acceptable" can describe a substance or component that does not cause an unacceptable loss of pharmacological activity or unacceptable adverse side effects. Examples of pharmaceutically acceptable ingredients can be those having monographs in the United States Pharmacopeia (USP 29) and the National Formulary (NF 24), United States Pharmacopeial Convention, Inc, Rockville, Maryland, 2005 ("USP / NF") or updated versions, as well as components listed in the continuously updated FDA Inactive Ingredients Search online database. Other useful ingredients not described in USP / NF, etc. can also be used.

[0268] As used herein, the term "pharmaceutically acceptable excipient" can include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents or absorption delaying agents. The use of such media and agents for pharmaceutically active substances is well known in the art (generally see Remington’s Pharmaceutical Sciences (edited by A.R. Gennaro), 21st edition, ISBN: 0781746736 (2005)). Unless any conventional media or agents are incompatible with the active ingredient, they are considered for use in therapeutic compositions. Supplementary active ingredients can also be incorporated into the compositions.

[0269] A "stable" formulation or composition can refer to a composition having sufficient stability to allow storage at a convenient temperature (such as between about 0 °C and about 60 °C) for a commercially reasonable period of time, such as at least about one day, at least about one week, at least about one month, at least about three months, at least about six months, at least about one year or at least about two years.

[0270] The formulation should be suitable for the mode of administration. The agents used in the present disclosure can be formulated by known methods for administration to a subject by several routes, including but not limited to parenteral, pulmonary, oral, topical, mucosal, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, ophthalmic, buccal and rectal. A single agent can also be administered in combination with one or more additional agents, or with other bioactive or bioinert agents. Such bioactive or bioinert agents can be in fluid or mechanical communication with the agent, or attached to the agent by ionic, covalent, van der Waals, hydrophobic, hydrophilic or other physical forces.

[0271] In some aspects, the present disclosure encompasses intranasal delivery formulations. Formulations containing a composition for intranasal delivery may have a pH corresponding to the physiological acidic nasal pH. The physiological acidic nasal pH may depend on the intact nasal mucosal function. The composition may have a pH of about 6.5 ± 0.5 (5.9 to 7.3) or about 6.7 ± 0.6 (5.3 to 7.6). The composition may have a pH of about 3.8 - 7.7 (mean ± SD 5.7 ± 0.9). The composition for nasal delivery may be within the slightly acidic range. The average pH may have an acidity of pH 5.7.

[0272] For effective delivery of a therapeutic agent via intranasal administration, in addition to drug loss due to binding to glycoproteins in the mucus layer, the reduced transport rate across the protective mucus lining of the nasal mucosa must be taken into account. Normal mucus is a viscoelastic, gel-like substance composed of water, electrolytes, mucins, macromolecules, and shed epithelial cells. It mainly serves as a cytoprotective and lubricating covering for the underlying mucosal tissue. Mucus is secreted by randomly distributed secretory cells located in the nasal epithelium and other mucosal epithelia. The structural unit of mucus is mucin. This glycoprotein is mainly responsible for the viscoelastic properties of mucus, although other macromolecules may also contribute to this property. In airway mucus, such macromolecules include locally produced secretory IgA, IgM, IgE, lysozyme, and bronchial transferrin, which also play important roles in host defense mechanisms.

[0273] The co - administration methods of the present disclosure optionally incorporate effective mucolytic or mucokinetic agents for degrading, diluting, or clearing mucus from the intranasal mucosal surface to facilitate the absorption and / or adsorption of intranasally administered biotherapeutic agents. In these methods, the mucolytic or mucokinetic agent is co - administered as an adjuvant compound to enhance the intranasal delivery of the bioactive agent. Alternatively, an effective amount of the mucolytic or mucokinetic agent is incorporated as a processing aid in the multi - processing methods of the present invention or as an additive in the combination formulations of the present invention to provide an improved formulation that enhances the intranasal delivery of biotherapeutic compounds by reducing the barrier effect of intranasal mucus.

[0274] A variety of mucolytic or mucokinetic agents can be used in the methods and compositions of the present invention. Depending on their mechanism of action, mucolytic and mucokinetic agents can generally be classified into the following groups: proteases that cleave the protein core of mucin glycoproteins (e.g., streptokinase, papain); sulfhydryl compounds that cleave mucin disulfide bonds; and detergents that disrupt non - covalent bonds in mucus (e.g., Triton X - 100, Tween 20). Additional compounds in this context include but are not limited to bile salts and surfactants such as sodium deoxycholate, sodium taurodeoxycholate, sodium glycocholate, and lysophosphatidylcholine.

[0275] The effectiveness order of bile salts in causing the structural decomposition of mucus is deoxycholate > taurocholate > glycocholate. According to the method of the present invention, other effective agents for reducing mucus viscosity or adhesiveness to enhance nasal delivery include, for example, short-chain fatty acids and mucolytics that act by chelation, such as N-acyl collagen peptides, bile acids, and saponins (the latter act in part by chelating Ca 2+ and / or Mg 2+ and Ca 2+ and / or Mg 2+ play an important role in maintaining the structure of the mucus layer).

[0276] Additional mucolytics for use in the methods and compositions of the present invention include N-acetyl-L-cysteine (ACS), which is an effective mucolytic that reduces both the viscosity and adhesiveness of bronchopulmonary mucus and has been reported to moderately increase the nasal bioavailability of human growth hormone in anesthetized rats (from 7.5% to 12.2%). These and other mucolytics or mucus clearance agents are brought into contact with the nasal mucosa in a concentration range typically of about 0.2 to 20 mM and act synergistically with the administration of the bioactive agent to reduce the polar viscosity and / or elasticity of nasal mucus.

[0277] Other mucolytics or mucus clearance agents can be selected from a series of glycosidases that are capable of cleaving glycosidic bonds within mucin glycoproteins. α-amylase and β-amylase are representatives of such enzymes, although their mucolytic action may be limited. In contrast, bacterial glycosidases allow these microorganisms to penetrate the mucus layer of their host.

[0278] For use in combination with the adenovirus compositions in the present disclosure, non-ionic detergents are also commonly used as mucolytics or mucus clearance agents. These agents generally do not alter or significantly impair the activity of the adenovirus compositions.

[0279] c) Administration

[0280] (i) Dosage Form

[0281] The composition can be formulated into various dosage forms and administered by a variety of different ways of delivering a therapeutically effective amount of the active ingredient. Such compositions can be administered by suitable routes (e.g., oral, parenteral, pulmonary, topical, mucosal, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, ocular, buccal, and rectal) in dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants, and vehicles as required. Topical administration can also involve the use of transdermal administration, such as transdermal patches or iontophoresis devices. As used herein, the term parenteral includes subcutaneous, intravenous, intramuscular, intra-articular, or intrasternal injection or infusion techniques. The formulation of drugs is discussed, for example, in Gennaro, A.R., Remington’s Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. (18th ed., 1995), and in Liberman, H.A. and Lachman, L., eds., Pharmaceutical Dosage Forms, Marcel Dekker Inc., New York, N.Y. (1980). In certain embodiments, the composition can be a food supplement, or the composition can be a cosmetic.

[0282] For parenteral administration (including subcutaneous, intraocular, intradermal, intravenous, intramuscular, intra-articular, and intraperitoneal), the formulation can be an aqueous or oil-based solution. Aqueous solutions can include sterile diluents such as water, saline solution, pharmaceutically acceptable polyols such as glycerol, propylene glycol, or other synthetic solvents; antibacterial and / or antifungal agents such as benzyl alcohol, methylparaben, chlorobutanol, phenol, thimerosal, etc.; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffering agents such as acetate, citrate, or phosphate; and / or agents for adjusting tonicity such as sodium chloride, dextrose, or polyols such as mannitol or sorbitol. The pH of the aqueous solution can be adjusted with an acid or a base (such as hydrochloric acid or sodium hydroxide). Oil-based solutions or suspensions can further contain sesame oil, peanut oil, olive oil, or mineral oil. The composition can be present in unit-dose or multi-dose containers, such as sealed ampoules and vials, and can be stored under lyophilized (freeze-dried) conditions, requiring only the addition of a sterile liquid carrier, such as water for injection, immediately before use. Ready-to-use injection solutions and suspensions can be prepared from sterile powders, granules, and tablets.

[0283] If nasal or respiratory (mucosal) administration is desired, the composition can be in the form of, and dispensed by, a squeeze spray dispenser, a pump dispenser, or an aerosol dispenser. Such dispensers can also be used to deliver the composition to the oral or buccal (e.g., cheek or tongue) mucosa, nasal cavity. Aerosols are typically pressurized with hydrocarbons. Pump dispensers can preferably dispense a metered dose or a dose having a specific particle size.

[0284] In certain embodiments, the vector compositions disclosed herein are co-formulated in a single composition for administration, e.g., mixed and co-administered to a subject simultaneously, with, for example, a pharmaceutically acceptable buffer, carrier, excipient, and / or adjuvant. In other embodiments, the vector and the protein are formulated in separate compositions with, for example, a pharmaceutically acceptable buffer, carrier, excipient, and / or adjuvant, and are administered to the subject in the separate compositions within 24 hours (such as within 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 2 hours, or within 1 hour or less).

[0285] Generally, a safe and effective amount of the adenovirus composition is administered, e.g., an amount that will elicit a desired therapeutic effect in the subject while minimizing undesired side effects. In various embodiments, the effective amount of the adenovirus composition described herein can significantly reduce the viral infectivity of a subject suffering from a viral infection. In some embodiments, the effective amount is an amount capable of treating a respiratory viral infection. In some embodiments, the effective amount is an amount capable of treating one or more symptoms associated with a respiratory viral infection.

[0286] The amount of the compositions described herein that can be combined with a pharmaceutically acceptable carrier to produce a single dosage form will vary depending on the host being treated and the specific mode of administration. Those skilled in the art will understand that the unit content of the agent contained in a single dose of each dosage form need not itself constitute a therapeutically effective amount, since the necessary therapeutically effective amount can be achieved by administering multiple individual doses.

[0287] The dose of the adenovirus vector will depend primarily on factors such as the condition being treated, the age, weight, and health status of the patient, and can thus vary from patient to patient. For example, a therapeutically effective adult or veterinary dose of the viral vector is typically in the range of about 100 μL to about 100 mL of a vector having a concentration of about 1×10 6 to about 1×10 15 particles, about 1×10 7 to 1×10 13 particles, or about 1×10 9 to 1×10 12 particles of virus. The dose range depends on the size of the animal and the route of administration. For example, a suitable human or veterinary dose for intramuscular injection (for an animal of about 80 kg) is in the range of about 1×10 9 to about 5×10 12 particles per mL for a single site. Optionally, multiple sites of administration can be delivered. In another example, for an oral formulation, a suitable human or veterinary dose can be in the range of about 1×10 11 to about 1×10 15Within the range of the particles. Those skilled in the art can adjust these doses according to the route of administration and the therapeutic or vaccine application for which the recombinant vector is used. The expression level of the transgene can be monitored, or for an immunogen, the level of circulating antibodies can be monitored to determine the frequency of dose administration. Other methods for determining the timing of the frequency of administration will be readily apparent to those skilled in the art.

[0288] Optional method steps involve co-administering to the patient a suitable amount of a short-acting immunomodulator either simultaneously with, or before or after, the administration of the viral vector. The immunomodulator selected is defined herein as an agent capable of inhibiting the formation of neutralizing antibodies against the recombinant vector of the present invention or capable of inhibiting the cytolytic T lymphocyte (CTL) elimination of the vector. The immunomodulator can interfere with the interaction between T helper subsets (T H i or T^) and B cells to inhibit the formation of neutralizing antibodies. Alternatively, the immunomodulator can inhibit the interaction between T H i cells and CTLs to reduce the occurrence of CTL elimination of the vector. A variety of useful immunomodulators and their dosages are disclosed, for example, in Yang et al., J. Virol., 70(9) (September 1996); International Patent Application Publication No. WO 96 / 12406, published on May 2, 1996; and International Patent Application No. PCT / US96 / 03035, all of which are incorporated herein by reference.

[0289] The specific effective dosage level for any particular subject will depend on a variety of factors, including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the subject; the time of administration; the route of administration; the rate of excretion of the composition employed; the duration of the treatment; drugs used in combination with or concurrently with the specific compound employed; and like factors well known in the medical arts (see, e.g., Koda-Kimble et al. (2004) Applied Therapeutics: The Clinical Use of Drugs, Lippincott Williams & Wilkins, ISBN 0781748453; Winter (2003) Basic Clinical Pharmacokinetics, 4th Edition, Lippincott Williams & Wilkins, ISBN 0781741475; Sharqel (2004) Applied Biopharmaceutics & Pharmacokinetics, McGraw-Hill / Appleton & Lange, ISBN 0071375503). For example, it is entirely within the skill of the art to start the dosage of the composition at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, for purposes of administration, the effective daily dose may be divided into multiple doses. Thus, a single dose composition may contain such amounts or multiples thereof to constitute the daily dose. However, it should be understood that the total daily usage of the compounds and compositions of the present disclosure will be decided by the attending physician within the scope of reasonable medical judgment.

[0290] Administration of the viral composition may occur as a single event or over the course of the treatment. For example, one or more nanoparticle compositions may be administered daily, weekly, bi-weekly or monthly. For the treatment of acute conditions, the course of the treatment is typically at least several days. Some conditions may extend the treatment from several days to several weeks. For example, the treatment may be extended for more than one week, two weeks or three weeks. For more chronic conditions, the treatment may be extended from several weeks to several months or even one year or longer.

[0291] Treatment according to the methods described herein may be carried out before, concurrently with or after the conventional modes of treatment of respiratory viruses.

[0292] The present disclosure encompasses pharmaceutical compositions comprising the compounds disclosed above (to facilitate administration and enhance the stability of the active agent). For example, the compounds of the present disclosure can be mixed with at least one pharmaceutically acceptable carrier or excipient to produce a pharmaceutical composition capable of and effective for administration (delivery) to a living subject (such as a suitable subject (i.e., "subject in need of treatment" or "subject in need")). For the purposes of the aspects and embodiments of the present invention, the subject can be a human or any other animal.

[0293] III. Methods

[0294] The present disclosure encompasses methods of treating, preventing, or reducing the infectivity or transmissibility of a virus in a subject in need. In some embodiments, the method prevents or reduces the infectivity of a viral infection by preventing the virus from internalizing into the cells of the subject or by preventing the viral genome from internalizing into the cells of the subject. In some embodiments, administering the compositions provided herein (such as those described in Section II) can generate an immune response in the subject that disrupts or blocks the interaction between a viral surface protein (e.g., spike protein or envelope protein) and a host receptor protein (e.g., epithelial angiotensin-converting enzyme (ACE)). Administering the compositions of the present disclosure to a subject at risk of viral infection can reduce the risk of coronavirus infection in the subject.

[0295] The disclosed compositions can be administered to a subject to induce an immune response in the subject against the spike protein of the corresponding coronavirus. In a particular instance, the subject is a human. The immune response can be a protective immune response, such as a response that inhibits subsequent infection with the corresponding coronavirus. The elicitation of the immune response can also be used to treat or inhibit an infection and disease associated with the corresponding coronavirus.

[0296] Subjects who have developed a coronavirus infection corresponding to the S protein in the immunogen or are at risk of developing it (e.g., due to exposure to or potential exposure to a coronavirus) can be selected for treatment. After administering the disclosed immunogen, the subject can be monitored for infection or symptoms associated with the coronavirus or both.

[0297] Typical subjects expected to be treated with the therapeutic agents and methods of the present disclosure include humans, as well as non-human primates and other animals. To identify subjects for prophylaxis or treatment according to the methods of the present disclosure, well-recognized screening methods are employed to determine risk factors associated with a target disease or condition or a suspected disease or condition, or to determine the status of an existing disease or condition in a subject. These screening methods include, for example, routine examinations to determine environmental, familial, occupational, and other such risk factors that may be associated with a target disease or condition or a suspected disease or disorder, as well as diagnostic methods for detecting and / or characterizing a coronavirus infection, such as various ELISA and other immunoassay methods. These and other routine methods allow a clinician to select patients in need of therapy using the methods and pharmaceutical compositions of the present disclosure. According to these methods and principles, the compositions may be administered as an independent prophylactic or therapeutic regimen, or as a subsequent, adjunctive, or synergistic therapeutic regimen to other treatments, in accordance with the teachings herein or other routine methods.

[0298] Administration of the disclosed compositions can be for prophylactic or therapeutic purposes. When provided prophylactically, the disclosed therapeutic agent is provided prior to any symptoms (e.g., prior to infection). Prophylactic administration of the disclosed therapeutic agent is used to prevent or ameliorate any subsequent infection. When provided therapeutically, the disclosed therapeutic agent is provided at or after the onset of symptoms of a disease or infection (e.g., after the development of symptoms of a coronavirus infection corresponding to the S protein in the composition), or after a coronavirus infection has been diagnosed. Thus, the therapeutic agent can be provided prior to an anticipated coronavirus exposure (to mitigate the expected severity, duration, or extent of infection and / or related disease symptoms), after exposure or suspected exposure to the virus, or after an actual infection has begun.

[0299] The compositions described herein are provided to a subject in an amount effective to induce or enhance an immune response in the subject (preferably a human) against a coronavirus S protein. The actual dose of the disclosed compositions will vary depending on factors such as the disease indication and specific status of the subject (e.g., the subject's age, size, health status, degree of symptoms, susceptibility factors, etc.), the time and route of administration, other drugs or treatments being administered concurrently, and the specific pharmacology of the composition being used to elicit the desired activity or biological response in the subject. The dosage regimen can be adjusted to provide an optimal prophylactic or therapeutic response.

[0300] The compositions according to the present disclosure can be used in a co-vaccination regime or combination formulation. In certain embodiments, the composition and co-immunization regime employ separate transgenes or formulations, each designed to elicit an antiviral immune response, such as an immune response to the coronavirus S protein. Separate immunogenic compositions that elicit an antiviral immune response can be combined into a multivalent immunogenic composition administered to a subject in a single immunization step, or they can be administered separately (in monovalent immunogenic compositions) in a co- (or prime-boost) immunization regime.

[0301] There can be several boosts, and each boost can be a different disclosed transgene. In some instances, a boost can be the same transgene as another boost or the prime. The prime and boost can be administered as a single dose or multiple doses, for example, two, three, four, five, six or more doses can be administered to a subject over a period of days, weeks or months. Multiple boosts can also be given, such as one to five (e.g., 1, 2, 3, 4 or 5 boosts) or more. Different doses can be used in a series of successive immunizations. For example, a relatively large dose in the primary immunization and then boosted with a relatively smaller dose.

[0302] In some embodiments, the boost can be administered about two weeks, about three to eight weeks or about four weeks after the prime, or about several months after the prime. In some embodiments, the boost can be administered about 5 months, about 6 months, about 7 months, about 8 months, about 10 months, about 12 months, about 18 months, about 24 months after the prime, or more or less time after the prime. Periodic additional boosts can also be used at appropriate time points to enhance the "immune memory" of the subject. The adequacy of the selected vaccination parameters (e.g., formulation, dose, regime, etc.) can be determined by taking an aliquot of serum from the subject and measuring the antibody titer during the immunization process. In addition, the clinical condition of the subject can be monitored for the desired effect, such as prevention of infection or improvement of a disease state (e.g., reduction in viral load). If such monitoring indicates that vaccination is suboptimal, the subject can be boosted with an additional dose of the immunogenic composition and the vaccination parameters can be modified in a manner expected to enhance the immune response.

[0303] In some embodiments, the compositions of the present disclosure are administered as a single dose.

[0304] After administration of the disclosed compositions of the present disclosure, the immune system of the subject will typically respond to the composition by producing antibodies specific to the coronavirus S protein contained in the composition. This response indicates that an immunologically effective dose has been delivered to the subject.

[0305] In some embodiments, the antibody response of a subject will be determined in the context of evaluating an effective dose / immunization regimen. In most cases, it will be sufficient to evaluate the antibody titers in serum or plasma obtained from the subject. The decision whether to administer a booster and / or to vary the amount of the therapeutic agent administered to an individual can be based, at least in part, on the antibody titer levels. The antibody titer levels can be based on, for example, an immunobinding assay that measures the concentration of antibodies in serum that bind to an antigen, including, for example, the recombinant coronavirus S protein contained in the immunogen.

[0306] Complete elimination or reduction or prevention of coronavirus infection is not required for the method to be effective. For example, eliciting an immune response against coronavirus with one or more of the disclosed compositions can reduce or inhibit the amount of coronavirus infection required, for example, by at least 10%, at least 20%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98% or even at least 100% (elimination or prevention of detectable infected cells), as compared to coronavirus infection in the absence of the composition. In other instances, coronavirus replication can be reduced or inhibited by the disclosed methods. Complete elimination of coronavirus replication is not required for the method to be effective. For example, an immune response elicited using one or more of the disclosed compositions can reduce the amount of replication of the corresponding coronavirus required, for example, by at least 10%, at least 20%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98% or even at least 100% (elimination or prevention of detectable coronavirus replication), as compared to coronavirus replication in the absence of an immune response.

[0307] In some embodiments, the disclosed compositions are administered to a subject concomitantly with the administration of an adjuvant. Adjuvants are known in the art to further increase the immune response to the applied antigenic determinants, and pharmaceutical compositions comprising an adenovirus and a suitable adjuvant are disclosed, for example, in WO 2007 / 110409, which is incorporated herein by reference. Examples of suitable adjuvants are provided herein.

[0308] In some embodiments, administering a therapeutically effective amount of one or more of the disclosed compositions to a subject induces a neutralizing immune response in the subject. To assess neutralizing activity, serum can be collected from the subject at an appropriate time point after immunization of the subject, frozen, and stored for performing neutralization tests. Methods for determining neutralizing activity are known to those of ordinary skill in the art and are further described herein and include, but are not limited to, plaque reduction neutralization (PRNT) assays, micro-neutralization assays, flow cytometry-based assays, single-cycle infection assays. In some embodiments, a panel of coronavirus pseudovirus assays can be used to determine serum neutralizing activity. For example, to test the immunogenicity of a vaccine candidate against multiple MERS-CoV strains (without the need for a biosafety level 3 facility), a pseudotyped reporter virus neutralization assay was previously developed (Wand et al., Nat Commun, 6:7712, 2015), which is similar to an assay previously developed for SARS-CoV (Martin et al., Vaccine 26, 6338, 2008; Yang et al., Nature 428, 561, 2004; Naldini et al., PNAS 93, 11382, 1996; Yang et al., PNAS 102, 797, 2005).

[0309] In other embodiments, the present disclosure provides methods for treating, preventing, or reducing the infectivity of a respiratory virus infection. In some embodiments, the viral infection can be a coronavirus infection. The coronavirus can be SARS-CoV, SARS-CoV-2, MERS-CoV, HKU1, OC43, or 229E. The coronavirus can be a β-coronavirus. A subject at risk of coronavirus infection may come into contact with an asymptomatic carrier of a coronavirus infection and thereby inadvertently contract the coronavirus infection.

[0310] Certain methods of the present disclosure encompass methods of manufacturing the adenoviruses described herein. Such methods can include transfecting cells with the adenovirus vectors described herein; culturing the cells under conditions such that the cells produce recombinant adenovirus; and collecting the recombinant adenovirus. Suitable cells are known in the art. In some embodiments, the cells can be HEK, Vero, or PER cells.

[0311] The present disclosure also encompasses methods of treating a second subject with serum from a first subject. Specifically, the present disclosure encompasses compositions comprising serum from a first subject that has previously been administered an adenoviral vector as detailed herein, a pharmaceutical composition as detailed herein, or an immunogenic composition as detailed herein. Methods of collecting such serum are known in the art. Methods of treating a second subject with serum from a first subject generally include administering to the second subject an immunogenically effective amount of a composition comprising serum from the first subject. Methods of administering serum to a subject are known, and determining the dosage of the serum is within the capabilities of those skilled in the art.

[0312] Generally, the methods as described herein include administering to a subject a therapeutically effective amount of a nanoparticle composition of the present disclosure. The methods as described herein are generally performed on a subject in need thereof. The subject can be a rodent, a human, a domestic animal, a companion animal, or a zoological animal. In one embodiment, the subject can be a rodent, such as a mouse, a rat, a guinea pig, etc. In another embodiment, the subject can be a domestic animal. Non-limiting examples of suitable domestic animals can include pigs, cows, horses, goats, sheep, llamas, and alpacas. In another embodiment, the subject can be a companion animal. Non-limiting examples of companion animals can include pets, such as dogs, cats, rabbits, and birds. In another embodiment, the subject can be a zoological animal. As used herein, a "zoological animal" refers to an animal that can be found in a zoo. Such animals can include non-human primates, large cats, wolves, and bears. In a preferred embodiment, the subject is a human.

[0313] IV. Kits

[0314] Kits are also provided. Such kits can include the agents or compositions as described herein, and in certain embodiments, include instructions for administration. The components can include, but are not limited to, one or more of the following: (i) a host cell as described herein, a packaging cell as described herein, an adenoviral vector as described herein, a pharmaceutical composition as described herein, or an immunogenic composition as described herein, and (ii) instructions for use. In some embodiments, the kits of the present disclosure can include the composition detailed in Section II above. Such kits can facilitate the implementation of the methods as described herein. When provided in kit form, the different components of the composition can be packaged in separate containers and mixed immediately prior to use. If desired, such separate packaging of the components can be presented in a packaging or dispenser device that can contain one or more unit dosage forms containing the composition. For example, the packaging can include a metal or plastic foil, such as a blister pack. In certain cases, such separate packaging of the components can also allow for long-term storage without loss of the activity of the components.

[0315] The kit may also include a reagent (such as sterile water or saline) in a separate container to be added to the lyophilized active component in a separate package. For example, a sealed glass ampoule may contain the lyophilized component, and sterile water, sterile saline or sterile in a separate ampoule bottle, each packaged under a neutral non-reactive gas (such as nitrogen). The ampoule may be composed of any suitable material, such as glass, organic polymers (such as polycarbonate, polystyrene), ceramics, metals or any other material commonly used to contain reagents. Other examples of suitable containers include bottles that can be made of substances similar to ampoules, and envelopes that can be composed of a foil lining on the inside (such as aluminum or alloy). Other containers include test tubes, vials, flasks, bottles, syringes, etc. The container may have a sterile access port, such as a bottle with a stopper that can be pierced by a hypodermic needle. Other containers may have two compartments separated by a membrane that can be easily removed, and the membrane allows the components to mix after removal. The removable membrane can be glass, plastic, rubber, etc.

[0316] In certain embodiments, the kit may provide instructional materials. The instructions may be printed on paper or other substrates, and / or may be provided as an electronically readable medium (such as a floppy disk, mini CD-ROM, CD-ROM, DVD-ROM, Zip disk, video tape, audio tape, etc.). The detailed instructions may not be physically associated with the kit; instead, the user may be directed to an Internet website designated by the kit manufacturer or distributor.

[0317] The compositions and methods described herein that utilize molecular biology protocols can be carried out according to a variety of standard techniques known in the art (see, e.g., Sambrook and Russel (2006) Condensed Protocols from Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, ISBN-10: 0879697717; Ausubel et al. (2002) Short Protocols in Molecular Biology, 5th Edition, Current Protocols, ISBN-10: 0471250929; Sambrook and Russel (2001) Molecular Cloning: A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press, ISBN-10: 0879695773; Elhai, J. and Wolk, C.P. 1988. Methods in Enzymology 167, 747-754; Studier (2005) Protein Expr Purif. 41(1), 207–234; Gellissen, ed. (2005) Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems, Wiley-VCH, ISBN-10: 3527310363; Baneyx (2004) Protein Expression Technologies, Taylor & Francis, ISBN-10: 0954523253).

[0318] Certain embodiments disclosed herein may be further limited in the claims by the use of the language “consisting of” or “consisting essentially of” instead of “comprising”. When used in a claim, whether submitted or added pursuant to amendment, the transitional term “consisting of” excludes any element, step, or ingredient not specified in the claim. The transitional term “consisting essentially of” limits the scope of the claim to the specified materials or steps and those that do not materially affect the basic and novel characteristics. The claimed embodiments of the invention are inherently or explicitly described and enabled herein.

[0319] Since various changes can be made to the above materials and methods without departing from the scope of the present invention, all the content contained in the above description and the embodiments given below should be construed as illustrative rather than restrictive.

[0320] Example

[0321] The following examples are included to illustrate various embodiments of the present disclosure. Those skilled in the art should understand that the techniques disclosed in the following examples represent techniques that the inventors have found to function well in practicing the present invention and, accordingly, can be considered to constitute a preferred mode for its practice. However, in light of the present disclosure, those skilled in the art should understand that many changes can be made to the specific embodiments disclosed and still obtain like or similar results without departing from the spirit and scope of the present invention.

[0322] Example 1 : Single-dose chimpanzee adenovirus vector vaccine protects against SARS-CoV-2 infection and pneumonia in mice expressing the human ACE2 receptor

[0323] This example provides a SARS-CoV-2 vaccine (ChAd-SARS-CoV-2-S) based on chimpanzee Ad (simian AdV-36) that encodes a prefusion-stabilized spike (S) protein with two proline substitutions introduced in the S2 subunit. Intramuscular administration of ChAd-SARS-CoV-2-S induces robust systemic humoral and cell-mediated immune responses against the S protein. After SARS-CoV-2 challenge in mice transiently expressing the human ACE2 (hACE2) receptor, one or two vaccine doses protected against lung infection, inflammation, and pathology. Although high levels of neutralizing antibodies were induced in serum, neither dosing regimen provided complete protection against SARS-CoV-2 infection, as relatively high levels of viral RNA were still detected in the lungs. In contrast, when a single dose of ChAd-SARS-CoV-2-S was administered via the intranasal route, high levels of neutralizing antibodies and anti-SARS-CoV-2 IgA were detected, as well as complete protection against infection in both the upper and lower respiratory tracts. Additionally, and compared to a control ChAd vaccine, there was no serum antibody response to the SARS-CoV-2 NP protein in animals immunized with ChAd-SARS-CoV-2-S via intranasal delivery 8 days after SARS-CoV-2 challenge. Thus, ChAd-SARS-CoV-2-S has the potential to confer sterilizing immunity at the site of inoculation, which prevents both virus-induced disease and transmission.

[0324] Results

[0325] Chimpanzee Ad vector vaccines induce robust antibody responses against SARS-CoV-2: Two replication-defective ChAd vectors based on simian Ad-36 virus were constructed. The ChAd-SARS-CoV-2-S vector encodes the full-length sequence of the SARS-CoV-2 S protein in transgene form, including the extracellular domain, transmembrane domain, and cytoplasmic domain (GenBank: QJQ84760.1), and is stabilized in the prefusion form by two proline substitutions at residues K986 and V987. The ChAd control has no transgene. The S protein transgene is transcriptionally controlled by the cytomegalovirus promoter. To render the vector replication-defective and enhance packaging capacity, the E1A / B genes were replaced and a deletion was introduced in the E3B gene ( Figure 1A ). To confirm that the S protein was expressed and antigenically intact, 293T cells were transduced and binding of a panel of 22 neutralizing monoclonal antibodies to the S protein was confirmed by flow cytometry ( Figure 1B ).

[0326] To evaluate the immunogenicity of ChAd-SARS-CoV-2-S, groups of 4-week-old BALB / c mice were immunized intramuscularly with 10 10 viral particles of ChAd-SARS-CoV-2-S or ChAd-control. Some mice received a booster dose four weeks later. Serum samples were collected 21 days after the primary or booster immunization ( Figure 1C ), and IgG responses against purified S and RBD proteins were evaluated by ELISA. Although ChAd-SARS-CoV-2-S induced high levels of S-specific and RBD-specific IgG, low levels (if any) were detected in mice immunized with the ChAd-control ( Figure 1D and Figure 2A ). Serum samples were assayed for neutralization of infectious SARS-CoV-2 in vitro using the focus reduction neutralization test (FRNT). As expected, sera from mice immunized with the ChAd-control did not inhibit SARS-CoV-2 infection after the primary immunization or booster. In contrast, sera from animals vaccinated with ChAd-SARS-CoV-2-S strongly neutralized SARS-CoV-2 infection, and the booster enhanced this inhibitory activity ( Figure 1E and Figure 2B - 2C ).

[0327] Vaccine-induced memory CD8+ T cells and antigen-specific B cell responses: Since optimal vaccination usually involves both humoral and cellular responses, the levels of SARS-CoV-2-specific CD4+ and CD8+ T cells were measured after vaccination. Four-week-old BALB / c mice were immunized with ChAd-SARS-CoV-2-S or ChAd-control and boosted three weeks later. To evaluate vaccine-induced SARS-CoV-2-specific CD4+ and CD8+ T cell responses, splenocytes were harvested one week after boost and stimulated ex vivo with 253 overlapping 15-mer S peptide pools. Subsequently, the quantification of intracellular IFNγ and granzyme B expression was determined by flow cytometry. After ex vivo peptide restimulation, splenic CD8+ T cells expressed IFNγ and both splenic CD4+ and CD8+ T cells expressed granzyme B in mice immunized with ChAd-SARS-CoV-2-S, but not in mice immunized with the ChAd-control vector ( Figure 1F - 1G and Figure 3 ). To evaluate antigen-specific B cell responses, splenocytes were harvested and analyzed by ELISPOT with the S protein. The ChAd-SARS-CoV-2-S vaccine induced S protein-specific IgG antibody-secreting cells in the spleen, while the control vaccine did not ( Figure 1H ).

[0328] Intramuscular immunization with the ChAd-SARS-CoV-2-S vaccine protects against SARS-CoV-2 infection in the lung: The protective activity of the ChAd vaccine was tested in a recently developed SARS-CoV-2 infection model (where BALB / c mice express hACE2 in the lung) after intranasal delivery of the vectorized human Ad (Hu-Ad5-hACE2). Endogenous murine ACE2 does not support viral entry, and this system enables the induction of SARS-CoV-2 infection in the murine lung. Four-week-old BALB / c mice were first immunized via the intramuscular route with the ChAd-control or ChAd-SARS-CoV-2-S vaccine. Approximately thirty days later, 10 8 plaque-forming units (PFU) of Hu-Ad5-hACE2 and an anti-Ifnar1 monoclonal antibody (mAb) were administered to the mice via the intranasal and intraperitoneal routes, respectively. A single dose of anti-Ifnar1 mAb was also administered to enhance lung pathogenesis in this model. Cross-immunity between the ChAd and Hu-Ad5 vectors was confirmed. Serum from ChAd-immunized mice did not neutralize Hu-Ad5 infection ( Figure 4A - 4B ).

[0329] Five days after Hu-Ad5-hACE2 transduction, mice were challenged with 4 × 10 5 focus-forming units (FFU) of SARS-CoV-2 via the intranasal route (Figure 2A ). At 4 days post-infection (dpi) (the peak of viral load in this model), the mice were euthanized and the lungs, spleens, and hearts were harvested for viral load and cytokine analysis. Notably, as determined by plaque assay, no detectable infectious virus was present in the lungs of mice immunized with ChAd-SARS-CoV-2-S, while high levels were present in mice vaccinated with ChAd-control( Figure 5B ). Consistent with this result, reduced viral RNA levels were observed in the lungs, hearts, and spleens of ChAd-SARS-CoV-2-S vaccinated animals compared to mice receiving the ChAd-control vector( Figure 5C ). In situ hybridization staining of viral RNA in the lungs harvested at 4 dpi revealed a significant reduction in SARS-CoV-2 RNA in alveolar cells of animals immunized with ChAd-SARS-CoV-2-S compared to ChAd-control( Figure 5D ). A subgroup of immunized animals was euthanized at 8 dpi and tissues were harvested for evaluation. At this time, viral RNA levels in the lungs and spleens of ChAd-SARS-CoV-2-S immunized mice were again lower or absent compared to the control ChAd vector( Figure 5C ). In summary, these data indicate that single intramuscular immunization with ChAd-SARS-CoV-2-S results in a marked but not complete reduction of SARS-CoV-2 infection in the lungs of challenged mice.

[0330] Next, the effects of the vaccine on pulmonary inflammation and disease were evaluated. Lower levels of mRNA for several pro-inflammatory cytokines and chemokines were observed in the lung tissues of animals immunized with ChAd-SARS-CoV-2-S compared to ChAd-control, including CXCL10, IL1β, IL-6, CCL5, IFNβ, and IFNγ( Figure 5E ). In addition, mice immunized with the ChAd-control vaccine and challenged with SARS-CoV-2 showed evidence of viral pneumonia, characterized by accumulation of immune cells at perivascular and alveolar locations, vascular congestion, and interstitial edema. In contrast, animals immunized with ChAd-SARS-CoV-2-S showed a marked attenuation of the inflammatory response in the lungs that developed in ChAd-control immunized mice( Figure 6 ). Thus, immunization with Ch-Ad-SARS-CoV-2 reduces viral infection and the consequent pulmonary inflammation and injury associated with SARS-CoV-2 infection.

[0331] Then, the improved protection using a prime-boost vaccination regimen was evaluated. BALB / c mice were immunized intramuscularly with ChAd-control or ChAd-SARS-CoV-2-S and received a homologous boost dose four weeks later. On day 29 after the boost, the mice were treated with a single dose of anti-Ifnar1 antibody, followed by Hu-Ad5-hACE2, and then challenged with SARS-CoV-2 five days later. As expected, the prime-boost regimen protected against SARS-CoV-2 challenge, and no infectious virus was detected in the lungs ( Figure 5F ). Although a significant reduction in viral RNA was detected in the lungs, spleen, and heart at 4 dpi, residual viral RNA levels remained, indicating that protection was not complete even after boosting ( Figure 5G ).

[0332] Single intranasal immunization with ChAd-SARS-CoV-2-S induces sterilizing immunity against SARS-CoV-2: Mucosal immunization via the nasopharyngeal route elicits a local immune response including secretory IgA antibodies, which confer protection at or near the site of inoculation of respiratory pathogens. To evaluate the immunogenicity and protective efficacy of mucosal vaccination, five-week-old BALB / c mice were inoculated intranasally with 10 10 viral particles of ChAd-control or ChAd-SARS-CoV-2-S ( Figure 7A ). Serum samples were collected four weeks after immunization to evaluate the humoral immune response. Intranasal immunization with ChAd-SARS-CoV-2-S but not ChAd-control induced high levels of S-specific and RBD-specific IgG and IgA in the serum ( Figure 7B - 7C ) as well as SARS-CoV-2 neutralizing antibodies (geometric mean titer of 1 / 1,574) ( Figure 7D and Figure 8A ). Serum antibodies from mice immunized with ChAd-SARS-CoV-2-S equivalently neutralized a recombinant, luciferase-expressing SARS-CoV-2 variant encoding the D614G mutation in the S protein ( Figure 8B ); this finding is important because many circulating viruses contain this substitution, which is associated with higher infectivity in cell culture (doi.org / 10.1101 / 2020.06.12.148726). The SARS-CoV-2-specific antibody response in the bronchoalveolar lavage (BAL) fluid of immunized mice was also evaluated. BAL fluid from mice vaccinated with ChAd-SARS-CoV-2-S but not the ChAd-control vaccine showed high levels of S-specific and RBD-specific IgG and IgA antibodies ( Figure 7E - 7F ), including those with neutralizing activity ( Figure 7G and Figure 8C ).

[0333] To evaluate the T cell responses activated via mucosal immunization, mice were vaccinated intranasally with ChAd-SARS-CoV-2-S or ChAd-control and boosted similarly four weeks later. Lungs were harvested one week after boost and T cells were analyzed by flow cytometry. Ex vivo restimulation with an S peptide pool led to a marked increase in CD8+ T cells producing IFNγ and granzyme B in the lungs of mice receiving the ChAd-SARS-CoV-2-S vaccine( Figure 7H ). Specifically, antigen-specific CD103 + CD69 + CD8 + T cell populations( Figure 7I ) were identified in the lungs, which were phenotypically consistent with vaccine-induced resident memory T cells. In the spleen, plasma cells secreting antibodies were detected after intranasal immunization with ChAd-SARS-CoV-2-S, producing IgA or IgG against the S protein( Figure 7J ). Notably, the frequency of B cells secreting anti-S IgA was approximately five-fold that of IgG.

[0334] The protective efficacy of the ChAd vaccine after a single-dose intranasal immunization was evaluated. On day 30 after vaccination, 10 8 PFU of Hu-Ad5-hACE2 and anti-Ifnar1 mAb were administered to the mice as described above. Five days later, the mice were challenged with 4 × 10 5 FFU of SARS-CoV-2. At 4 and 8 dpi, the lungs, spleens, hearts, turbinates, and nasal washes were harvested and the viral loads were evaluated. As judged by the absence of infectious virus in the lungs( Figure 9A ) and the near absence of measurable viral RNA in the lungs, spleens, hearts, turbinates, or nasal washes( Figure 9B ), intranasal delivery of the ChAd-SARS-CoV-2-S vaccine exhibited significant protective efficacy. The very low levels of viral RNA in the lungs and turbinates at 4 dpi may reflect the input non-replicating virus, as similar levels were measured in C57BL / 6 mice lacking hACE2 receptor expression at this time. The levels of cytokine and chemokine mRNA in the lung homogenates of mice immunized with ChAd-SARS-CoV-2-S were also significantly lower than those of the ChAd control vaccine( Figure 9C ), and the residual expression may be due to the human Ad vector hACE2 delivery system. Finally, histopathological analysis of lung tissues from animals vaccinated intranasally with ChAd-SARS-CoV-2-S and challenged with SARS-CoV-2 showed minimal perivascular and alveolar infiltrates (if any) at 8 dpi compared to the extensive inflammation observed in animals vaccinated with the ChAd control vaccine( Figure 9D)。

[0335] To determine whether intranasal delivery of ChAd-SARS-CoV-2-S achieved sterilizing immunity, anti-NP antibodies were measured at 8 dpi and compared to responses from 5 days before SARS-CoV-2 infection. Since the NP gene is not present in the vaccine vector, induction of a humoral immune response against NP after SARS-CoV-2 exposure indicates viral protein translation and active infection. After SARS-CoV-2 challenge, an anti-NP antibody response was detected in ChAd control mice vaccinated via the intranasal route or in ChAd control and ChAd-SARS-CoV-2-S mice vaccinated via the intramuscular route ( Figure 9E and Figure 2D ). Notably, none of the mice immunized with ChAd-SARS-CoV-2-S via the intranasal route showed a significant increase in the anti-NP antibody response after SARS-CoV-2 infection. Combining our virological analysis, these data suggest that single intranasal immunization with ChAd-SARS-CoV-2-S induces robust and potentially sterilizing mucosal immunity that prevents SARS-CoV-2 infection in the upper and lower respiratory tracts of mice expressing the hACE2 receptor.

[0336] Discussion

[0337] In this example, intramuscular and intranasal administration of replication-deficient ChAd vectors as a vaccine platform for SARS-CoV-2 was evaluated. Single-dose immunization via the intramuscular route with a vaccine based on stabilized S protein induced S-specific and RBD-specific binding and neutralizing antibodies. Vaccination with one or two doses protected mice expressing human ACE2 from SARS-CoV-2 challenge, as demonstrated by the absence of infectious virus in the lungs and a significant reduction in viral RNA levels in the lungs and other organs. Mice immunized with ChAd-SARS-CoV-2-S also showed a marked reduction (and even disappearance) of signs of lung pathology, pulmonary inflammation, and pneumonia compared to control ChAd vaccines. However, intramuscular vaccination with ChAd-SARS-CoV-2-S did not confer sterilizing immunity, as demonstrated by detectable viral RNA levels in several tissues (including the lungs) and induction of anti-NP antibody responses. Mice immunized with a single dose of ChAd-SARS-CoV-2-S via the intranasal route were also protected from SARS-CoV-2 challenge. However, intranasal vaccination generated robust IgA and neutralizing antibody responses that protected both the upper and lower respiratory tracts from SARS-CoV-2 infection and inhibited infection with both wild-type and D614G variant viruses. Extremely low viral RNA in the upper airway tissues and the absence of serological responses to NP in the context of challenge strongly suggest that most animals receiving a single intranasal dose of ChAd-SARS-CoV-2-S achieved sterilizing immunity.

[0338] Although several vaccine candidates (e.g., lipid-encapsulated mRNA, DNA, inactivated, and viral-vectored) have advanced rapidly to human clinical trials in the accelerated efforts to control the pandemic, few studies have demonstrated their efficacy in preclinical models. Rhesus macaques immunized with two or three doses of a DNA plasmid vaccine encoding the full-length SARS-CoV-2 S protein induced neutralizing antibodies in serum and reduced viral loads in BAL and nasal mucosal fluids. In addition, three immunizations with purified inactivated SARS-CoV-2 within two weeks induced neutralizing antibodies and provided partial or complete protection against infection and viral pneumonia in rhesus macaques depending on the dose administered. A limitation of these challenge models is that rhesus macaques develop mild interstitial pneumonia after SARS-CoV-2 infection compared to some human and other nonhuman primate species. This example shows in mice expressing hACE2 that a single intramuscular or intranasal dose of the ChAd-SARS-CoV-2-S vaccine confers significant and potentially complete protection against viral replication, inflammation, and lung disease.

[0339] The present disclosure supports the use of non-human Ad vector vaccines against emerging RNA viruses, including SARS-CoV-2. Previous work has shown the efficacy of single-dose or two-dose regimens of gorilla Ad encoding the prM-E gene of Zika virus (ZIKV) in several murine challenge models, including in the context of pregnancy. Others have evaluated ChAd or rhesus Ad vaccine candidates against ZIKV and shown efficacy in mice and non-human primates. A different ChAd encoding wild-type SARS-CoV-2 S protein (ChAdOx1) is currently in clinical trials in humans (NCT04324606). Although data from human trials have not yet been reported, studies in rhesus monkeys have shown that a single intramuscular dose protects against infection in the lung but not in the upper respiratory tract (biorxiv.org / content / 10.1101 / 2020.05.13.093195v1). No vaccine evaluated against SARS-CoV-2 in any preclinical or clinical study has shown evidence of immune enhancement, a theoretical risk based on studies of other human and animal coronaviruses. Indeed, and in contrast to data on SARS-CoV vaccines or antibodies, enhanced infection, immunopathology, or disease has not been observed in animals immunized with ChAd encoding SARS-CoV-2 S protein or administered passively transferred monoclonal antibodies.

[0340] ChAd-SARS-CoV-2-S induced a SARS-CoV-2-specific CD8+ T cell response after in vitro S peptide restimulation, which included a high percentage and number of cells expressing IFNγ and granzyme. The induction of a robust CD8+ T cell response by the ChAd-SARS-CoV-2-S vaccine is consistent with reports of other simian Ad vectors. The ChAd vaccine vector not only overcomes the problem of pre-existing immunity against human adenoviruses but also has immunological advantages in that they do not induce an exhausted T cell response.

[0341] A single intranasal dose of ChAd-SARS-CoV-2-S conferred excellent immunity against SARS-CoV-2 challenge, superior to one or two intramuscular immunizations with the same vaccine and dose. Given that the serum neutralizing antibody responses were comparable, it was speculated that the greater protection observed after intranasal delivery was due to the mucosal immune response generated. Indeed, high levels of anti-SARS-CoV-2 IgA were detected in serum and lung, as well as IgA-secreting B cells in the spleen. In addition, intranasal vaccination also induced SARS-CoV-2-specific CD8+ T cells in the lung, including CD103 + CD69 +Cells, which may have a resident memory phenotype. To our knowledge, none of the SARS-CoV-2 vaccine platforms currently in clinical trials use intranasal delivery. There is great interest in using intranasal delivery for influenza A virus vaccines because they can elicit local humoral and cellular immune responses. In fact, sterilizing immunity to influenza A virus reinfection requires local adaptive immune responses in the lung, which are best induced by intranasal vaccination rather than intramuscular vaccination. When there are concerns about the administration of live attenuated virus vaccines via the intranasal route, subunit- or replication-deficient vector-based vaccines are expected to generate mucosal immunity in a safer way, especially considering the advances in formulation.

[0342] In summary, this example established the induction of both neutralizing antibodies and antigen-specific CD8+ T cell responses by immunization with ChAd-SARS-CoV-2-S. While a single intramuscular immunization with ChAd-SARS-CoV-2-S confers protection against SARS-CoV-2 infection and inflammation in the lung, intranasal delivery of ChAd-SARS-CoV-2-S induces mucosal immunity, provides superior protection, and may promote sterilizing immunity, at least in mice transiently expressing the hACE2 receptor. Thus, this example supports the use of intranasal delivery of ChAd-SARS-CoV-2-S as a platform for controlling SARS-CoV-2 infection, disease, and transmission.

[0343] Methods

[0344] Viruses and cells: Vero E6 (CRL-1586, American Type Culture Collection (ATCC)), Vero CCL81 (ATCC), and HEK293 cells were cultured at 37 °C in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 10 mM HEPES pH 7.3, 1 mM sodium pyruvate, 1× non-essential amino acids, and 100 U / ml penicillin-streptomycin.

[0345] The SARS-CoV-2 strain 2019n-CoV / USA_WA1 / 2020 was obtained from the Centers for Disease Control and Prevention, USA (gift from Natalie Thornburg). The virus was passaged once in Vero CCL81 cells and titrated by focus-forming assay (FFA) on Vero E6 cells. A full-length SARS-CoV-2 reporter virus expressing recombinant luciferase (2019n-CoV / USA_WA1 / 2020 strain) has been previously reported (Zost et al., 2020), and the D614G variant will be described elsewhere. All work with infectious SARS-CoV-2 was performed in BSL3 and A-BSL3 facilities approved by the Institutional Biosafety Committee of the US institutions using appropriate positive-pressure air respirators and protective equipment.

[0346] Mouse experiments: Animal studies were conducted in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Institutional Animal Care and Use Committee of the University of Washington School of Medicine (assurance number A3381-01). Viral inoculation was performed under anesthesia induced and maintained with ketamine hydrochloride and xylazine, and every effort was made to minimize animal suffering.

[0347] Female BALB / c mice were purchased from The Jackson Laboratory (catalog 000651). Animals four to five weeks of age were immunized with 10 10 viral particles (vp) of ChAdV-empty or ChAd-SARS-CoV-2-S in 50 μl PBS via intramuscular injection in the hind limb or via intranasal inoculation. Subgroups of immunized animals were boosted four weeks after the primary immunization using the same route as used for the primary immunization. One day prior to intranasal administration of 10 8 PFU of Hu-AdV5-hACE2, vaccinated mice (10 to 11 weeks of age) were given a single intraperitoneal injection of 2 mg anti-Ifnar1 mAb (MAR1-5A3, Leinco). Five days after Hu-AdV5 transduction, mice were inoculated with 4 × 10 5 FFU of SARS-CoV-2 via the intranasal route. Animals were euthanized at 4 or 8 dpi, and tissues were harvested for virological, immunological, and pathological analyses.

[0348] Construction of Chimpanzee Adenovirus Vectors: The simian Ad36 vector (ChAd) was obtained from the University of Pennsylvania Vector Core at the University of Pennsylvania. The ChAd genome was engineered by deletions in the E1 and E3B regions (GenBank: FJ025917.1; nucleotides 455 - 3026 and 30072 - 31869, respectively). The modified human cytomegalovirus major immediate early promoter sequence was incorporated in the complementary DNA strand in the counterclockwise direction to replace the E1 gene. The CMV modification included two tandem copies of the tet operator 2 (TetO2) sequence (5′-TCT CTA TCA CTG ATA GGG AGA TCT CTA TCA CTG ATA GG GA-3′) (SEQ ID NO:7) inserted between the TATA box and the mRNA start (GenBank: MN920393, nucleotides 174211 - 174212). The SARS-CoV-2 S (encoding a prefusion-stabilized mutant with two proline substitutions at residues K986 and V987, which stabilizes the prefusion form of S) was cloned into the unique PmeI site under the control of the CMV-tetO2 promoter in the pSAd36 genomic plasmid to generate pSAd36-S. Similarly, the mutant SAR-CoV-2 S proteins disclosed in SEQ ID NO:10, 11, 20, 21 were cloned. Meanwhile, pSAd36-control carrying an empty CMV-tetO2 cassette without a transgene was also generated. The pSAd36-S and pSAd-control plasmids were linearized with PacI restriction enzyme to release the viral genome for transfection into T-Rex 293-HEK cells (Invitrogen). The rescued replication-deficient ChAd-SARS-CoV-2-S and ChAd-control vectors were amplified in 293 cells and purified by CsCl density gradient ultracentrifugation. The viral particle concentration in each vector preparation was determined by spectrophotometry at 260 nm.

[0349] Construction of a human adenovirus vector expressing human ACE2: The codon-optimized hACE2 sequence was cloned into a shuttle vector (pShuttle-CMV, Addgene 240007) to generate pShuttle-hACE2. pShuttle-hACE2 was linearized with PmeI and subsequently co-transformed with the HuAdv5 backbone plasmid (pAdEasy-1 vector; Addgene 240005) into the Escherichia coli strain BJ5183 to generate pAdV5-ACE2 by homologous recombination. The pAdEasy-1 plasmid containing the HuAdV5 genome has deletions in the E1 and E3 genes. hACE2 is under the transcriptional control of the cytomegalovirus promoter and is flanked at its 3' end by the SV40 polyadenylation signal. pAd-hACE2 was linearized with the PacI restriction enzyme and then transfected into T-Rex 293HEK cells (Invitrogen) to generate HuAdv5-hACE2. Recombinant HuAdv5-hACE2 was produced in 293-HEK cells and purified by CsCl density gradient ultracentrifugation. The virus titer was determined by plaque assay in 293-HEK cells.

[0350] In situ RNA hybridization and histology: RNA in situ hybridization was performed using RNAscope 2.5HD (Brown) (Advanced Cell Diagnostics) according to the manufacturer's instructions. Left lung tissues were collected at autopsy, inflated with 10% neutral buffered formalin (NBF), and then immersed and fixed in 10% NBF for seven days before processing. Paraffin-embedded lung sections were deparaffinized by incubation at 60 °C for 1 hour and endogenous peroxidase was quenched with H2O2 for 10 minutes at room temperature. The slides were boiled in RNAscope target retrieval reagent for 15 minutes and incubated in RNAscope protease Plus reagent for 30 minutes, followed by hybridization with the SARS-CoV2 RNA probe (Advanced Cell Diagnostics 848561) and signal amplification. The sections were counterstained with Gill’s hematoxylin and visualized by bright-field microscopy. Some lung sections were processed for histology after hematoxylin and eosin staining.

[0351] SARS-CoV-2 neutralization assay: Heat-inactivated serum samples were serially diluted and mixed with 10 2The FFU of SARS-CoV-2 was incubated with [serum] at 37 °C for 1 h. The virus-serum mixture was added to the monolayer of Vero cells in a 96-well plate and incubated at 37 °C for 1 h. Subsequently, the cells were overlaid with 1% (w / v) methylcellulose in MEM supplemented with 2% FBS. The plates were incubated for 30 h and then fixed with 4% PFA in PBS for 1 h at room temperature. The cells were washed and then incubated sequentially with anti-SARS-CoV-2 CR3022 antibody (Yuan et al., 2020) (1 μg / mL) and HRP-conjugated goat anti-human IgG (Sigma) in PBS supplemented with 0.1% (w / v) saponin (Sigma) and 0.1% BSA. The plates were developed using TrueBlue peroxidase substrate (KPL) and then the foci were counted on a BioSpot analyzer (Cellular Technology Limited). For the neutralization assay with luciferase-expressing SARS-CoV-2, serum samples were serially diluted 3-fold starting at 1:50 and mixed with 85 PFU of each recombinant virus (wild-type and D614G). Vero E6 cells seeded in clear-bottom black-wall 96-well plates (Corning) were inoculated with the serum-virus mixture and the cells were cultured at 37 °C for 48 h. Subsequently, the cells were lysed and luciferase activity was measured using the Nano-Glo luciferase assay system (Promega) according to the manufacturer's instructions.

[0352] Hu-AdV5 neutralization assay: One day before Hu-AdV5-hACE2 transduction, serum samples were collected from mice immunized intramuscularly with ChAd-control or ChAd-SARS-CoV-2-S. The sera were heat-inactivated and serially diluted and then mixed with 10 2Incubate the HuAdV5 in FFU together at 37 °C for 1 hour. Add the virus-serum mixture to the monolayer of HEK293 cells in a 96-well plate and incubate at 37 °C for 1 hour. Then cover the cells with 1% (w / v) methylcellulose in MEM supplemented with 5% FBS. Incubate the plate at 37 °C for 48 hours and then fix with 2% PFA in PBS at room temperature for 1 hour. Subsequently, wash the plate with PBS and incubate overnight at 4 °C with biotinylated anti-HuAdV5-hexon antibody (2 μg / mL; Novus Biologicals NB600413) diluted in permeabilization buffer (PBS supplemented with 0.1% (w / v) saponin and 0.1% BSA). Wash the plate again and incubate at room temperature for 30 minutes with streptavidin-HRP (1:3000; Vector Laboratories SA-5004) in permeabilization buffer. After the last wash series, develop the plate using TrueBlue peroxidase substrate (KPL) and count the foci on a BioSpot analyzer (Cellular Technology Limited).

[0353] Protein expression and purification: Reverse transcribe the purified RNA from the 2019-nCoV / USA-WA1 / 2020 SARS-CoV-2 strain into cDNA and use it as a template for recombinant gene cloning. Clone the full-length SARS-CoV-2 NP (NP-FL) into pET21a with a hexahistidine tag and perform recombinant expression using BL21(DE3)-RIL Escherichia coli in Terrific Broth (bioWORLD). After induction overnight with isopropyl β-D-1-thiogalactopyranoside (Goldbio) at 25 °C, lyse the cells in 20 mM Tris-HCl pH 8.5, 1 M NaCl, 5 mM β-mercaptoethanol and 5 mM imidazole for nickel affinity purification. After elution in the previous buffer supplemented with 500 mM imidazole, purify the protein to homogeneity using size exclusion chromatography and, in some cases, cation exchange chromatography. Clone the SARS-CoV-2 RBD and S extracellular domain (disrupting the S1 / S2 furin cleavage site, introducing double proline mutations into the S2 subunit and incorporating a folded trimerization motif) into pFM1.2 with a C-terminal hexahistidine or octahistidine tag, transiently transfect into Expi293F cells and purify by cobalt resin chromatography (G-Biosciences) as previously described (Alsoussi et al., 2020).

[0354] ELISA: Purify the antigen (S, RBD or NP) and coat it at 2 μg / mL (70 μL) in 50 mM Na2CO3 pH 9.6 onto a 96-well Maxisorp transparent plate at 4 °C overnight. Aspirate the coating buffer and block the wells with 200 μL of 1×PBS + 0.05% Tween-20 + 1% BSA + 0.02% NaN3 (blocking buffer, PBSTBA) at 37 °C for 1 hour or at 4 °C overnight. Dilute the heat-inactivated serum samples in PBSTBA in a separate 96-well polypropylene plate. Then wash the plate three times with 1×PBS + 0.05% Tween-20 (PBST), and then add 50 μL of the corresponding serum dilution. Incubate the serum in the blocked ELISA plate at room temperature for at least 1 hour. Wash the ELISA plate three times again in PBST, and then add 50 μL of 1:2000 anti-mouse IgG-HRP (Southern Biotech catalog number 1030-05) in PBST or 1:10000 biotinylated anti-mouse IgG, anti-mouse IgM or anti-mouse IgA (Southern Biotech) in PBST. Incubate the plate at room temperature for 1 hour, wash it three times in PBST, and then add a 1:5000 dilution of streptavidin-HRP (ThermoFisher) to the wells. After incubating at room temperature for 1 hour, wash the plate three times with PBST and add 50 μL of 1-Step Ultra TMB-ELISA (ThermoFisher catalog number 34028). After incubation for 12 to 15 minutes, terminate the reaction with 50 μL of 2 M sulfuric acid. Read the absorbance of each well at 450 nm (Synergy H1) within 2 minutes of adding the sulfuric acid. Determine the optical density (450 nm) measurement using a microplate reader (Bio-Rad).

[0355] ELISpot assay: The 96-well MultiScreen-HA filter plate (Millipore) was pre-coated overnight at 4 °C with 3 μg / ml of SARS-CoV-2 S protein. After rinsing with PBST, the plate was blocked with medium (RPMI, 10% FBS, penicillin-streptomycin, 1 mM sodium pyruvate, 0.1 mM non-essential amino acids, 10 mM HEPES, and 50 mM β-mercaptoethanol) at 37 °C for 4 hours. A single-cell suspension of splenocytes in medium was added to the S protein-coated plate and incubated at 37 °C and 5% humidified CO2 for 4 hours. After washing with PBS and PBST, the plate was incubated with biotinylated anti-IgG or anti-IgA (Southern Biotech), followed by incubation with streptavidin-conjugated horseradish peroxidase (Jackson ImmunoResearch), each for 1 hour at room temperature. After washing again with PBS, 3-amino-9-ethylcarbazole (Sigma) substrate solution was added for spot development. The reaction was terminated by rinsing with water. Spots were counted using a Biospot reader (Cellular Technology).

[0356] Viral load measurement: SARS-CoV-2-infected mice were euthanized using a mixture of ketamine and xylazine, and organs were collected. Tissues were weighed and homogenized using a MAgNA Lyser (Roche) with beads in 1 ml of Dulbecco's Modified Eagle Medium (DMEM) containing 2% fetal bovine serum (FBS). RNA was extracted from the clarified tissue homogenate using the MagMax mirVana Total RNA Isolation Kit (Thermo Scientific) and the Kingfisher duo prime extractor (Thermo Scientific). SARS-CoV-2 RNA levels were measured by one-step quantitative reverse transcriptase PCR (qRT-PCR) TaqMan assay as previously described (Hassan et al., 2020). A SARS-CoV-2 nucleocapsid (N)-specific primer and probe set was used: (L primer: ATGCTGCAATCGTGCTACAA (SEQ ID NO:8); R primer: GACTGCCGCCTCTGCTC (SEQ ID NO:9). Viral RNA was expressed as the number of (N) gene copies per milligram on a log10 scale. For some samples, virus titers were determined by plaque assay on Vero E6 cells. Cytokine and chemokine mRNA measurement. RNA extracted from lung homogenates was DNase-treated and used to synthesize cDNA using the High-Capacity cDNA Reverse Transcription Kit (Thermo Scientific), with RNase inhibitor added according to the manufacturer's protocol. Cytokine and chemokine expression was determined using the TaqMan Fast Universal PCR master mix (Thermo Scientific) and commercially available primer / probe sets specific for IFN-γ (IDT: Mm.PT.58.41769240), IL-6 (Mm.PT.58.10005566), IL-1β (Mm.PT.58.41616450), TNF-α (Mm.PT.58.12575861), CXCL10 (Mm.PT.58.43575827), CCL2 (Mm.PT.58.42151692), CCL5 (Mm.PT.58.43548565), CXCL11 (Mm.PT.58.10773148.g), IFN-γ (Mm.PT.58.30132453.g), and IFNγ-2 / 3 (Thermo Scientific Mm04204156_gH), and the results were normalized relative to GAPDH (Mm.PT.39a.1) levels. Treated mice were compared to untreated controls, and fold changes were determined using 2 -ΔΔCt . Methods to determine fold change.

[0357] Peptide restimulation and intracellular cytokine staining: Spleen cells from intramuscularly vaccinated mice were incubated with 253 overlapping 15-mer SARS-CoV-2 S peptide pools in culture at 37 °C for 12 h and then treated with brefeldin A (BioLegend, 420601) for 4 h. After blocking with FcγR antibody (BioLegend, clone 93), the cells were stained on ice with CD45 BUV395 (BD BioSciences clone 30-F11); CD44 PE-Cy7, CD4 PE-Cy5, CD8b PreCP-Cy5.5 and CD19 APC-Cy7 (BioLegend clones, IM7, GK1.5, YTS156.7.7 and 6D5, respectively) and a fixable viability dye Aqua (Invitrogen, L34966). The stained cells were fixed and permeabilized using the Foxp3 / Transcription Factor Staining Buffer Set (eBiosciences, 00-5523). Subsequently, intracellular staining was performed with anti-IFN-γ Alexa647 (BD Biosciences, clone XMG1.2), anti-TNFα BV605 (BioLegend, clone MP6-XT22) and anti-GrB PE (Invitrogen, GRB04). Lungs were harvested from intranasally immunized mice and digested for 1 h at 37 °C in a digestion buffer consisting of RPMI medium supplemented with Liberase DH (Sigma, 167 μg / ml) and DNase I (Sigma, 100 μg / ml). Lung cells were incubated with the above 253 overlapping 15-mer SARS-CoV-2 S peptide pools in the presence of brefeldin A at 37 °C for 5 h. The lung cells were then stained as described above, except that CD4-BV421 (BioLegend clone GK1.5) was used instead of CD4-PE-Cy5, CD19 staining was excluded, and CD103-FITC and CD69-BV711 (BioLegend clones, 2E7 and H1.2F3, respectively) were added. Analysis was performed on a BD LSRFortessa X-20 cell cytometer using FlowJo X 10.0 software.

[0358] Flow cytometry-based antigen characterization: HEK-293T cells were seeded at 10 6Cells were seeded at [[[number]]] cells / well in 6-well plates. After 20 hours, cells were harvested, fixed and permeabilized using the Foxp3 transcription factor staining buffer set (Thermo Fisher), and stained for viral antigen after incubation with the following anti-SARS-CoV-2 neutralizing murine mAbs: SARS2-01, SARS2-02, SARS2-07, SARS2-11, SARS2-12, SARS2-16, SARS2-18, SARS2-20, SARS2-21, SARS2-22, SARS2-23, SARS2-29, SARS2-31, SARS2-32, SARS2-34, SARS2-38, SARS2-39, SARS2-50, SARS2-55, SARS2-58, SARS2-66, and SARS2-71 (L. Van Blargan and M. Diamond, unpublished results). H77.39, an isotype-matched anti-HCV E2 mAb, was used as a negative control. Cells were washed, incubated with Alexa Fluor 647-conjugated goat anti-mouse IgG (Thermo Fisher), and analyzed by flow cytometry using a MACSQuant Analyzer 10 (Miltenyi Biotec). The percentage of cells positive for a given mAb was compared to cells stained with an oligoclonal mixture of anti-SARS-CoV-2 mAbs at saturating amounts.

[0359] Example 2 : Intranasal vaccine confers durable protection against SARS-CoV-2 variants in mice

[0360] SARS-CoV-2 variants that attenuate antibody neutralization can jeopardize vaccine efficacy and the end of the COVID-19 pandemic. Example 1 shows the protective activity in animals of a chimpanzee adenovirus vector vaccine based on the spike protein (ChAd-SARS-CoV-2-S) administered intranasally as a single dose, which has advanced to human trials. This example provides persistence, dose response, and cross-protective activity in mice. A single intranasal dose of ChAd-SARS-CoV-2-S induces a persistent, high neutralizing Fc effector antibody response in serum and long-lived plasma cells secreting S-specific IgG and IgA in the bone marrow. Protection against historical SARS-CoV-2 strains was observed over a 100-fold vaccine dose range and a period of 200 days. Six weeks or nine months after vaccination, serum antibodies neutralized SARS-CoV-2 strains with B.1.351 and B.1.1.28 spike proteins and conferred nearly complete protection in the upper and lower respiratory tracts upon challenge. Thus, in mice, intranasal immunization with ChAd-SARS-CoV-2-S provides durable protection against historical and emerging SARS-CoV-2 strains.

[0361] The spike (S) protein of the SARS-CoV-2 virion is the primary target for antibody and vaccine countermeasures. The S protein serves as the major viral attachment and entry factor and engages the cell surface receptor angiotensin-converting enzyme 2 (ACE2) to facilitate SARS-CoV-2 entry into human cells. The SARS-CoV-2 S protein is cleaved to generate S1 and S2 fragments, where the S1 protein contains the receptor-binding domain (RBD), and the S2 protein promotes membrane fusion and viral penetration into the cytoplasm. The prefusion form of the SARS-CoV-2 S protein is recognized by potent neutralizing monoclonal antibodies or protein inhibitors.

[0362] Many vaccine candidates targeting the SARS-CoV-2 S protein have been developed using DNA plasmid, lipid nanoparticle-encapsulated mRNA, inactivated virion, protein subunit, or viral vector vaccine platforms. Several vaccines administered by intramuscular (IM) injection (e.g., Pfizer / BioNTech BNT162b2 and Moderna 1273 mRNA and Johnson & Johnson Ad26.COV2 and AstraZeneca ChAdOx1 nCoV-19 adenovirus platforms) have received emergency use authorization in many countries and have provided hundreds of millions of doses globally (covid19.who.int).

[0363] Although vaccination via intramuscular (IM) injection induces robust systemic immunity that protects against severe disease and death, there remain questions about their ability to limit SARS-CoV-2 transmission, particularly in the absence of a reduction in upper respiratory tract infections. In fact, many IM-administered vaccines have shown variable protection against upper airway infections and transmission in preclinical studies and have failed to induce substantial mucosal (IgA) immunity. This issue is important because more transmissible SARS-CoV-2 variants with substitutions in the spike protein have emerged, including B.1.1.7, B.1.351, and B.1.1.28. Experiments with pseudoviruses and authentic SARS-CoV-2 strains have also shown that vaccine-induced sera have reduced neutralization against variants with mutations at positions L452, E484, and other positions in the spike gene. In addition to the possible negative impact on protection, the combination of reduced immunity to certain variants and naturally lower levels of anti-S IgG in the respiratory mucosa could create conditions for further selection of resistance in the upper airway and transmission to the general population.

[0364] As described herein, a single-dose, intranasal (IN)-delivered SARS-CoV-2 vaccine (ChAd-SARS-CoV-2-S) based on chimpanzee adenovirus (simian Ad-36) encoding a prefusion-stabilized S protein induces robust humoral, cell-mediated, and mucosal immune responses and limits upper and lower airway infections in K18-hACE2 transgenic mice, hamsters, and nonhuman primates. This vaccine, which has been advanced to human clinical trials (BBV154, ClinicalTrials.gov identifier NCT04751682), is different from ChAdOx1 nCoV-19, a SARS-CoV-2 vaccine based on chimpanzee Ad-23 that is currently authorized for emergency use in some countries. Here, as a further step to evaluate the potential utility of ChAd-SARS-CoV-2-S, its dose response, persistence, and cross-protective activity, including effects on upper and lower airway infections, were evaluated in mice. Approximately 9 months after IN immunization, neutralizing antibody and anti-S protein IgA levels in the sera of ChAd-SARS-CoV-2-S-vaccinated animals remained high and inhibited infection with SARS-CoV-2 strains bearing the B.1.351 and B.1.1.28 spike proteins. At this time, susceptible K18-hACE2 transgenic mice were completely protected from upper and lower respiratory tract infections after challenge with SARS-CoV-2 virus bearing the B.1.351 spike protein.

[0365] Results

[0366] Single-dose ChAd-SARS-CoV-2-S immunization induces durable anti-spike and neutralizing responses at different doses: The dose response of ChAd-SARS-CoV-2-S was evaluated using increasing doses (108 , 10 9 and 10 10 virus particles [vp]) or 10 10 days post-IM or IN immunization with ChAd-control vaccine at 100 or 200 days after immunization with 10 Figure 10A ). First, anti-S and anti-RBD IgG and IgA levels were measured by ELISA. Consistent with previous results at the one-month time point 30, at 100 or 200 days post-vaccination, IN immunization with ChAd-SARS-CoV-2-S induced superior antibody responses compared to IM immunization or vaccination with ChAd-control vaccine( Figure 10B - 10M and Fig. 11). At 100 or 200 days, serum anti-S and anti-RBD specific binding IgG levels were higher after IN immunization than after IM immunization. After IN immunization with 10 10 , 10 9 and 10 8 vp of ChAd-SARS-CoV-2-S at 100 days, the geometric mean titers (GMTs) of the S-specific IgG responses were 1.1×10 6 , 4.8×10 5 and 2.6×10 5 , respectively, and those of RBD-specific IgG were 3.2×10 5 , 1.8×10 5 and 8.7×10 4 ( Figure 10B ). In contrast, at 100 days after IM immunization with 10 10 , 10 9 and 10 8 vp of ChAd-SARS-CoV-2-S, the S-specific and RBD-specific IgG responses were 1 / 4 to 1 / 6 (P<0.0001), with S-specific IgG titers of 2.1×10 5 , 1.1×10 5 and 4.5×10 4 , respectively, and RBD-specific IgG titers of 5.1×10 4 , 2.9×10 4 and 2.3×10 4 ( Figure 10E ). At 200 days post-IN or IM immunization, similar dose responses for S-specific and RBD-specific IgG titers were observed( Figure 10H and Figure 10K ). After IN immunization with 10 10 , 10 9 and 10 8Twenty days after IN immunization with ChAd-SARS-CoV-2-S at 10 vp, the GMTs of S-specific IgG were 2.8×10 6 , 2.4×10 6 and 1.2×10 6 , and the GMTs of RBD-specific IgG were 1.1×10 6 , 6.1×10 5 and 3.2×105( Figure 10H ). Twenty days after IM immunization with ChAd-SARS-CoV-2-S at 10 10 , 10 9 and 10 8 vp, the GMTs of S-specific IgG were 8.1×10 5 , 6.9×10 5 and 2.6×10 5 , and the GMTs of RBD-specific IgG were 1.4×10 5 , 1.3×10 5 and 8.0×10 4 ( Figure 10K ). Thus, anti-S and anti-RBD IgG levels were higher after IN immunization than after IM immunization and continued to increase in serum even months after single-dose vaccination.

[0367] Next, we evaluated the induction and persistence of the serum IgA response. Although IM immunization failed to induce S-specific or RBD-specific IgA( Figure 1F and L), comparable levels of anti-S and RBD IgA were detected after IN immunization at 100 or 200 days post-immunization( Figure 1C and I). One hundred days after IM immunization with ChAd-SARS-CoV-2-S at 10 10 , 10 9 and 10 8 vp, the GMTs of S-specific IgA were 4.8×10 3 , 1.2×10 3 and 8.4×10 2 , and the GMTs of RBD-specific IgA were 2.2×10 3 , 4.6×10 2 and 2.9×10 2 ( Figure 1C ). As observed for IgG, IgA levels continued to increase over time, such that at 200 days after IM immunization with ChAd-SARS-CoV-2-S at 10 10 , 10 9 and 10 8After IN immunization with ChAd-SARS-CoV-2-S of vp, the GMT of S-specific IgA at 200 days was 1.1×10 4 , 7.4×10 3 and 5.4×10 3 , and the GMT of RBD-specific IgA was 5.2×10 3 , 3.8×10 3 and 9.8×10 2 (Figure 1I).

[0368] Next, the neutralizing activity was determined by using focus reduction neutralization test (FRNT)( Figure 10D , Figure 10G , Figure 10J , Figure 10M and Figure 11) to evaluate the functional relevance of the serological response. As expected, no neutralizing activity was detected in the sera from mice treated with ChAd control. At 100 days after IN immunization with 10 10 , 10 9 and 10 8 vp of ChAd-SARS-CoV-2-S, the mean effective half-maximal inhibitory titre [EC50] was 39,449, 9,989 and 7,270( Figure 10D ). In contrast, at this time point after IM immunization with 10 10 , 10 9 and 10 8 vp of ChAd-SARS-CoV-2-S, the EC50 values were 1 / 20 to 1 / 8 (P<0.0001), being 4,988, 2,017 and 391( Figure 10G ). At 200 days after IN immunization with 10 10 , 10 9 and 10 8 vp of ChAd-SARS-CoV-2-S, and consistent with the higher anti-S and RBD titres observed, the EC50 values were 45,591, 22,769 and 23,433( Figure 10J ). In contrast, at 200 days after IM immunization with 10 10 , 10 9 and 10 8 vp of ChAd-SARS-CoV-2-S, the EC50 values were much lower, being 2,524, 940 and 716( Figure 10M ).

[0369] Long-lived plasma cells (LLPC) reside in the bone marrow and continuously secrete high levels of antibodies related to serum levels. To evaluate the use of 10 10Levels of antigen - specific LLPCs at 200 days after IM or IN immunization with ChAd - SARS - CoV - 2 - S were determined by isolating CD138+ cells from the bone marrow and using an ELISPOT assay to measure the production of S - specific IgG or IgA. The frequency of LLPCs secreting S - specific IgG after IN immunization was approximately 4 - fold that of IM immunization ( Figure 10N ). Additionally, after IN immunization, a higher number of LLPCs producing S - specific IgA were detected, which were not present after IM immunization ( Figure 10N ). Collectively, these data establish the following: (a) single - dose immunization promotes superior humoral immunity compared to IM immunization; (b) a 1 / 100 vaccination dose of ChAd - SARS - CoV - 2 - S induces a robust neutralizing antibody response in mice; (c) IN rather than IM immunization induces serum IgA responses and IgA - specific LLPCs against the SARS - CoV - 2 S protein; and (d) the humoral immunity induced by ChAd - SARS - CoV - 2 - S is persistent and increases over a six - month period after vaccination.

[0370] IN vaccination with ChAd - SARS - CoV - 2 - S induces a broad antibody response with Fc effector function capacity: To further characterize the humoral response, at 90 days after IN or IM vaccination, sera from BALB / c mice were used to analyze antibody binding to SARS - CoV - 2 variant proteins and Fc effector function. Our SARS - CoV - 2 proteome included spike (D614G, E484K, N501Y, Δ69 - 70, K417N) and RBD (E484K) antigens corresponding to the WA1 / 2020, B.1.1.7, B.1.351, B.1.1.28 strains. First, the anti - SARS - CoV - 2 - specific antibody responses of several isotypes (IgG1, IgG2a, IgG2b, IgG3, IgM, and IgA) and their ability to bind Fcγ receptors (mouse FcγRIIB, FcγRIII, FcγRIV) were measured using a luminex platform. Consistent with the data obtained by ELISA ( Figure 10B and Figure 10E ), IN vaccination with ChAd - SARS - CoV - 2 - S induced higher levels of IgG1 against the D614G spike and WA1 / 2020 RBD proteins compared to IM immunization, and as expected, lower doses of the vaccine resulted in lower antibody titers ( Figure 12A ). Anti - SARS - CoV - 2 IgG1 titers against all spike and RBD variants were also higher after IN immunization compared to after IM immunization, and the titers decreased with the vaccine dose ( Figure 12B)。As shown in the heatmap, this trend was observed for all anti-SARS-CoV-2 specific antibody isotypes and was associated with the FcγR binding pattern ( Figure 12C )。These data indicate that IN vaccination induces a higher magnitude and broader antibody subclass response against SARS-CoV-2 than IM vaccination.

[0371] Antibody effector functions such as opsonization are mediated in part by Fcγ receptor engagement. To determine whether the observed differences in antibody titers and FcγR binding titers result in differences in effector function, antibody-dependent neutrophil phagocytosis (ADNP) and antibody-dependent cell phagocytosis (ADCP) assays were performed ( Figure 12D - 12E )。Serum from IN-vaccinated mice stimulated significantly more ADNP than those obtained from IM-vaccinated mice. However, a minimal difference in ADCP of antibodies obtained after IN and IM vaccination was evident ( Figure 12D - 12E )。These data indicate that IN vaccination with ChAd-SARS-CoV-2-S induces a greater and more functional antibody response than IM vaccination.

[0372] Intranasal administration of ChAd-SARS-CoV-2-S induces durable protection against SARS-CoV-2 challenge in BALB / c mice: To evaluate the efficacy of the ChAd-SARS-CoV-2-S vaccine, BALB / c mice immunized with the dosing regimen described in Figure 10A were challenged with SARS-CoV-2. Hu-Ad5-hACE2 enabling ectopic expression of hACE2 was introduced intranasally and viral challenge was performed in BALB / c mice prior to SARS-CoV-2 infection generated by a historical SARS-CoV-2 strain. Animals were immunized once via the IN or IM route with 10 10 vp of ChAd-control or 10 10 , 10 9 and 10 8 vp of ChAd-SARS-CoV-2-S. On day 95 or day 195 post-vaccination, mice were given 10 8 plaque-forming units (PFU) of Hu-Ad5-hACE2 and anti-Ifnar1 mAb; the latter attenuates innate immunity and enhances pathogenesis in this model. Five days later, 5×10 4SARS-CoV-2 (strain WA1 / 2020) in focus-forming units (FFUs) was instilled into BALB / c mice via the IN route. Four days post-infection (dpi), lungs, spleens, and hearts were harvested from mice challenged 100 days after immunization, and lungs, turbinates, and nasal washes were collected from a second cohort challenged 200 days after immunization. Viral loads in tissues were assessed by quantitative reverse transcription PCR (qRT-PCR) using primers for subgenomic RNA (N gene). Compared to animals receiving the ChAd-control vaccine, all three doses of IN-vaccination induced significant protection 100 days post-vaccination, as evidenced by little viral RNA in the lungs, spleens, and hearts ( Figure 13A - 13C ). At 200 days post-immunization, the protection conferred by ChAd-SARS-CoV-2-S delivered via IN remained robust in the upper and lower respiratory tracts compared to ChAd-control-immunized mice. Nevertheless, limited infection breakthrough was observed in the lungs and turbinates of animals immunized with the lowest 10 8 vp dose of ChAd-SARS-CoV-2-S ( Figure 13G and Figure 13I ). In contrast, protection at 100 days post-IM immunization was lower than that post-IN immunization at the same challenge time point. Although viral RNA was not detected in the hearts and spleens ( Figure 13E - 13F ), levels at least 1,000- to 30,000-fold higher (P < 0.0001) were measured in the lungs of mice immunized with ChAd-SARS-CoV-2-S via IM compared to the IN route ( Figure 13A and Figure 13D ). A greater effect was also observed with administration via the IM route, as the reduction in viral RNA load in the lungs at the 10 8 vp dose was no longer different compared to ChAd-control-vaccinated mice ( Figure 13D ). At 200 days post-IM immunization, protection against SARS-CoV-2 infection was lower in the lungs, nasal washes, and turbinates compared to post-IN immunization ( Figure 13G - 13L ).

[0373] ChAd-SARS-CoV-2-S induces durable immunity in hACE2 transgenic mice: Next, the immunogenicity of intranasally delivered ChAd-SARS-CoV-2-S was evaluated in K18-hACE2 C57BL / 6 mice, which are more susceptible to SARS-CoV-2 infection than BALB / c mice. At 10 9Five-week-old K18-hACE2 mice were inoculated via the intranasal (IN) route with ChAd-control or ChAd-SARS-CoV-2-S of vp. Serum samples were collected six weeks later and the humoral immune response was evaluated. IN immunization with ChAd-SARS-CoV-2-S but not ChAd-control induced high levels of S-specific and RBD-specific IgG and IgA( Figure 14A - 14B ). Neutralizing antibody titers against SARS-CoV-2 strains WA1 / 2020 and two additional SARS-CoV-2 strains with spike proteins from the B.1.351 and B.1.1.28 variants were measured by FRNT assay( Figure 14C - 14D and Figure 16). High levels of neutralizing antibodies against WA1 / 2020 (EC50 of 9,591) were induced after a single IN dose of ChAd-SARS-CoV-2-S. As observed with vaccine-induced human sera, a decrease in neutralizing titers was observed against the Wash-B.1.351 (approx. 1 / 5, P<0.0001; Figure 14C ) and Wash-B.1.1.28 (approx. 1 / 3, P<0.0001; Figure 4D) SARS-CoV-2 strains compared to WA1 / 2020. To evaluate the persistence of the humoral response, separate groups of K18-hACE2 mice were immunized via the IN route and serum samples were collected at nine months. At this time point, ChAd-SARS-CoV-2-S induced high levels of S-specific and RBD-specific IgG and IgA as well as neutralizing antibodies against WA1 / 2020 (EC50 of 12,550)( Figure 14E - 14H and Figure 16). A decrease in neutralizing titers was also observed when tested against the Wash-B.1.351 and Wash-B.1.1.28 viruses compared to WA1 / 2020 (approx. 1 / 8 to 1 / 6, P<0.05; Figure 14G - 14H ), although they remained relatively high (EC50s of 1,627 and 1,918, respectively).

[0374] ChAd-SARS-CoV-2-S confers cross-protection against challenges with Wash B.1.351 and Wash-B.1.1.28 in hACE2 transgenic mice: The protective efficacy of ChAd-SARS-CoV-2-S against WA1 / 2020 and two chimeric viruses (Wash-B.1.351 and Wash-B.1.1.28) with spike genes corresponding to important variants was tested( Figure 15A ). Five-week-old K18-hACE2 mice were immunized via the IN route with a single 10 9 vp dose of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks later, 10 4Mice were challenged with FFU of Wash-B.1.351, Wash B.1.1.28, or WA1 / 2020 via the IN route. All mice immunized with ChAd-SARS-CoV-2 showed no weight loss, whereas most ChAd-control vaccinated mice experienced significant weight loss at 3 to 6 dpi ( Figure 15B , Figure 15G and Figure 15L Notably, vaccination with ChAd-SARS-CoV-2-S resulted in virtually no detectable SARS-CoV-2 RNA in the upper and lower respiratory tracts, heart, and brain at 6 dpi ( Figure 15C - 15F , Figure 15H - 15K and Figure 15M - 15O As a further test of the durability of the cross-protective response, a single 10 10 Five-week-old K18-hACE2 mice were immunized with 10 vp doses of ChAd-control or ChAd-SARS-CoV-2-S via IN route. 4 Mice were challenged with FFU of Wash-B.1.351 via the IN route. In contrast to ChAd-control treated mice, ChAd-SARS-CoV-2-S vaccinated mice maintained body weight ( Figure 15P In addition, significant virological protection was observed, as only very low amounts of Wash-B.1.351 SARS-CoV-2 RNA were detected in the upper and lower respiratory tracts, heart, and brain of some mice ( Figure 15Q - 15T ).

[0375] discuss

[0376] The persistence of vaccine-induced immune responses is key to providing sustained protection against SARS-CoV-2 infection and curbing the current pandemic. Here, it is shown that a single intranasal (IN) immunization with ChAd-SARS-CoV-2-S induces S-specific and RBD-specific binding and neutralizing antibodies that rise continuously for several months, indicating the presence of a persistent germinal center response. Long-lived plasma cells (LLPCs) were detected in the bone marrow six months after IN vaccination, and they secrete SARS-CoV-2-specific IgG and IgA, which may contribute to the persistent high antiviral antibody levels in circulation. In contrast, intramuscular (IM) immunization with ChAd-SARS-CoV-2-S induces lower levels of serum neutralizing antibodies, fewer LLPCs secreting spike-specific IgG, and little or no serum or cellular IgA response. At least in mice, a single IN dose of ChAd-SARS-CoV-2-S generates persistent humoral immunity, which was observed across a 100-fold dose range. These preclinical immunogenicity results are comparable to those of studies of mRNA vaccines against SARS-CoV-2 in humans, which showed humoral immune responses lasting for at least several months. In contrast, the persistence of antibody responses after natural SARS-CoV-2 infection can vary considerably.

[0377] At multiple time points within six months, a single immunization with ChAd-SARS-CoV-2-S confers durable protection against challenge with SARS-CoV-2 (WA1 / 2020 strain) in hACE2-transduced BALB / c mice or K18-hACE2 transgenic C57BL / 6 mice. Notably, IN immunization provides nearly complete virological protection against upper and lower respiratory tract infections, with limited breakthrough infections observed only at 1 / 100 of the vaccine dose. The elimination of infection in the upper respiratory tract suggests that IN vaccination can prevent transmission. In contrast, IM immunization reduces viral RNA levels in the lungs but shows significantly less protection against the homologous WA1 / 2020 strain in upper respiratory tract samples. Although many SARS-CoV-2 vaccine candidates from different platforms have shown immunogenicity and protective efficacy in animal models, to our knowledge, there is no vaccine candidate with established persistence or protection against variant viruses. The long-term protection conferred by IN immunization (even at 1 / 100 of the vaccination dose) is promising. If the mouse results are replicated, dose-sparing strategies could enable the production of large numbers of vaccine doses that can reduce SARS-CoV-2 infection and transmission.

[0378] The emergence of SARS-CoV-2 S variants (e.g., B.1.351 and B.1.1.28) with amino acid mutations in the receptor-binding motif is of concern because they are resistant to the inhibitory activity of many neutralizing antibodies. Indeed, human sera from subjects vaccinated with the BNT162b2 mRNA or ChAdOx1 nCoV-19 (AZD1222) vaccine showed reduced neutralization against B.1.351. Of concern, IM administration of ChAdOx1 nCoV-19 (AZD1222) showed reduced protective efficacy against mild to moderate B.1.351 infection in humans. In K18-hACE2 transgenic mice, reduced neutralization (1 / 8 to 1 / 3) of variant viruses was also observed when we compared the immunogenicity of IN-delivered ChAd-SARS-CoV-2-S against WA1 / 2020 and chimeric SARS-CoV-2 strains expressing the B.1.1.28 or B.1.351 spike protein, although titers remained >1,000. Six weeks after IN immunization with ChAd-SARS-CoV-2-S, K18-hACE2 mice were fully protected against weight loss and infection with WA1 / 2020, Wash-B.1.351, and Wash-B.1.1.28 in the upper and lower respiratory tracts and the brain. Notably, in a separate cohort of K18-hACE2 mice challenged nine months after a single IN immunization, the animals were fully protected against challenge with Wash-B.1.351. Although the correlates of protection for SARS-CoV-2 vaccines have not been fully established, high levels of cross-neutralizing antibodies against variant viruses, combined with robust virus-specific systemic and mucosal CD8+ T cell responses, may contribute to protection. In addition to this, antibody effector functions may also contribute to the prevention of SARS-CoV-2 infection and disease. Indeed, enhanced Fc effector functions against SARS-CoV-2 variant proteins, including robust induction of ADNP and ADCP responses, were observed in sera derived from IN-delivered ChAd-SARS-CoV-2-S.

[0379] In summary, this example shows that IN immunization with ChAd-SARS-CoV-2-S induces robust and long-lasting binding IgG and IgA antibodies, neutralizing antibodies, Fc effector functions, and LLPC responses against SARS-CoV-2. In mice, single IN immunization with ChAd-SARS-CoV-2-S confers cross-protection against SARS-CoV-2 strains presenting spike proteins corresponding to the B.1.351 and B.1.1.28 variants, even nine months after vaccination. Given the potency of preclinical evaluations in multiple animal models 30, 31, 32 and the durable protective immunity against important variants, IN delivery of ChAd-SARS-CoV-2-S is a promising platform for preventing SARS-CoV-2 infection and reducing transmission.

[0380] Methods

[0381] Viruses and cells: Vero E6 (CRL-1586, American Type Culture Collection (ATCC)), Vero-TMPRSS2 57, Vero (CCL-81, ATCC), and HEK293 (CRL-1573, ATCC) cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 10 mM HEPES pH 7.3, 1 mM sodium pyruvate, 1× non-essential amino acids, and 100 U / ml penicillin-streptomycin at 37 °C. Vero-TMPRSS2 cells were also supplemented with 5 μg / mL blasticidin.

[0382] The SARS-CoV-2 strain 2019n-CoV / USA_WA1 / 2020 (WA1 / 2020) was obtained from the Centers for Disease Control and Prevention. The virus was passaged once in Vero CCL-81 cells and titrated by plaque-forming assay (FFA) on Vero E6 cells. The Wash-B.1.351 and Wash-B.1.1.28 chimeric viruses with variant spike genes have been previously described 28, 58. All viruses were passaged once in Vero-TMPRSS2 cells and next-generation sequencing was performed to confirm the introduction and stability of substitutions. All virus experiments were conducted in an approved Biosafety Level 3 (BSL-3) facility.

[0383] Mouse experiments: Animal studies were conducted in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Institutional Animal Care and Use Committee of the University of Washington School of Medicine (assurance number A3381-01). Virus inoculation was performed under anesthesia induced and maintained with ketamine hydrochloride and xylazine, and every effort was made to minimize animal suffering.

[0384] Female BALB / c (Catalog 000651) and K18-hACE2 C57BL / 6 (Catalog 034860) mice were purchased from The Jackson Laboratory. Animals four to five weeks of age were immunized IM (hind limb) or IN with 10 10 vp of ChAdV-Control or 10 8 、10 9 or 10 10 vp of ChAd-SARS-CoV-2-S. One day prior to IN administration of 10 8 PFU pair of Hu-Ad5-hACE2, vaccinated BALB / c mice (10 to 11 weeks of age) were given a single intraperitoneal injection of 2 mg anti-Ifnar1 mAb (MAR1-5A3 59 (Leinco)). Five days after Hu-Ad5-hACE2 transduction, mice were inoculated via the IN route with 4 × 10 5 FFU of WA1 / 2020 SARS-CoV-2. K18-hACE2 mice were challenged at the indicated days after immunization via the IN route with 10 4 FFU of SARS-CoV-2 (WA1 / 2020, Wash-B.1.351, or Wash-B.1.1.28). Animals were euthanized at 6 dpi, and tissues were harvested for virological analysis.

[0385] Chimpanzee and human adenovirus vectors: The ChAd-SARS-CoV-2 and ChAd-Control vaccine vectors are derived from the simian Ad36 backbone 60, and the construction and validation have been described herein. The rescued replication-defective ChAd-SARS-CoV-2-S and ChAd-Control vectors were amplified in HEK293 cells and purified by CsCl density gradient ultracentrifugation. The viral particle concentration in each vector preparation was determined by spectrophotometry at 260 nm. The Hu-AdV5-hACE2 vector was also generated as described above and in HEK293 cells. The virus titer was determined by plaque assay in HEK293 cells.

[0386] SARS-CoV-2 neutralization in women: Heat-inactivated serum samples were serially diluted and combined with 10 2FFU of different SARS-CoV-2 strains were incubated together at 37 °C for 1 hour. The virus-serum mixture was added to the monolayer of Vero cells in a 96-well plate and incubated at 37 °C for 1 hour. Subsequently, the cells were overlaid with 1% (w / v) methylcellulose in MEM supplemented with 2% FBS. The plates were incubated for 30 hours and then fixed with 4% PFA in PBS for 1 hour at room temperature. The cells were washed and then incubated sequentially with an oligoclonal pool of 62 anti-S antibodies of SARS2-2, SARS2-11, SARS2-16, SARS2-31, SARS2-38, SARS2-57, and SARS2-71 and HRP-conjugated goat anti-mouse IgG (Sigma, 12-349) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin. The plates were developed using TrueBlue peroxidase substrate (KPL), and then the foci were counted on a BioSpot analyzer (Cellular Technology Limited).

[0387] Protein expression and purification: Cloning and production of purified S and RBD proteins corresponding to the WA1 / 2020 SARS-CoV-2 strain have been previously described. Briefly, prefusion-stabilized S64 and RBD were cloned into the pCAGGS mammalian expression vector with a hexahistidine tag and transiently transfected into Expi293F cells. The proteins were purified by cobalt resin chromatography (G-Biosciences).

[0388] ELISA: Purified antigen (S or RBD) was coated at 2 μg / mL (70 μL) in 50 mM Na2CO3 pH 9.6 onto 96-well Maxisorp clear plates overnight at 4°C. The coating buffer was aspirated, and the wells were blocked overnight at 4°C with 200 μL of 1× PBS + 0.05% Tween-20 + 1% BSA + 0.02% NaN3 (blocking buffer, PBSTBA). Heat-inactivated serum samples were diluted in PBSTBA in separate 96-well polypropylene plates. The plates were then washed three times with 1× PBS + 0.05% Tween-20 (PBST), and then 50 μL of the corresponding serum dilution was added. The serum was incubated in the blocked ELISA plates for at least 1 hour at room temperature. The ELISA plates were again washed three times in PBST, and then 50 μL of 1:1000 anti-mouse IgG-HRP (Southern Biotech catalog number 1030-05) or 1:1000 anti-mouse IgA-HRP (Southern Biotech) in PBST was added. The plates were incubated for 1 hour at room temperature, washed three times in PBST, and then 100 μL of 1-Step Ultra TMB-ELISA (ThermoFisher catalog number 34028) was added. After incubation for 12 to 15 minutes, the reaction was terminated with 50 μL of 2M sulfuric acid. The optical density (450 nm) was measured using a microplate reader (Bio-Rad).

[0389] ELISPOT assay: To quantify S-specific plasma cells in the bone marrow, femurs and tibias were crushed in RPMI 1640 using a mortar and pestle, filtered through a 100 μm filter, and subjected to ACK lysis. CD138 + cells were enriched by positive selection and magnetic beads according to the manufacturer's instructions (EasySep Mouse CD138 Positive Selection, STEMCELL). The enriched CD138 + cells were incubated overnight in RPMI 1640 supplemented with 10% FBS in MultiScreen-HA filter plates (Millipore) pre-coated with SARS-CoV-2 S protein. The spots were developed using TruBlue substrate (KPL) and then incubated sequentially with anti-mouse IgG-biotin or anti-mouse IgA-biotin and streptavidin-HRP. The plates were imaged using a BioSpot instrument, and the spots were manually counted.

[0390] Viral load measurement: SARS-CoV-2-infected mice were euthanized using a mixture of ketamine and xylazine, and organs were collected. Tissues were weighed and homogenized using a MAgNA Lyser (Roche) with beads in 1 ml of Dulbecco's Modified Eagle Medium (DMEM) containing 2% fetal bovine serum (FBS). RNA was extracted from the clarified tissue homogenates using the MagMax mirVana total RNA isolation kit (Thermo Scientific) and the KingFisher Flex extraction system (Thermo Scientific). SARS-CoV-2 RNA levels were measured by one-step quantitative reverse transcriptase PCR (qRT-PCR) TaqMan assay as previously described 37. The SARS-CoV-2 nucleocapsid (N)-specific primer and probe set was used as described above. Viral RNA was expressed as the number of (N) gene copies per milligram on a log10 scale.

[0391] Luminex assay: The Luminex assay was performed as previously described. Briefly, proteins (spike: D614G, E484K, N501Δ69-70, K417N, B.1.1.7, B.1.351; receptor-binding domain (RBD) (ImmuneTech): WT, E484K, B.1.1.7, B.1.351, B.1.128) were carboxyl-conjugated to magnetic Luminex microplex carboxylated beads (Luminex Corporation) using NHS-ester linkage along with sulfo-NHS and EDC (Thermo Fisher), and then incubated with sera (IgG1, FcγRIIb, FcγRIII 1:3000; IgG2a, G2b, G3, A, FcγRIV 1:1000, IgM 1:500) at 37 °C for 2 h. Isotype analysis for each isotype was performed by incubating the immune complexes with a second goat anti-mouse PE antibody (IgG1 1070-09, IgG2a 1080-09S, IgG2b 1090-09S, IgG3 1100-09, IgM 1020-09, IgA 1040-09 Southern Biotech). FcγR binding was quantified by incubating the immune complexes with biotinylated FcγRs (FcγRIIB, FcγRIII, and FcγRIV, provided by Duke Protein Production Facility) conjugated to streptavidin-PE (Prozyme). Flow cytometry was performed using an IQue (Intellicyt) and analyzed on IntelliCyt ForeCyt (v8.1).

[0392] Antibody-dependent neutrophil or cell phagocytosis: Antibody-dependent neutrophil phagocytosis (ADNP) and antibody-dependent cell phagocytosis (ADCP) assays were performed as previously described. Briefly, the spike protein carboxyl was conjugated to blue, yellow-green, or red FluoSphere using NHS-ester linkage along with sulfo-NHS and EDC (Thermo Fisher). TM Carboxylate-modified microspheres, 0.2 μm (Thermo Fisher). The spike-coated beads were incubated with diluted serum (1:150 for ADNP, 1:100 for ADCP) at 37 °C for 2 h. For the ADNP assay, bone marrow cells were collected from BALB / c mice and erythrocytes were lysed with ACK. The remaining cells were washed with PBS and aliquoted into 96-well plates (5×10 4 cells per well). The bead-antibody complexes were added to the cells and incubated at 37 °C for 1 h. After washing, the cells were stained with the following antibodies: CD11b APC (BioLegend 101212), CD11c A700 (BioLegend 117320), Ly6G Pacific Blue (127628), Ly6C BV605 (BioLegend 128036), Fcblock (BD Bioscience 553142), and CD3 PE / Cy7 (BioLegend 100320). The cells were fixed with 4% PFA and processed on a BD LSRFortessa (BD Biosciences). Neutrophils were defined as CD3 - 、CD11b + 、Ly6G + 。The neutrophil phagocytosis score was calculated as (% FITC+) × (geometric mean fluorescence intensity of FITC) / 10000. For the ADCP assay, J774A.1 (ATCC TIB-67) murine monocytes were incubated with the spike-coated bead-antibody complexes at 37 °C for 1 h. The cells were washed in 5 mM EDTA PBS, fixed with 4% PFA, and analyzed on a BD LSRFortessa (BD Biosciences). The cell phagocytosis score was calculated as (% FITC+) × (geometric mean fluorescence intensity of FITC) / 10000.

[0393] Example 3 : Expression of the SARS-CO-V2 spike gene (BA.5) variant from the CHAD vector

[0394] As previously discussed in the construction of chimpanzee adenovirus vectors, adenovirus vectors containing the S6P and S6PdF variants of SAR-CoV2-Omicron BA.5 (bivalent) were constructed and subjected to expression testing. These constructs were designated ChAd.BA.5-S6P and ChAd.BA.5-S6PdF, respectively. Freshly generated ChAd.BA.5-S6P (derived from the omicron variant BA.5 and having S6P) and ChAd.BA.5-S6PdF vectors at 3×10 3 vp / cell, or ChAd-SARS-CoV-2-S (WA1 / 2020-S2P) and ChAd.BA.1-S6PdF vectors, or a ChAd vector without a transgene were used to infect monolayers of human A549 cells. Forty-eight hours post-infection, the expression of the SARS-CoV-2 spike gene was detected by flow cytometry using a mixture of primary mAbs that bind to different epitopes of the spike glycoprotein. As Figure 18 provided, infection with the ChAd.BA.5-S6P and ChAd.BA.5-S6PdF vectors resulted in 90% and 92%, respectively, of cells expressing the spike gene, which is very close to the expression levels achieved by ChAd-SARS-CoV-2-S (WA1 / 2020-S2P) (93%) and ChAd.BA.1-S6PdF (96%). Infection with the ChAd negative control showed a background expression level of 5%, similar to that of control uninfected cells incubated with the primary and secondary Alexa Fluor 594-conjugated F(ab')2 fragments of donkey anti-mouse IgG (4.2%). These data indicate that both the ChAd.BA.5-S6P and ChAd.BA.5-S6PdF vectors should induce efficient spike expression, generating a strong immune response comparable to the immune responses achieved by the ChAd-SARS-CoV-2-S and ChAd.BA.1-S6PdF vaccine vectors.

[0395] Example 4 : Intranasal vaccination with CHAD-WUHAN-S and CHAD.BA.5-S or CHAD-bivalent durably protects mice against SARS-CoV-2 variants

[0396] Using the methods provided herein, the efficacy of intranasal vaccines with Ch-AD-control, ChAD-Wunand-S, ChAd-BA.5, and CHAD-bivalent was tested in vivo. Figure 23 Sequence alignments of the relevant S proteins are provided. Figure 19A A schematic of the vaccination, blood sampling, virus challenge, and necropsy timings is provided. In preliminary experiments, anti-SARS-CoV-2 IgG ( Figure 19B 、 19D, 19F), or IgA( Figure 19C , 19E , 19G) with SARS-CoV-2 Wuhan-1( Figure 19B -C), BA.5( Figure 19D -E), or BQ.1.1 (Figure 21F-G) for binding to the S protein was tested. Based on ELISA tests performed on sera obtained 28 days after vaccination, intranasal immunization with bivalent ChAd-CoV-2S (Wuhan) and ChAd-CoV-2-S (BA.5) provided a greater breadth of IgA and IgG responses against the Wuhan-1, BA.5, and BQ.1.1 spike proteins compared to the corresponding monovalent vaccine components.

[0397] Next, the neutralizing activity against WA1 / 2020 of Ch-AD-control, ChAd-Wuhan d-S, ChAd-BA.5, and ChAD-bivalent upon intranasal immunization was tested using FRNT. Figure 20A Neutralizing activity against WA1 / 2020 by FRNT is shown. Figure 20B Neutralizing activity against BA.5 by FRNT is shown. Figure 20C FRNT neutralizing activity against BF.7 is shown. Figure 20D Neutralizing activity against BQ.1.1 by FRNT is shown. Figure 20E Neutralizing activity against XBB.1.1 by FRNT is shown. Each point represents data from a single mouse and is the average of two technical replicates. Figure 20F -H shows the neutralization data, which is plotted as a direct comparison of the given vaccines (ChAd-SARS-CoV-2S (Wuhan-1, Figure 20F ), ChAd-SARS-CoV-2-S (BA.5, Figure 20G ), or bivalent vaccine (ChAd-SARS-CoV-2S (Wuhan-1) + ChAd-SARS-CoV-2-S (BA.5), Figure 20H ) against the indicated SARS-CoV-2 strains used for infection.

[0398] The data provided show that intranasal immunization with bivalent ChAd-CoV-2S (Wuhan) and ChAd-CoV-2-S (BA.5) provided a stronger serum neutralizing antibody response against the Wuhan-1, BA.5, and BQ.1.1 viruses compared to the corresponding monovalent vaccines.

[0399] Finally, the lungs were analyzed at 6 dpi after challenge with SARS-CoV-2 WA1 / 2020 D614G (left) or Omicron BQ.1.1 (right). Figure 21A) Nasal concha Figure 21B ) and nasal irrigation fluid Figure 21C ) The viral RNA levels in. Intranasal immunization with bivalent ChAd-CoV-2S (Wuhan) and ChAd-CoV-2-S (BA.5) provided greater protection against pulmonary infection with WA1 / 2020 D614G and BQ.1.1 viruses compared to the corresponding monovalent vaccines. This corresponded to improved protection against pulmonary inflammation, and as measured by cytokine levels ([[]] Figure 22 ).

[0400] Equivalent

[0401] Although several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision various other means and / or structures for performing the functions and / or obtaining the results and / or one or more of the advantages described herein, and each of these variations and / or modifications is considered to be within the scope of the inventive embodiments described herein. More generally, those of skill in the art will readily understand that all parameters, dimensions, materials, and configurations described herein are intended to be exemplary, and the actual parameters, dimensions, materials, and / or configurations will depend on the particular application for which the inventive teachings are used. Those of skill in the art will recognize or be able to determine many equivalents of the specific inventive embodiments described herein using only routine experimentation. Accordingly, it is to be understood that the foregoing embodiments are presented by way of example only, and that within the scope of the appended claims and their equivalents, the inventive embodiments may be practiced in a manner different from that specifically described and claimed. The inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. Moreover, any combination of two or more such features, systems, articles, materials, kits, and / or methods (where such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent) is included within the scope of the invention of the present disclosure.

[0402] All references, patents, and patent applications disclosed herein are incorporated by reference in their entirety (in some cases may cover the entire document) for the subject matter for which each is cited.

[0403] As used herein, the phrase "and / or" in the specification and claims should be understood to mean "either or both" of the recited elements, i.e., elements that may be present together in some cases and separate in other cases. Multiple elements listed with "and / or" should be construed in the same manner, i.e., "one or more" of the elements so conjoined. Other elements may optionally be present in addition to the elements specifically identified in the "and / or" clause, whether related or unrelated to the elements specifically identified. Thus, as a non-limiting example, when used in conjunction with open-ended language such as "comprising", in one embodiment, a reference to "A and / or B" can refer only to A (optionally including elements other than B); in another embodiment, only to B (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); and so forth.

[0404] As used herein, in this specification and claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" should be interpreted inclusively, i.e., including at least one of a plurality or series of elements, but also including more than one, and optionally, including additional unlisted items. Only terms that expressly state the contrary, such as "only one" or "exactly one", or "consisting of" when used in the claims, refer to including exactly one of a plurality or series of elements. In general, as used herein, the term "or" should be interpreted to denote exclusive alternatives (i.e., "one or the other but not both") only when preceded by an exclusive term such as "either", "one", "only one" or "exactly one". "Consisting essentially of" when used in the claims should have its ordinary meaning as used in the field of patent law.

[0405] As used herein, in the specification and claims, the phrase "at least one" in reference to a list of one or more elements shall be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each element specifically listed in the list of elements, and not excluding any combinations of elements in the list of elements. This definition also allows for the optional presence, whether related or unrelated to the specifically identified elements in the list of elements, of elements other than those specifically identified in the list of elements referred to by the phrase "at least one". Thus, as a non-limiting example, "at least one of A and B" (or equivalently, "at least one of A or B", or equivalently, "at least one of A and / or B") can, in one embodiment, mean at least one, optionally including more than one A, with no B present (and optionally including elements other than B); in another embodiment, mean at least one, optionally including more than one B, with no A present (and optionally including elements other than A); in yet another embodiment, mean at least one, optionally including more than one A, and at least one, optionally including more than one B (and optionally including other elements); and so forth.

[0406] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Unless otherwise indicated, any reference to "or" herein is intended to cover "and / or".

Claims

1. An adenovirus vector comprising the genome of a non-human adenovirus, wherein the genome of the adenovirus has been modified such that the vector lacks the native E1 and optionally the E3 or E3B locus, and comprises a nucleic acid sequence encoding a SARS-CoV-2 spike (S) protein having an amino acid sequence that has at least 80% identity to any one of SEQ ID NO: 10, 12, 20 or 21 or an immunogenic portion or fragment thereof.

2. The adenovirus vector according to claim 1, wherein the non-human adenovirus is a simian adenovirus (SAdV).

3. The adenovirus vector according to any one of claims 1 or 2, wherein the nucleic acid sequence encodes an amino acid sequence having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity to one or more of SEQ ID NO: 10-12, 20 or 21.

4. The adenovirus vector according to claim 2, comprising or consisting of a nucleic acid sequence having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity to any one of SEQ ID NO: 13-19.

5. An adenovirus vector comprising a nucleic acid sequence encoding an amino acid sequence having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identity to any one of SEQ ID NO: 10-12, 20, 21 or an immunogenic portion or fragment thereof.

6. An adenovirus vector comprising or consisting of a nucleic acid sequence having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity to any one of SEQ ID NOs: 13-19.

7. An adenovirus vector comprising a nucleic acid sequence encoding an amino acid sequence having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identity to SEQ ID NO: 3, said amino acid sequence comprising at least 10, or at least 15, or at least 20, or at least 25, or at least 30 mutations from the list consisting of: T19I, L24S, de125-27, 69-70del, G142D, V213G, G339D, S371F, S373P, S375F, T376A, K417N, N440K, S477N, T478K, E484A, Q493R, L452R, F486V, Q498R, N501Y, D614G, H655Y, N679K, P681H, R682G, R683S, R685S, N764K, D796Y, A942P Q954H, N969K, K988P and V989P.

8. The adenovirus vector according to claim 7, further comprising at least 2, or at least 3, or at least 4, or at least 5, or 6 stabilizing mutations as provided in F819P, A894P, A901P, A944P, K988P and V989P.

9. The adenovirus vector according to any one of claims 5-8, wherein the adenovirus vector has a functional deletion in the E1 and optionally E3 or E3B genes.

10. The adenovirus vector according to any one of claims 5-9, wherein the adenovirus vector is a simian adenovirus vector.

11. The adenovirus vector according to claim 10, wherein the adenovirus vector is chimpanzee adenovirus 36.

12. A pharmaceutical composition comprising the adenovirus vector according to any one of claims 1-11 and a pharmaceutically acceptable carrier, diluent, excipient or adjuvant.

13. An immunogenic composition comprising the adenovirus vector according to any one of claims 1-11, a pharmaceutically acceptable carrier, diluent, excipient or adjuvant.

14. The pharmaceutical composition according to claim 12 or the immunogenic composition according to claim 10, further comprising one or more additional active ingredients.

15. The pharmaceutical composition according to claim 12 or the immunogenic composition according to claim 13, wherein the composition is formulated for intranasal or intramuscular administration.

16. A host cell transduced with the adenovirus vector or composition according to any one of the preceding claims.

17. A packaging cell line that produces the composition or virus vector according to any one of the preceding claims.

18. The packaging cell line according to claim 17, wherein the cell comprises a complement of an adenovirus gene that is functionally defective in the adenovirus vector according to any one of the preceding claims.

19. The packaging cell line according to claim 17, wherein the complement of the functionally defective adenovirus gene comprises one or more of the E1, E3 or E3B genes.

20. A kit comprising: (i) one or more of the host cell according to claim 16, the packaging cell line according to claim 18, the adenovirus vector according to any one of claims 1-11, the pharmaceutical composition according to claim 12 or the immunogenic composition according to claim 13, and (ii) instructions for use.

21. A coronavirus vaccine comprising the adenovirus vector according to any one of claims 1-11.

22. A composition comprising the serum of a first subject previously administered the adenovirus vector according to any one of claims 1-11, the pharmaceutical composition according to claim 9 or the immunogenic composition according to claim 13.

23. A method of treating a second subject suffering from a coronavirus infection, comprising administering to the second subject an immunogenically effective amount of a composition comprising the serum according to claim 22.

24. A method of inducing an immune response against a coronavirus in a subject in need thereof, comprising administering to the subject an immunogenically effective amount of a composition comprising the adenovirus vector according to any one of claims 1-11, the pharmaceutical composition according to claim 12 or the immunogenic composition according to claim 13.

25. A method of treating or preventing a coronavirus infection in a subject in need thereof, comprising administering to the subject an immunogenically effective amount of a composition comprising the adenovirus vector according to any one of claims 1-11, the pharmaceutical composition according to claim 9, the immunogenic composition according to claim 13 or the serum according to claim 22.

26. The method according to any one of claims 23-25, wherein the composition is administered intranasally.

27. The method according to any one of claims 23 - 25, wherein the composition is administered intramuscularly.

28. The method according to claims 23 - 27, further comprising administering the composition one or more additional times.

29. The method according to any one of claims 24 or 25, wherein the coronavirus is the SARS-CoV-2 virus or a variant thereof.

30. The method according to claim 29, wherein the coronavirus is an alpha, beta, gamma, delta, or omicron variant or a subvariant thereof.

31. The method according to claim 29, wherein the coronavirus is the omicron strain or a subvariant thereof.

32. The method according to claims 24 or 25, wherein the subject is a human.

33. The method according to claim 32, wherein the subject has a coronavirus infection, is suspected of having a coronavirus infection, or is at risk of developing a coronavirus infection.

34. A method of preparing an adenovirus, comprising transfecting a cell with an adenovirus vector according to any one of claims 1 - 21; culturing the cell under conditions such that the cell produces a recombinant adenovirus; and collecting the recombinant adenovirus.

35. The method according to claim 34, wherein the cell is a HEK, Vero, or PER cell.

Images