Coronavirus vaccine

RNA molecules encoding variant-specific SARS-CoV-2 Spike proteins, encapsulated in lipid nanoparticles, address the challenge of vaccine evasion by inducing high neutralization titers against emerging variants like JN.1 and its descendants, providing enhanced immune responses and cross-protection.

WO2025179238A2PCT designated stage Publication Date: 2025-08-28BIONTECH SE
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/016933
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-20
Filing Date
2025-02-21
Publication Date
2025-08-28

AI Technical Summary

Technical Problem

Existing SARS-CoV-2 vaccines struggle to induce effective immune responses against emerging variants such as JN.1 and its descendants due to their ability to evade pre-existing immunity, leading to increased transmissibility and infectivity.

Method used

Compositions comprising RNA molecules encoding SARS-CoV-2 Spike proteins with specific amino acid mutations, encapsulated in lipid nanoparticles, are administered to induce a robust immune response against variants like JN.1 and its descendants, including RNA molecules with nucleotide sequences closely matching SEQ ID NOs 182, 187, 192, 197, and 202, and incorporating modifications like N1-methyl-pseudouridine and a 5' cap structure.

Benefits of technology

These compositions induce surprisingly high neutralization titers against a broad range of SARS-CoV-2 variants, including JN.1 descendants, offering improved immune responses and broader cross-neutralization compared to existing vaccines, even against Omicron variants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000045_0001
    Figure IMGF000045_0001
  • Figure IMGF000045_0002
    Figure IMGF000045_0002
  • Figure IMGF000151_0001
    Figure IMGF000151_0001
Patent Text Reader

Abstract

This disclosure relates to the field of RNA to prevent or treat coronavirus infection. In particular, the present disclosure relates to methods and agents for vaccination against coronavirus infection and inducing effective coronavirus antigen-specific immune responses such as antibody and / or T cell responses against various SARS-CoV-2 variants of concern.
Need to check novelty before this filing date? Find Prior Art

Description

CORONAVIRUS VACCINEBackground

[0001] SARS-CoV-2 infections and the resulting disease COVID- 19 have spread globally, affecting a growing number of countries. On 11 March 2020 the World Health Organization (WHO) characterized the COVID-19 outbreak as a pandemic. As of 01 December 2020, there have been >63 million globally confirmed COVID-19 cases and >1.4 million deaths, with 191 countries / regions affected. The ongoing pandemic remains a significant challenge to public health and economic stability worldwide, not least because the SARS-CoV-2 virus has continued to mutate over time relative to the first detected SARS-CoV-2 strain (referred to herein as the "Wuhan strain"). As a result of these acquired mutations, the SARS-CoV-2 virus has become better able to evade pre-existing immunity in subjects (e.g., pre-existing immunity obtained via prior exposure to a SARS-CoV-2 virus and / or prior vaccination with one or more SARS-CoV-2 vaccines).Summary

[0002] The JN.l variant emerged in August 2023, in Luxemburg. It is a descendant of the BA.2.86 variant.BA.2.86 initially drew the attention of health authorities because it had a large number of S protein mutations as compared to previous variants (~30 more than other variants circulating at the time). BA.2.86 never came to dominate circulating SARS-CoV-2 variants, however. Unlike BA.2.86, the JN. l variant (and descendants thereof) has the ability to transmit efficiently between humans, an ability that is thought to be due to the acquisition of an L455S mutation in the S protein (position shown relative to SEQ ID NO: 1). The JN.l variant rapidly came to dominate SARS-CoV-2 infections, increasing from less than 5% of all sequenced variants in November 2023, to 60% of all sequenced variants by January 2024. Since the initial emergence of the JN. l variant, descendants have continued to be identified, including the JN.1.2, JN.l.6, JN.1.7, KP.2, KP.3, XEC, MV.l, MC.l, LP.8.1, and LF.7 variants, that have acquired further mutations relative to JN. l, and which are thought to further increase the infectivity and / or transmissibility of SARS-CoV-2 variants.

[0003] The present application provides technologies for inducing an immune response against SARS-CoV-2 variants, for example those that have arisen through the course of the SARS-CoV-2 pandemic, including the JN.l variant and descendants thereof. As used herein, a "SARS-CoV-2 variant" refers to a SARS-CoV-2 viral strain which differs in its amino acid sequence from {e.g., contains one or more amino acid mutations relative to) the first- detected SARS-CoV-2 strain e.g., the Wuhan strain; comprising a Spike (S) protein comprising an amino acid sequence of SEQ ID NO: 1). In some embodiments, said one or more amino acid mutations {e.g., substitution, addition, or deletion of one or more amino acid residues) is comprised within the Spike (S) protein of the SARS-CoV-2 variant.

[0004] In particular, among other things, the present application provides compositions {e.g., RNA, mRNA, and / or LNP formulated mRNA compositions), and methods of using the same to induce an immune response against one or more SARS-CoV-2 variants {e.g., a JN. l, JN.1.6, JN.1.7, KP.2, KP.3, XEC, JN.1.2, MV.l, MC.l, LP.8.1, and / or LF.7 variant {e.g., variants comprising an S protein comprising mutations and / or amino acid sequences described herein)). Among other things, the present disclosure provides an insight that, among the many circulating SARS-CoV-2 variants, a composition that can deliver an antigen (e.g., an S polypeptide) of a JN variant (e.g., JN. l, JN.1.6, JN.1.7, or JN.1.2) or a descendent thereof (e.g., KP.2, KP.3, XEC, MV.l, MC.l, LP.8.1, or LF.7) would be particularly advantageous in light of the rapid spread of these variants. Among other things, the present disclosure describes data demonstrating that such vaccines, including compositions comprising an RNA encoding an S protein of a JN.lvariant and compositions comprising an RNA encoding an S protein of a KP.2 variant, can induce surprisingly high neutralization titers against a broad panel of JN.l descendants. A composition comprising an RNA encoding an S protein of a KP.2 SARS-CoV-2 variant induced the highest neutralization titers of the compositions tested, including, surprisingly, neutralization titers against a JN. l variant that were higher than those induced by a composition comprising an RNA encoding an S protein of a JN.l variant.

[0005] In some embodiments, technologies described in the present application provide for an improved immune response {e.g., (i) higher antibody and / or neutralization titers against one or more SARS-CoV-2 variants of concern {e.g., a JN. l, JN.1.6, JN.1.7, KP.2, KP.3, XEC, JN.1.2, MV.l, MC.l, LP.8.1, and / or LF.7 variant) and / or (ii) broader cross neutralization {e.g., higher antibody and / or neutralization titers against a number of SARS-CoV-2 variants of concern {e.g., one or more of a JN.l, JN.1.6, JN.1.7, KP.2, KP.3, XEC, JN.1.2, MV.l, MC.l, LP.8.1, and / or LF.7 variants, as well as viruses related thereto and other Omicron variants)), as compared to existing technologies (e.g., as compared to vaccines that deliver previously arising variants, including vaccines delivering an S protein of a Wuhan, Omicron BA.4 / 5, and / or XBB.1.5 SARS-CoV-2 strain and variants). For example, RNA described herein that encodes an S protein comprising one or more mutations associated with a JN.l variant can induce an improved immune response against JN.l as well as against other SARS-CoV-2 variants, such as, e.g., descendants of JN.l, including, inter alia, KP.2 and XEC and other descendants described herein. Likewise, RNA described herein that encodes an S protein comprising one or more mutations associated with a KP.2 variant can induce improved neutralization titers against KP.2 as well as improved cross neutralization titers against other SARS-CoV-2 variants, such as, e.g., JN.l and descendant thereof, including, inter alia, XEC and other descendants described herein.

[0006] Among other things, the present application provides insights relating to which amino acid mutations to include in a variant-adapted vaccine, and / or amino acid and nucleotide sequences for inducing immune responses against a SARS-CoV-2 variant of concern {e.g., a JN. l, JN.1.2, JN.1.6, KP.2, KP.3, XEC, JN.1.7, JN.1.2, MV. l, MC. l, LP.8.1, and / or LF.7 variant). In some embodiments, an immune response is induced against a JN variant (e.g., a JN. l, JN.1.2, JN.1.6, and / or JN.1.7 variant) or a descendent thereof (e.g., a KP.2, KP.3, XEC, MV.l, MC.l, LP.8.1, or LF.7 variant).

[0007] In some embodiments, the present disclosure provides a composition comprising an RNA molecule having:(a) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 182;(b) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 182, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 179 and / or (ii) one or more of the following substitutions mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A2101, L2102I, V2103G, L2106F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, P1143L, or any combination thereof; and / or(c) a nucleotide sequence as set forth in SEQ ID NO: 182.

[0008] In some embodiments, the present disclosure provides a composition comprising an RNA molecule having: (a) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 187;(b) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 187, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 184 and / or (ii) one or more of the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, P1143L, or any combination thereof; and / or(c) a nucleotide sequence of SEQ ID NO: 187.

[0009] In some embodiments, the present disclosure provides a composition comprising an RNA molecule having:(a) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 192;(b) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 192, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 189 and / or (ii) one or more of the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, T572I, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, P1143L, E1150D, or any combination thereof; and / or(c) a nucleotide sequence of SEQ ID NO: 192.

[0010] In some embodiments, the present disclosure provides a composition comprising an RNA molecule having:(a) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 197;(b) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 197, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 194 and / or (ii) one or more of the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, P1143L, M1229I, or any combination thereof; and / or(c) a nucleotide sequence of SEQ ID NO: 197.

[0011] In some embodiments, the present disclosure provides a composition comprising an RNA molecule having:(a) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 202;(b) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 202, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 199 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K,F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof; and / or(c) a nucleotide sequence of SEQ ID NO: 202.

[0012] In some embodiments, the present disclosure provides a composition comprising an RNA molecule having:(a) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 207;(b) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 207, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 204 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, T22N, A24-26, A27S, S50L, F59S, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q493E, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof; and / or(c) a nucleotide sequence of SEQ ID NO: 207; wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0013] In some embodiments, the present disclosure provides a method of inducing an immune response against a coronavirus e.g., a betacoronavirus, sarbecovirus, and / or SARS-CoV-2) in a subject, comprising administering to the subject a composition as disclosed herein.

[0014] In some embodiments, the present disclosure provides a composition comprising an RNA molecule having a nucleotide sequence of SEQ ID NO: 207.

[0015] In some embodiments, a SARS-CoV-2 S protein comprises one or more mutations that stabilize a prefusion confirmation of the SARS-CoV-2 S protein (e.g., one or more mutations as described herein, including one or both of the following mutations relative to SEQ ID NO: 1: K986P and V987P).

[0016] In some embodiments, a SARS-CoV-2 S protein comprises:(a) a mutation at a position corresponding to position 22 of SEQ ID NO: 1 (e.g., T22N);(b) mutations at positions corresponding to position 22 and 59 of SEQ ID NO: 1 (e.g., T22N and F59S);(c) a mutation at a position corresponding to position 59 of SEQ ID NO: 1 (e.g., F59S);(d) a mutation at a position corresponding to position 346 of SEQ ID NO: 1 (e.g., R346T);(e) mutations at positions corresponding to positions 346 and 1104 of SEQ ID NO: 1 (e.g., R346T and V1104L);(f) mutation at a position corresponding to position 455 of SEQ ID NO: 1 (e.g., L455S or L455F);(g) a mutation at a position corresponding to position 456 of SEQ ID NO: 1 (e.g., F456L);(h) mutations at positions corresponding to positions 455 and 456 of SEQ ID NO: 1 (e.g., F456L and L455F);(i) a mutation at a position corresponding to position 493 of SEQ ID NO: 1 (e.g., Q493E);0) a mutation at a position corresponding to position 1104 of SEQ ID NO: 1 (e.g., V1104L); or(k) any combination of (a)-(j).

[0017] In some embodiments, an RNA molecule comprises a 5' cap and a modified uridine in place of each uridine. In some embodiments, a modified uridine comprises Nl-methyl-pseudouridine. In some embodiments, a modified uridine comprises pseudouridine. In some embodiments, a 5' cap comprises m27'3' °Gppp(mi2' °)ApG.

[0018] In come embodiments, an RNA molecule is encapsulated in or associated with a particle (e. ., a lipid particle e.g., a lipid nanoparticle or a liposome)). In some embodiments, an LNP comprises molar ratios of 20-60% ionizable cationic lipid, 5-25% neutral lipid, 25-55% sterol, and 0.5-15% PEG-modified lipid.

[0019] In some embodiments, a composition comprises two or more RNA molecules, each encoding an S protein of a different SARS-CoV-2 variant. In some embodiments, a composition comprises two or more RNA molecules described herein (e.g., two or more RNA molecules, each comprising a nucleotide sequence that encodes an S protein comprising one or more mutations characteristic of JN.l, JN.1.6, JN.1.7, KP.2, KP.3, XEC, JN.1.2 MV.l, MC.l, LP.8.1, or LF.7 SARS-CoV-2 variant, wherein the S protein encoded by each of the two RNA molecules have a different amino acid sequence. In some embodiments, a composition comprises a first RNA molecule comprising a nucleotide sequence that encodes an S protein comprising one or more mutations characteristic of a JN.l, JN.1.6, JN.1.7, KP.2, KP.3, XEC, JN.1.2 MV.l, MC.l, LP.8.1, or LF.7 SARS-CoV-2 variant (e.g., one or more mutations described herein, or an RNA molecule comprising or encoding a sequence described herein), and one or more additional RNA molecules, wherein the one or more additional RNA molecules each comprise a nucleotide sequence encoding an S protein of a SARS-CoV-2 strain or variant that is not JN. l, JN.1.7, JN.1.6, KP.2, KP.3, XEC, JN.1.2, MV. l, MC.l, LP.8.1, or LF.7. In some embodiments, the one or more additional RNA molecules comprise a sequence that is at least 95% identical to that set forth in SEQ ID NO: 20, 72, 103, or 161.

[0020] In some embodiments, an RNA molecule comprises:(i) Nl-methyl-pseudouridine in place of each uridine; and(ii) a 5' cap that comprises m27'3' °Gppp(mi2' °)ApG; wherein the RNA molecule is encapsulated in a lipid nanoparticle (LNP); and wherein the LNP comprises molar ratios of 20-60% ionizable cationic lipid, 5-25% neutral lipid, 25-55% sterol, and 0.5-15% PEG-modified lipid.

[0021] In some embodiments, a composition comprises about 10 mM Tris buffer and about 10% sucrose.

[0022] In some embodiments, a composition comprises at least one unit dose of LNP-encapsulated RNA molecules. In some embodiments, the unit dose comprises the RNA molecules in an amount of about 30 pg. In some embodiments, the unit dose comprises the RNA molecule in an amount of about 10 pg. In some embodiments, the unit dose comprises the RNA molecule in an amount of about 3 pg.

[0023] In some embodiments, a composition is formulated as a multi-dose formulation in a vial.

[0024] In some embodiments, a subject is 12 years or older. In some embodiments, a subject that is 12 years or older is administered an RNA molecule described herein in an amount of about 30 pg. In some embodiments, a subject that is 12 years or older is administered an RNA molecule described herein in an amount of about 20 pg. In some embodiments, a subject that is 12 years or older is administered an RNA molecule described herein in an amount of about 10 pg. In some embodiments, a subject that is 12 years or older is administered an RNA molecule described herein in an amount of about 5 pg.

[0025] In some embodiments, a subject is 5 years to less than 12 years old. In some embodiments, a subject that is 5 years to less than 12 years old is administered an RNA molecule described herein in an amount of about 10 pg. In some embodiments, a subject that is 5 years to less than 12 years old is administered an RNA molecule describedherein in an amount of about 6 pg. In some embodiments, a subject that is 5 years to less than 12 years old is administered an RNA molecule described herein in an amount of about 5 pg. In some embodiments, a subject that is5 years to less than 12 years old is administered an RNA molecule described herein in an amount of about 3 pg. In some embodiments, a subject that is 5 years to less than 12 years old is administered an RNA molecule described herein in an amount of about 1.5 pg.

[0026] In some embodiments, a subject is about 6 months old to less than 5 years old. In some embodiments, a subject who is 6 months old to less than 5 years old is administered an RNA molecule described herein in an amount of about 3 pg of the RNA molecule. In some embodiments, a subject who is 6 months old to less than 5 years old is administered an RNA molecule described herein in an amount of about 2 pg. In some embodiments, a subject who is6 months old to less than 5 years old is administered an RNA molecule described herein in an amount of about 1 pg. In some embodiments, a subject who is 6 months old to less than 5 years old is administered an RNA molecule described herein in an amount of about 0.5 pg.

[0027] In some embodiments, a composition comprises or is formulated to provide one or more unit doses comprising about 0.1 pg to about 100 pg, about 1 pg to about 50 pg, about 1 pg to about 30 pg, about 1 pg to about 10 pg, about 10 pg to about 20 pg, about 20 pg to about 30 pg, about 1 pg, about 3 pg, about 5 pg, about 10 pg, about 15 pg, about 20 pg, about 25 pg, or about 30 pg of RNA described herein. In some embodiments, a composition comprises or is formulated to provide one or more unit doses comprising about 100 pg or less, about 90 pg or less, or about 60 pg or less of total RNA. In some embodiments, a composition comprises or is formulated to provide one or more unit doses comprising about 90 pg, about 60 pg, about 30 pg, about 25 pg, about 20 pg, about 10 pg, about 6 pg, about 5 pg, or about 3 pg of total RNA.

[0028] In some embodiments, a method comprises administering about 0.1 pg to about 100 pg, about 1 pg to about 50 pg, about 1 pg to about 30 pg, about 1 pg to about 10 pg, about 10 pg to about 20 pg, about 20 pg to about 30 pg, about 1 pg, about 3 pg, about 5 pg, about 10 pg, about 15 pg, about 20 pg, about 25 pg, or about 30 pg of RNA described herein. In some embodiments, a method comprises administering a dose of a composition described herein comprising about 100 pg or less about 90 pg or less, or about 60 pg or less of total RNA. In some embodiments, a method comprises adminsitering about 90 pg, about 60 pg, about 30 pg, about 25 pg, about 20 pg, about 10 pg, about 6 pg, about 5 pg, or about 3 pg of total RNA.

[0029] In some embodiments, a composition described herein comprises, is formulated to be administered in an amount of, or is administered in an amount of about 200 pL to 300 pL.

[0030] In some embodiments, a subject was previously administered one or more doses of a SARS-CoV-2 vaccine, e.g., wherein the subject was previously administered a complete dosing regimen of a SARS-CoV-2 vaccine. As used herein, "a complete dosing regimen" includes, e.g., a dosing regimen described on the label of a currently or previously approved SARS-CoV-2 vaccine; a dosing regimen that complies with current clinical and / or CDC recommendations; one, two, or three doses of a vaccine administered as part of an approved primary dosing regimen, optionally followed by one or more booster doses; two doses of a Wuhan-adapted vaccine {e.g., administered about 21 days apart) or three doses of a Wuhan-adapted vaccine {e.g., where the first and the second dose are administered about 21 days apart and the third dose is administered about 28 days after the third dose), and optionally one or more booster doses of a SARS-CoV-2 vaccine {e.g., one of more of a Wuhan-adapted vaccine, a Wuhan + Omicron BA.4 / 5 bivalent vaccine, and / or an XBB. l.S-adapted vaccine).

[0031] As used herein, "about 21 days apart" includes, e.g., 17 to 25 days apart, 19 to 23 days apart, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days apart.

[0032] In some embodiments, a subject was previously administered a first dose and a second dose of Comirnaty®, wherein the first dose and the second dose were administered about 21 days apart, and / or wherein the subject was previously administered as a booster dose of a bivalent vaccine that delivers (i) a SARS-CoV-2 S protein of an Omicron BA.4 / 5 variant and (ii) a SARS-CoV-2 S protein of a Wuhan strain. In some embodiments, a subject was previously administered a composition that delivers a SARS-CoV-2 S protein of an XBB.1.5 variant.

[0033] In some embodiments, a method further comprises administering one or more vaccines against a non- SARS-CoV-2 disease, e.g., wherein the one or more vaccines comprise an RSV vaccine, an influenza vaccine, or a combination thereof, wherein the one or more vaccines against a non-SARS-CoV-2 disease may be administered at the same time as a composition described herein (e.g., in the same injection or closely after one another (e.g., in the same visit to a medical professional and / or within a few minutes of one another)). In some embodiments, a composition described herein further comprises one or more vaccines against a non-SARS-CoV-2 disease, e.g., wherein the one or more vaccines comprise an RSV vaccine, an influenza vaccine, or a combination thereof.

[0034] In some embodiments, compositions described herein (e.g., monovalent compositions comprising an RNA molecule encoding a SARS-CoV-2 S protein of a JN.l, JN.1.6.1, JN.1.7, KP.2, KP.3, XEC, JN.1.2, MV.l, MC.l, LP.8.1, or LF.7 variant) can induce a strong immune response e.g., high neutralization titers (e.g., antibody titers that are sufficient to prevent SARS-CoV-2 infection or mitigate symptoms of infection) against certain SARS-CoV-2 variants of concern (e.g., Omicron variants of concern (including, e.g., a JN. l, JN.1.2, JN. l.6.1, JN.1.7, KP.2, KP.3, XEC, BA.2.86, MV. l, MC. l, LP.8.1, and / or LF.7 variant))). In some embodiments, such monovalent compositions comprise an RNA molecule encoding a SARS-CoV-2 S protein of a JN.l variant. In some embodiments, such monovalent compositions comprise an RNA molecule encoding a SARS-CoV-2 S protein of a JN.1.6 variant. In some embodiments, such monovalent compositions comprise an RNA molecule encoding a SARS-CoV-2 S protein of a JN.1.7 variant. In some embodiments, such monovalent compositions comprise an RNA molecule encoding a SARS- CoV-2 S protein of a JN.1.2 variant. In some embodiments, such monovalent compositions comprise an RNA molecule encoding a SARS-CoV-2 S protein of a KP.2, KP.3, or XEC variant. In some embodiments, such monovalent composition comprise an RNA molecule encoding a SARS-CoV-2 S protein of an MV. l variant. In some embodiments, such monovalent composition comprise an RNA molecule encoding a SARS-CoV-2 S protein of an MC. l variant. In some embodiments, such monovalent composition comprise an RNA molecule encoding a SARS-CoV-2 S protein of an LP.8.1 variant. In some embodiments, such monovalent composition comprise an RNA molecule encoding a SARS- CoV-2 S protein of an LF.7 variant. In some embodiments, such compositions can induce surprisingly high neutralization titers against certain Omicron variants of concern (including, e.g., JN. l, JN.1.7, JN.1.6, JN.1.2, BA.2.86, XBB.1.5, XBB.1.16, KP.2, KP.3, XEC, XBB.2.3, MV. l, MC. l, LP.8.1, and LF.7 variants). For example, in some embodiments, a composition described herein that comprises an RNA molecule encoding a SARS-CoV-2 S protein of a JN.l, JN.1.6, JN.1.7, KP.2, KP.3, XEC, JN.1.2, MV.l, MC.l, LP.8.1, or LF.7 variant can induce neutralization titers against a JN.l, JN.1.6, JN.1.7, KP.2, KP.3, XEC, JN.1.2, MV.l, MC.l, LP.8.1, and / or LF.7 variant that are higher (e.g, at least about 20%, at least about 40%, at least about 60%, at least about 80% or more) than those induced by currently approved / authorized SARS-CoV-2 vaccines and / or vaccines that deliver antigens of non- JN.1 / JN.1.6 / JN.1.7 / JN.1.2 / KP.2 / KP.3 / XEC / MV.1 / MC.1 / LP.8.1 / LF.7 SARS-CoV-2 variants (e.g., a vaccine that delivers a full length S protein of a Wuhan strain, a vaccine that delivers a full length S protein of an XBB.1.5 strain, and / or avaccine that delivers a full length S protein of a Wuhan strain and a full length S protein of an Omicron BA.4 / 5 variant). In some embodiments, a composition described herein that comprises an RNA molecule encoding a SARS- CoV-2 S protein of an JN. l variant can induce neutralization titers against a JN. l, JN.1.6, JN.1.7, KP.2, KP.3, XEC, JN.1.2, MV.l, MC. l, LP.8.1, and / or LF.7 variant that are higher (e.g., at least about 20%, at least about 40%, at least about 60%, at least about 80% or more) than those induced by currently approved / authorized SARS-CoV-2 vaccines and / or vaccines that deliver antigens of non-JN.l / JN.1.6JN.1.7 / JN.1.2 / KP.2 / KP.3 / XEC / MV.1 / MC.1 / LP.8.1 / LF.7 SARS-CoV-2 variants (e.g., antibody titers induced by an XBB.1.5-adapted vaccine). In some embodiments, a composition described herein that comprises an RNA molecule encoding a SARS-CoV-2 S protein of an KP.2 variant can induce neutralization titers against a JN.l, JN.1.6, JN.1.7, KP.2, KP.3, XEC JN.1.2, MV.l, MC. l, LP.8.1, and / or LF.7 variant that are higher (e.g., at least about 20%, at least about 40%, at least about 60%, at least about 80% or more) than those induced by currently approved / authorized SARS-CoV-2 vaccines and / or vaccines that deliver antigens of non-JN.l / JN.1.6 / JN.1.7 / JN.1.2 / KP.2 / KP.3 / XEC / MV.l / MC.l / LP.8.1 / LF.7 SARS-CoV-2 variants (e.g., antibody titers induced by an XBB.1.5-adapted vaccine). In some embodiments, compositions described herein can also increase neutralization titers against further SARS-CoV-2 variants of concern (e.g., an Omicron BA.l, BA.2, and / or BA.4 / 5 variant and / or XBB variants (e.g., XBB.1.5 and / or XBB.1.16 variants)). In some embodiments, a strong immune response can be observed in vaccine-naive subjects (e.g., pediatric patients (e.g., subjects 6 months to less than 5 years old)). In some embodiments, a strong immune response can be observed in subjects who have not previously been exposed to SARS-CoV-2, and / or previously been administered a SARS-CoV-2 vaccine. In some embodiments, a strong immune response can be observed in subjects who previously received a SARS-CoV-2 vaccine (e.g., an RNA vaccine encoding a SARS-CoV-2 S protein (e.g., a Wuhan strain)) and / or who were previously exposed to SARS-CoV-2. In some embodiments, compositions described herein provide for an improved immune response relative to previously approved SARS-CoV-2 vaccines (e.g., vaccines delivering antigens of a Wuhan, BA.4 / 5, or XBB.1.5 strains / variants), wherein an improved immune response includes, e.g., higher neutralization titers against a given SARS-CoV-2 variant (e.g., a JN.l, JN.1.6, JN.1.2, KP.2, KP.3, XEC, JN.1.7, MV.l, MC.l, LP.8.1, and / or LF.7 variant) and / or broader cross-neutralization (e.g., higher neutralization titers against a larger number of Omicron variants). In some embodiments, a broader cross-neutralization response can be observed in pediatric subjects (e.g., subjects aged 6 months to less than 2 years, and / or 2 years to less than 5 years), e.g., pediatric subjects who have not previously been administered a SARS-CoV-2 vaccine.

[0035] Among other things, the present disclosure describes a composition comprising an RNA molecule having a nucleotide sequence as set forth in SEQ ID NO: 207, wherein the RNA molecule comprises:(a) Nl-methyl-pseudouridine in place of each uridine; and(b) a 5' cap that comprises m27'3 OGppp(mi2' °)ApG; wherein the RNA molecule is encapsulated in a lipid nanoparticle (LNP).

[0036] In some embodiments, a composition comprises about 10 mM Tris buffer and about 10% sucrose.

[0037] In some embodiments, a composition is formulated as a multi-dose formulation in a vial.

[0038] In some embodiments, a composition comprises at least one unit dose of LNP-encapsulated RNA molecules, wherein the composition comprises a population of LNPs encapsulating RNA molecules, and wherein:(a) the LNPs comprise an ionizable cationic lipid, a neutral lipid, a sterol, and a PEG-modified lipid; and(b) each LNP in the population encapsulates at least one RNA molecule, wherein the RNA molecule comprises:(i) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 182; or(ii) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 182, and that comprises a nucleotide sequence that encodes a SARS-CoV-2 protein comprising the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, and P1143L;(Hi) Nl-methyl-pseudouridine in place of each uridine; and(iv) a 5' cap that comprises m27'3' °Gppp(mi2' °)ApG.

[0039] Among other things, the present disclosure describes a composition comprising at least one unit dose of LNP-encapsulated RNA molecules, wherein the composition comprises a population of LNPs encapsulating RNA molecules, and wherein:(a) the LNPs comprise an ionizable cationic lipid, a neutral lipid, a sterol, and a PEG-modified lipid; and(b) each LNP in the population encapsulates at least one RNA molecule, wherein the RNA molecule comprises:(i) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 187; or(ii) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 187, and that comprises a nucleotide sequence that encodes a SARS-CoV-2 protein comprising the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, and P1143L;(iii) Nl-methyl-pseudouridine in place of each uridine; and(iv) a 5' cap that comprises m27'3'0Gppp(mi2' °)ApG.

[0040] Among other things, the present disclosure describes a composition comprising at least one unit dose of LNP-encapsulated RNA molecules, wherein the composition comprises a population of LNPs encapsulating RNA molecules, and wherein:(a) the LNPs comprise an ionizable cationic lipid, a neutral lipid, a sterol, and a PEG-modified lipid; and(b) each LNP in the population encapsulates at least one RNA molecule, wherein the RNA molecule comprises:(i) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 192; or(ii) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 192, and that comprises a nucleotide sequence that encodes a SARS-CoV-2 protein comprising the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, T572I, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, P1143L, and E1150D;(iii) Nl-methyl-pseudouridine in place of each uridine; and(iv) a 5' cap that comprises m27'3' °Gppp(mi2'0)ApG.

[0041] Among other things, the present disclosure describes a composition comprising at least one unit dose of LNP-encapsulated RNA molecules, wherein the composition comprises a population of LNPs encapsulating RNA molecules, and wherein:(a) the LNPs comprise an ionizable cationic lipid, a neutral lipid, a sterol, and a PEG-modified lipid; and(b) each LNP in the population encapsulates at least one RNA molecule, wherein the RNA molecule comprises:(i) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 197; or(II) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical toSEQ ID NO: 197, and that comprises a nucleotide sequence that encodes a SARS-CoV-2 protein comprising the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, P1143L, and M1229I;(iii) Nl-methyl-pseudouridine in place of each uridine; and(iv) a 5' cap that comprises m27'3' °Gppp(mi2' °)ApG.

[0042] Among other things, the present disclosure describes a composition comprising at least one unit dose of LNP-encapsulated RNA molecules, wherein the composition comprises a population of LNPs encapsulating RNA molecules, and wherein:(a) the LNPs comprise an ionizable cationic lipid, a neutral lipid, a sterol, and a PEG-modified lipid; and(b) each LNP in the population encapsulates at least one RNA molecule, wherein the RNA molecule comprises:(i) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 202; or(ii) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 202, and that comprises a nucleotide sequence that encodes a SARS-CoV-2 protein comprising the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, and P1143L;(iii) Nl-methyl-pseudouridine in place of each uridine; and(iv) a 5' cap that comprises m27-3,°Gppp(mi2' °)ApG.

[0043] Among other things, the present disclosure describes a composition comprising at least one unit dose of LNP-encapsulated RNA molecules, wherein the composition comprises a population of LNPs encapsulating RNA molecules, and wherein:(a) the LNPs comprise an ionizable cationic lipid, a neutral lipid, a sterol, and a PEG-modified lipid; and(b) each LNP in the population encapsulates at least one RNA molecule, wherein the RNA molecule comprises:(i) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 207; or(ii) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 207, and that comprises a nucleotide sequence that encodes a SARS-CoV-2 protein comprising the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, T22N, A24-26, A27S, S50L, F59S, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q493E, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, and P1143L;(iii) Nl-methyl-pseudouridine in place of each uridine; and(iv) a 5' cap that comprises m27'3' °Gppp(mi2' °)ApG.

[0044] In some embodiments, a composition comprises about 10 mM Tris buffer and about 10% sucrose.

[0045] In some embodiments, a unit dose comprises an RNA molecule described herein in an amount of about 30 pg. In some embodiments, a unit dose comprises an RNA molecule described herein in an amount of about 10 pg. In some embodiments, a unit dose comprises an RNA molecule described herein in an amount of about 3 pg.

[0046] Among other things, the present disclosure describes a method of inducing an immune response against a coronavirus in a subject, comprising administering to a subject a composition described herein.

[0047] In some embodiments, an administered RNA molecule comprises Nl-methyl-pseudouridine in place of each uridine.

[0048] In some embodiments, an administered RNA molecule comprises a 5' cap that comprises m27'3' °Gppp(mi2'_°)ApG.

[0049] In some embodiments, an administered RNA molecule is encapsulated in or associated with an LNP.

[0050] In some embodiments, a method comprises administering a composition described herein to a subject who is 12 years or older, where the composition comprises 30 pg of an RNA molecule.

[0051] In some embodiments, a method comprises administering a composition described herein to a subject who is 5 years to less than 12 years old, wherein the composition comprises 10 pg of an RNA molecule.

[0052] In some embodiments, a method comprises administering a composition describered herein to a subject who is 6 months to less than 5 years old, wherein the composition comprises 3 pg of an RNA molecule.

[0053] In some embodiments, a composition is administered in a volume of about 200 pL to 300 pL.

[0054] In some embodiments, a subject was previously administered one or more doses of a SARS-CoV-2 vaccine.

[0055] In some embodiments, a subject was previously administered a complete dosing regimen of a SARS-CoV-2 vaccine.

[0056] In some embodiments, a subject was previously administered a first dose and a second dose of BNT162b2, wherein the first dose and the second dose were administered about 21 days apart.

[0057] In some embodiments, a subject was previously administered as a booster dose a bivalent vaccine that delivers (i) a SARS-CoV-2 S protein of an Omicron BA.4 / 5 variant and (ii) a SARS-CoV-2 S protein of a Wuhan strain.

[0058] In some embodiments, a composition described herein is co-administered with one or more vaccines against a non-SARS-CoV-2 disease. In some embodiments, one or more vaccines against a non-SARS-CoV-2 disease include an RSV vaccine, an influenza vaccine, or a combination thereof. Among other things, the present disclosure describes an RNA molecule comprising:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 200 or 202, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 199 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 200 or 202; and / or(c) a nucleotide sequence of SEQ ID NO: 200 or 202; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0059] Among other things, the present disclosure describes an RNA molecule comprising:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 237 or 239, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 199 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof; and / or(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 237 or 239; and / or(c) a nucleotide sequence of SEQ ID NO: 237 or 239; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0060] Among other things, the present disclosure describes an RNA molecule comprising:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 242 or 244, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 199 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof; and / or(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 242 or 244; and / or(c) a nucleotide sequence of SEQ ID NO: 242 or 244; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0061] Among other things, the present disclosure describes an RNA molecule comprising a nucleotide sequence encoding a SARS-CoV-2 S protein, or a fragment of an SARS-CoV-2 S protein, wherein:(a) if the RNA molecule encodes a SARS-CoV-2 S protein, the SARS-CoV-2 S protein comprises all of the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, where positions are indicated relative to SEQ ID NO: 1; and(b) if the RNA molecule encodes a fragment of a SARS-CoV-2 S protein, the fragment of a SARS-CoV-2 S protein comprises one or more of the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24- 26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, to the extent the mutations are in a region that is present in the fragment of the SARS-CoV-2 S protein; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0062] In some embodiments, an RNA molecule comprises:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 180 or 182, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 179 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 180 or 182; and / or(c) a nucleotide sequence of SEQ ID NO: 180 or 182; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0063] In some embodiments, an RNA molecule comprises:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 229 or 231, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 179 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K,D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 229 or 231; and / or(c) a nucleotide sequence of SEQ ID NO: 229 or 231; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0064] In some embodiments, an RNA molecule comprises:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 233 or 235, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 179 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 233 or 235; and / or(c) a nucleotide sequence of SEQ ID NO: 233 or 235; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0065] In some embodiments, a SARS-CoV-2 S protein comprises one or more mutations that stabilize a prefusion confirmation of the SARS-CoV-2 S protein (e.g., one or more mutations described herein, including one or both of the following mutations relative to SEQ ID NO: 1: K986P and V987P).

[0066] In some embodiments, an RNA molecule encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 286 or a sequence that is at least 70% identical to SEQ ID NO: 286 {e.g, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 286),(b) a nucleotide sequence of SEQ ID NO: 288 or a sequence that is at least 70% identical to SEQ ID NO: 288 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 288),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 285, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 285 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 285); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more of the following mutations: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I,V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, or E554K, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1.

[0067] In some embodiments, an RNA molecule encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 290 or a sequence that is at least 70% identical to SEQ ID NO: 290 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 290),(b) a nucleotide sequence of SEQ ID NO: 292 or a sequence that is at least 70% identical to SEQ ID NO: 292 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 292),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 285, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 285 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 285); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more of the following mutations: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, or Y505H, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1.

[0068] In some embodiments, an RNA molecule encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 294 or a sequence that is at least 70% identical to SEQ ID NO: 294 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 294),(b) a nucleotide sequence of SEQ ID NO: 296 or a sequence that is at least 70% identical to SEQ ID NO: 296 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 296),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 285, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 285 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 285); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more of the following mutations: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, or Y505H, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1.

[0069] In some embodiments, an RNA molecule encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 364 or a sequence that is at least 70% identical to SEQ ID NO: 364 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 364),(b) a nucleotide sequence of SEQ ID NO: 438 or a sequence that is at least 70% identical to SEQ ID NO: 438 (e.g, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 438),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 363, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 363 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 363); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more of the following mutations insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, or Y505H or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1.

[0070] In some embodiments, an RNA molecule encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 367 or a sequence that is at least 70% identical to SEQ ID NO: 367 (e.g, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 367),(b) a nucleotide sequence of SEQ ID NO: 369 or a sequence that is at least 70% identical to SEQ ID NO: 369 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 369),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 363, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 363 (e.g, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 363); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more of the following mutations: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, or Y505H or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1.

[0071] In some embodiments, an RNA molecule encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 370 or a sequence that is at least 70% identical to SEQ ID NO: 370 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 370),(b) a nucleotide sequence of SEQ ID NO: 372 or a sequence that is at least 70% identical to SEQ ID NO: 372 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 372),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 363, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 285 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 363); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more of the following mutations: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, or Y505H, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1.

[0072] In some embodiments, an RNA molecule comprises a nucleotide sequence encoding a SARS-CoV-2 S protein, or a fragment of an SARS-CoV-2 S protein, wherein:(a) if the RNA molecule encodes a SARS-CoV-2 S protein, the SARS-CoV-2 S protein comprises all of the following mutations: insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S31del, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, E554K, A570V, T572I, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, where positions are indicated relative to SEQ ID NO: 1; and(b) if the RNA molecule encodes a fragment of a SARS-CoV-2 S protein, the fragment of a SARS-CoV-2 S protein comprises one or more of the following mutations insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S31del, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, E554K, A570V, T572I, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, to the extent the mutations are in a region that is present in the fragment of the SARS-CoV-2 S protein; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0073] In some embodiments, an RNA molecule comprises:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 215 or 217, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 214 and / or (ii) one or more the following mutationsrelative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 215 or 217; and / or(c) a nucleotide sequence of SEQ ID NO: 215 or 217; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0074] In some embodiments, an RNA molecule comprises:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 261 or 263, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 261 or 263 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 261 or 263; and / or(c) a nucleotide sequence of SEQ ID NO: 261 or 263; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0075] In some embodiments, an RNA molecule comprises:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 265 or 267, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 214 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 265 or 267; and / or(c) a nucleotide sequence of SEQ ID NO: 265 or 267; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0076] In some embodiments, an RNA molecule comprises a nucleotide sequence encoding a fragment of a SARS- CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 325 or a sequence that is at least 70% identical to SEQ ID NO: 325 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 325),(b) a nucleotide sequence of SEQ ID NO: 327 or a sequence that is at least 70% identical to SEQ ID NO: 327 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 327),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 324, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 324 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 324); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations of the following mutations: insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S31del, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, or any combination thereof, where mutations are shown relative to SEQ ID NO: 1.

[0077] In some embodiments, an RNA molecule comprises a nucleotide sequence encoding a fragment of a SARS- CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 329 or a sequence that is at least 70% identical to SEQ ID NO: 329 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 329),(b) a nucleotide sequence of SEQ ID NO: 331 or a sequence that is at least 70% identical to SEQ ID NO: 331 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 331),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 324, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 324 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 324); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations of the following mutations: insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S31del, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, or any combination thereof, where mutations are shown relative to SEQ ID NO: 1.

[0078] In some embodiments, an RNA molecule comprises a nucleotide sequence encoding a fragment of a SARS- CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 333 or a sequence that is at least 70% identical to SEQ ID NO: 333 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 333),(b) a nucleotide sequence of SEQ ID NO: 335 or a sequence that is at least 70% identical to SEQ ID NO: 335 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 335),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 324, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 324 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 324); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations of the following mutations: insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S31del, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, or any combination thereof, where mutations are shown relative to SEQ ID NO: 1.

[0079] In some embodiments, an RNA molecule comprises a nucleotide sequence encoding a fragment of a SARS- CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 400 or a sequence that is at least 70% identical to SEQ ID NO: 400 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 400),(b) a nucleotide sequence of SEQ ID NO: 402 or a sequence that is at least 70% identical to SEQ ID NO: 402 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 402),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 399, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 399 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 399); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of the following mutations: insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S31del, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, or any combination thereof, where mutations are shown relative to SEQ ID NO: 1.

[0080] In some embodiments, an RNA molecule comprises a nucleotide sequence encoding a fragment of a SARS- CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 404 or a sequence that is at least 70% identical to SEQ ID NO: 404 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 404),(b) a nucleotide sequence of SEQ ID NO: 406 or a sequence that is at least 70% identical to SEQ ID NO: 406 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 406),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 399, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 399 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 399); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S3 Idel, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, or any combination thereof, where mutations are shown relative to SEQ ID NO: 1.

[0081] In some embodiments, an RNA molecule comprises a nucleotide sequence encoding a fragment of a SARS- CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 408 or a sequence that is at least 70% identical to SEQ ID NO: 408 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 408),(b) a nucleotide sequence of SEQ ID NO: 410 or a sequence that is at least 70% identical to SEQ ID NO: 410 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 410),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 399, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 399 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 399); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S3 Idel, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, or any combination thereof, where mutations are shown relative to SEQ ID NO: 1.

[0082] In some embodiments, an RNA molecule comprises a nucleotide sequence encoding a SARS-CoV-2 S protein, or a fragment of an SARS-CoV-2 S protein, wherein:(a) if the RNA molecule encodes a SARS-CoV-2 S protein, the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S,S31F, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, K182N, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456V, N460K, S477N, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, P1143L, or any combination thereof, where positions are indicated relative to SEQ ID NO: 1; and(b) if the RNA molecule encodes a fragment of a SARS-CoV-2 S protein, the fragment of a SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S31F, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, K182N, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456V, N460K, S477N, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, P1143L, or any combination thereof, where positions are indicated relative to SEQ ID NO: 1, to the extent the mutations are in a region that is present in the fragment of the SARS-CoV-2 S protein; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0083] In some embodiments, an RNA molecule comprises(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 210 or 212, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 209 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 210 or 212; and / or(c) a nucleotide sequence of SEQ ID NO: 201 or 212; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0084] In some embodiments, an RNA molecule comprises(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 253 or 255, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 209 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 253 or 255; and / or(c) a nucleotide sequence of SEQ ID NO: 253 or 255; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0085] In some embodiments, an RNA molecule comprises(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 257 or 259, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 209 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 257 or 259; and / or(c) a nucleotide sequence of SEQ ID NO: 257 or 259; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0086] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 312 or a sequence that is at least 70% identical to SEQ ID NO: 312 {e.g, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 312),(b) a nucleotide sequence of SEQ ID NO: 314 or a sequence that is at least 70% identical to SEQ ID NO: 314 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 314),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 311, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 311 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 311); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S31F, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, K182N, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456V, N460K, S477N, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, or any combination thereof, where positions are indicated relative to SEQ ID NO: 1.

[0087] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 316 or a sequence that is at least 70% identical to SEQ ID NO: 316 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 316),(b) a nucleotide sequence of SEQ ID NO: 318 or a sequence that is at least 70% identical to SEQ ID NO: 318 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 318),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 311, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 311 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 311); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S31F, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, K182N, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456V, N460K, S477N, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, or any combination thereof, where positions are indicated relative to SEQ ID NO: 1.

[0088] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 320 or a sequence that is at least 70% identical to SEQ ID NO: 320 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 320),(b) a nucleotide sequence of SEQ ID NO: 322 or a sequence that is at least 70% identical to SEQ ID NO: 322 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 322),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 311, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 311 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 311); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S31F, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, K182N, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456V, N460K, S477N, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, or any combination thereof, where positions are indicated relative to SEQ ID NO: 1.

[0089] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 387 or a sequence that is at least 70% identical to SEQ ID NO: 387 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 387),(b) a nucleotide sequence of SEQ ID NO: 389 or a sequence that is at least 70% identical to SEQ ID NO: 389 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 389),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 386, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 386 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 386); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S31F, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, K182N, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456V, N460K, S477N, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, or any combination thereof, where positions are indicated relative to SEQ ID NO: 1.

[0090] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 391 or a sequence that is at least 70% identical to SEQ ID NO: 391 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 391),(b) a nucleotide sequence of SEQ ID NO: 393 or a sequence that is at least 70% identical to SEQ ID NO: 393 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 393),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 386, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 386 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 386); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S31F, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, K182N, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456V, N460K, S477N, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, or any combination thereof, where positions are indicated relative to SEQ ID NO: 1.

[0091] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 395 or a sequence that is at least 70% identical to SEQ ID NO: 395 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 395),(b) a nucleotide sequence of SEQ ID NO: 397 or a sequence that is at least 70% identical to SEQ ID NO: 397 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 397),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 386, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 311 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 386); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S31F, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, K182N, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456V, N460K, S477N, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, or any combination thereof, where positions are indicated relative to SEQ ID NO: 1.

[0092] In some embodiments, an RNA molecule comprises a nucleotide sequence encoding a SARS-CoV-2 S protein, or a fragment of an SARS-CoV-2 S protein, wherein:(a) if the RNA molecule encodes a SARS-CoV-2 S protein, the SARS-CoV-2 S protein comprises all of the following mutations insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S31del, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, F186L, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445R, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, K1086R, V1104L, and P1143L, where positions are indicated relative to SEQ ID NO: 1; and(b) if the RNA molecule encodes a fragment of a SARS-CoV-2 S protein, the fragment of a SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S31del, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, F186L, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445R, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, K1086R, V1104L, P1143L, where mutations are indicated relative to SEQ ID NO: 1, to the extent the mutations are in a region that is present in the fragment of the SARS-CoV-2 S protein; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0093] In some embodiments, an RNA molecule comprises:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 220 or 222, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 219 and / or (ii) one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 220 or 222; and / or(c) a nucleotide sequence of SEQ ID NO: 220 or 222; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0094] In some embodiments, an RNA molecule comprises:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 269 or 271, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 219 and / or (ii) one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 269 or 271; and / or(c) a nucleotide sequence of SEQ ID NO: 269 or 271; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0095] In some embodiments, an RNA molecule comprises:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 273 or 275, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 219 and / or (ii) one or more mutations corresponding to one or more of:: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 273 or 275; and / or(c) a nucleotide sequence of SEQ ID NO: 273 or 275; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0096] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 338 or a sequence that is at least 70% identical to SEQ ID NO: 338 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 338),(b) a nucleotide sequence of SEQ ID NO: 340 or a sequence that is at least 70% identical to SEQ ID NO: 340 e.g, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 340),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 337, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 337 {e.g, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 337); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S3 Idel, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, F186L, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445R, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, where mutations are indicated relative to SEQ ID NO: 1.

[0097] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 342 or a sequence that is at least 70% identical to SEQ ID NO: 342 {e.g, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 342),(b) a nucleotide sequence of SEQ ID NO: 344 or a sequence that is at least 70% identical to SEQ ID NO: 344 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 344),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 337, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 337 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 337); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S3 Idel, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, F186L, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445R, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, where mutations are indicated relative to SEQ ID NO: 1.

[0098] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 346 or a sequence that is at least 70% identical to SEQ ID NO: 346 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 346),(b) a nucleotide sequence of SEQ ID NO: 348 or a sequence that is at least 70% identical to SEQ ID NO: 348 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 348),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 337, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 337 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 337); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S3 Idel, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, F186L, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445R, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, where mutations are indicated relative to SEQ ID NO: 1.

[0099] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 413 or a sequence that is at least 70% identical to SEQ ID NO: 413 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 413),(b) a nucleotide sequence of SEQ ID NO: 415 or a sequence that is at least 70% identical to SEQ ID NO: 415 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 415),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 412, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 412 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 412); or(d) any combination of (a)-(c);[O1OO] optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S3 Idel, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, F186L, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445R, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, where mutations are indicated relative to SEQ ID NO: 1.[O1O1] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 417 or a sequence that is at least 70% identical to SEQ ID NO: 417 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 417),(b) a nucleotide sequence of SEQ ID NO: 419 or a sequence that is at least 70% identical to SEQ ID NO: 419 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 419),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 412, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 412 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 412); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S3 Idel, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, F186L, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445R, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, where mutations are indicated relative to SEQ ID NO: 1.

[0102] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 421 or a sequence that is at least 70% identical to SEQ ID NO: 421 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 421),(b) a nucleotide sequence of SEQ ID NO: 423 or a sequence that is at least 70% identical to SEQ ID NO: 423 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 423),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 412, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 337 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 412); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S3 Idel, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, F186L, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445R, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, where mutations are indicated relative to SEQ ID NO: 1.

[0103] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a SARS-CoV-2 S protein or a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) if the RNA molecule encodes a SARS-CoV-2 S protein, the SARS-CoV-2 S protein comprises all of the following mutations: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S31P, S50L, H69del, V70del,V127F, G142D, Y144del, F157S, R158G, K182R, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, K444R, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, and P1143L, where positions are indicated relative to SEQ ID NO: 1; and(b) if the RNA molecule encodes a fragment of a SARS-CoV-2 S protein, the fragment of a SARS-CoV-2 S protein comprises one or more of the following mutations insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S31P, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, K182R, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, K444R, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, P1143L, or any combination thereof, to the extent the mutations are in a region that is present in the fragment of the SARS-CoV-2 S protein; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0104] In some embodiments, an RNA molecule comprises:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 225 or 227, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 224 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 225 or 227; and / or(c) a nucleotide sequence of SEQ ID NO: 225 or 227; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0105] In some embodiments, an RNA molecule comprises:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 269 or 271, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 224 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: il or 279; and / or(c) a nucleotide sequence of SEQ ID NO: 269 or 271; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0106] In some embodiments, an RNA molecule comprises:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 281 or 283, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 224 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 281 or 283; and / or(c) a nucleotide sequence of SEQ ID NO: 281 or 283; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

[0107] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 351 or a sequence that is at least 70% identical to SEQ ID NO: 351 {e.g, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 351),(b) a nucleotide sequence of SEQ ID NO: 353 or a sequence that is at least 70% identical to 353 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 353),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 350, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 350 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 350); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S31P, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, K182R, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, K444R, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1.

[0108] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 355 or a sequence that is at least 70% identical to SEQ ID NO: 355 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 355),(b) a nucleotide sequence of SEQ ID NO: 357 or a sequence that is at least 70% identical to SEQ ID NO: 357 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 357),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 350, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 350 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 350); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S31P, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, K182R, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, K444R, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1.

[0109] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 359 or a sequence that is at least 70% identical to SEQ ID NO: 359 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 359),(b) a nucleotide sequence of SEQ ID NO: 361 or a sequence that is at least 70% identical to SEQ ID NO: 361 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 361),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 350, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 350 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 350); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S31P, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, K182R, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, K444R, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1.[O11O] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 426 or a sequence that is at least 70% identical to SEQ ID NO: 426 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 426),(b) a nucleotide sequence of SEQ ID NO: 428 or a sequence that is at least 70% identical to SEQ ID NO: 428 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 428),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 425, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 425 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 425); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S31P, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, K182R, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, K444R, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1.[Olli] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 430 or a sequence that is at least 70% identical to SEQ ID NO: 430 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 430),(b) a nucleotide sequence of SEQ ID NO: 432 or a sequence that is at least 70% identical to SEQ ID NO: 432 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 432),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 425, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 425 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 425); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S31P, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, K182R, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, K444R, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1.

[0112] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 434 or a sequence that is at least 70% identical to SEQ ID NO: 434 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 434),(b) a nucleotide sequence of SEQ ID NO: 436 or a sequence that is at least 70% identical to SEQ ID NO: 436 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 436),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 425, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 425 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 425); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S31P, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, K182R, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, K444R, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1.

[0113] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 299 or a sequence that is at least 70% identical to SEQ ID NO: 299 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 299),(b) a nucleotide sequence of SEQ ID NO: 301 or a sequence that is at least 70% identical to SEQ ID NO: 301 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 301),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 298, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 298 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 298); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S50L, F59S, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1.

[0114] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 303 or a sequence that is at least 70% identical to SEQ ID NO: 303 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 303),(b) a nucleotide sequence of SEQ ID NO: 305 or a sequence that is at least 70% identical to SEQ ID NO: 305 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 305),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 298, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 298 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 298); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S50L, F59S, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1.

[0115] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 307 or a sequence that is at least 70% identical to SEQ ID NO: 307 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 307),(b) a nucleotide sequence of SEQ ID NO: 309 or a sequence that is at least 70% identical to SEQ ID NO: 309 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 309),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 298, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 298 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 298); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S50L, F59S, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1.

[0116] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 440 or a sequence that is at least 70% identical to SEQ ID NO: 440 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 440),(b) a nucleotide sequence of SEQ ID NO: 376 or a sequence that is at least 70% identical to SEQ ID NO: 376 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 376),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 374, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 374 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 374); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S50L, F59S, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1.

[0117] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 378 or a sequence that is at least 70% identical to SEQ ID NO: 378 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 378),(b) a nucleotide sequence of SEQ ID NO: 380 or a sequence that is at least 70% identical to SEQ ID NO: 380 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 380),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 374, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 374 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 374); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S50L, F59S, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1.

[0118] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 382 or a sequence that is at least 70% identical to SEQ ID NO: 382 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 382),(b) a nucleotide sequence of SEQ ID NO: 384 or a sequence that is at least 70% identical to SEQ ID NO: 384 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 384),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 374, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 298 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 374); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S50L, F59S, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1.

[0119] In some embodiments, a modified uridine is Nl-methyl-pseudouridine and / or wherein the 5' cap comprises m27 3°Gppp(m i2' °)ApG.

[0120] In some embodiments, an RNA molecule is encapsulated in or associated with a lipid nanoparticle (LNP).

[0121] In some embodiments, a nucleotide sequence encoding a polypeptide has been codon-optimized (e.g., codon-optimized for expression in human cells) and / or has been enriched for a G / C content (e.g., has a total G / C content of 40% or higher, 50% or higher, 60% or higher, or 70% or higher).

[0122] In some embodiments, an RNA comprises a 5' cap, a cap proximal sequence, a 5' UTR sequence, a 3' UTR sequence, and a polyA sequence, optionally wherein:(a) the 5' cap comprises a Capl structure;(b) the 5'-UTR sequence comprises a modified human alpha-globin 5'-UTR;(c) the 3'-UTR sequence comprises a first sequence from the amino terminal enhancer of split (AES) messenger RNA and a second sequence from the mitochondrial encoded 12S ribosomal RNA;(d) the polyA sequence comprises at least 100 A nucleotides; or(e) a combination of any one of (i)-(iv).

[0123] In some embodiments,(a) the 5' cap comprises a Capl structure, and the Capl structure comprises m7(3'OMeG)(5')ppp(5')(2'OMeAl)pG2, wherein Al is position +1 of the RNA, and G2 is position +2 of the RNA;(b) the polyA sequence comprises an interrupted sequence of A nucleotides, optionally wherein the interrupted sequence comprises 30 adenine nucleotides followed by 70 adenine nucleotides, wherein the 30 adenine nucleotides and 70 adenine nucleotides are separated by a linker sequence, optionally wherein the interrupted polyA tail sequence comprises SEQ ID NO: 14, or a sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 14;(c) 5'-UTR sequence comprises SEQ ID NO: 12, or a sequence that is at least 70%, 75%, 80%, 85%,90%, 91%, 92%, 93%, 94%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 12;(d) the 3'-UTR sequence comprises SEQ ID NO: 13, or a sequence that is at least 70%, 75%, 80%,85%, 90%, 91%, 92%, 93%, 94%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 13; or(e) any combination of (a)-(e).

[0124] In some embodiments, an RNA is saRNA, self-amplifying RNA, trans-amplifying RNA (taRNA), or mRNA.

[0125] Among other things, the present disclosure describes a composition, where the composition comprises one or more RNA molecules described herein.

[0126] In some embodiments, a composition comprises one or more additional RNA molecules comprising a nucleotide sequence that encodes an S protein of a SARS-CoV-2 variant, optionally wherein the S protein encoded by each of the one or more additional RNA molecules is not an S protein of a JN.l, JN.1.2, JN.1.6, KP.2, XEC, JN.1.7, MV.1, MC.l, LP.8.1, and / or LF.7 SARS-CoV-2 variant.

[0127] In some embodiments, a composition comprise about 10 mM Tris buffer and about 10% sucrose.

[0128] In some embodiments, a composition is formulated as a multi-dose formulation in a vial.

[0129] In some embodiments, a composition is formulated to provide one or more unit doses, wherein each unit dose comprises about 100 pg or less (e.g., about 90 pg or less), or about 60 pg, about 30 pg, about 25 pg, about 20 pg, about 10 pg, about 6 pg, about 5 pg, about 3 pg, about 2 pg, about 1 pg, or about 0.5 pg of the RNA molecule.

[0130] Among other things, the present disclosure describes a method, where the method comprises administering to a subject an RNA molecule or a composition described herein. In some embodiments, a method can be a method of inducing an immune response against a coronavirus (e.g., a SARS-CoV-2 strain or variant). In some embodiments, a method can be a method for vaccinating a subject against a coronavirus (e.g., SARS-CoV-2 infection).

[0131] In some embodiments, a method comprises administering about 30 pg, about 20 pg, about 10 pg, about 5 pg, about 3 pg, about 2 pg, about 1 pg, or about 0.5 pg of the RNA molecule.

[0132] In some embodiments,(a) a subject is 12 years or older, and a method comprises administering about 30 pg, about 20 pg, about 10 pg, or about 5 pg of the RNA molecule;(b) a subject is 5 years to less than 12 years old, and a method comprises administering about 10 pg, about 6.6 pg, about 3.3 pg, or about 1.6 pg of an RNA molecule; or(c) a subject is 6 months to less than 5 years old, and a method comprises administering about 3 pg, about 2 pg, about 1 pg, or about 0.5 pg of an RNA molecule.

[0133] In some embodiments, a composition is administered in a volume of about 200 pL to 300 pL.

[0134] In some embodiments, a subject administered a composition was previously administered one or more doses of a SARS-CoV-2 vaccine or has not previously been administered one or more doses of a SARS-CoV-2 vaccine.

[0135] In some embodiments, a method described herein further comprises co-administering one or more vaccines against a non-SARS-CoV-2 disease.

[0136] In some embodiments, one or more vaccines against a non-SARS-CoV-2 disease comprise an RSV vaccine, an influenza vaccine, or a combination thereof.Brief Description of the Figures

[0137] Fig. 1. Experimental design for a study to characterize immune responses induced by variant- adapted vaccines in SARS-CoV-2 vaccine-experienced mice. Mice are split into 9 groups, each of which is administered a first dose of an RNA molecule encoding a SARS-CoV-2 S protein of a Wuhan strain (BNT162b2) and a second dose of a variant-adapted vaccine (e.g., (i) a monovalent vaccine comprising an RNA molecule that encodes an S protein of an XBB.1.5-adapted vaccine, or (ii) a bivalent composition comprising a first RNA molecule encoding a SARS-CoV-2 S protein of a Wuhan strain and a second RNA molecule encoding a SARS-COV-2 S protein of a SARS- CoV-2 variant (e.g., an Omicron BA.4 / 5 variant as shown in the Figure (BNT162b2 + BA.4 / 5)). Following the second dose, mice are administered a composition comprising an RNA molecule encoding a SARS-CoV-2 S protein of a strain or variant or combination of strains / variants, as indicated in the Figure. The first and second doses are administered 21 days apart, and the third dose is administered about 70 days after the third dose. 119 days after administering the first dose, mice are sacrificed and the experiment concluded.

[0138] Fig. 2. Experimental design for a study to characterize variant-adapted vaccines in SARS-CoV-2 vaccine-experienced mice. Mice are split into 6 groups, each of which is administered a first and a second dose of an RNA molecule encoding a SARS-CoV-2 S protein of a Wuhan strain (BNT162b2), followed by a third dose of a monovalent or multivalent RNA composition comprising an RNA molecule encoding an S protein of a SARS-CoV-2 variant (e.g., (i) a monovalent composition comprising an RNA molecule encoding a SARS-CoV-2 S protein of an XBB.1.5 variant, or (ii) a bivalent composition comprising a first RNA molecule encoding a SARS-CoV-2 S protein of a Wuhan strain and a second RNA molecule encoding a SARS-CoV-2 S protein of a BA.4 / 5 Omicron variant (BNT162b2 + BA.4 / 5), as shown in the Figure). Following the third dose, mice are administered a composition comprising an RNA molecule encoding a SARS-CoV-2 S protein of a variant or strain or combination of strains / variants, as indicated in the Figure. The first and second doses are administered an appropriate amount of time apart (e.g., 21 days apart, as shown in the Figure), the third dose is administered an appropriate amount of time after the second dose (e.g., 70 days after the second dose, as shown in the Figure) and the 4th dose is administered an appropriate amount of time after the third dose (e.g., 126 days after the first dose, as shown in the Figure). 126 days after administering the first dose, mice are sacrificed and the experiment concluded.

[0139] Fig. 3. Example experimental protocol for testing variant-adapted vaccines as a primary series in mice. Two doses of a monovalent or bivalent vaccine composition comprising RNA molecule(s) encoding a SARS- CoV-2 S protein(s) (e.g., vaccine compositions comprising RNA molecule(s) encoding an S protein of the strains / variants indicated in the Figure) are administered to mice an appropriate amount of time apart (e.g., 21 days apart, as shown in the Figure). "WT" corresponds to an RNA molecule encoding a SARS-CoV-2 S protein from a Wuhan strain. Indicated in the Figure is the mass of RNA (pg) administered to mice.

[0140] Fig. 4. Example experimental protocol for testing variant-adapted vaccines as a fourth booster dose in mice. "BNT162b2 Original WT" corresponds to a monovalent mRNA vaccine encoding a SARS-CoV-2 S protein of a Wuhan strain, "BNT162b2 Bivalent WT + BA.4 / 5" corresponds to a bivalent vaccine comprising an RNA molecule encoding an S protein of a Wuhan strain and an RNA molecule encoding a SARS-CoV-2 S protein of an Omicron BA.4 / 5 variant. On day 134, mice are administered a monovalent or bivalent vaccine encoding one of the strains, variants, or combinations indicated in the Figure. On days 134 and 160, blood samples are collected (represented by the test tube racks).

[0141] Fig. 5. List of exemplary mutations associated with the S protein of certain SARS-CoV-2 variants.

[0142] Fig. 6. Experimental Design Used to Characterize Immune Responses in Vaccine-Experienced Subjects (Mice). Shown is an experimental protocol that was used to characterize immune responses induced by RNA-LNP compositions described herein. Mice in each of the "XBB.1.5," "JN.l," and "KP.2" vaccine groups were administered (1) two doses, 21 days apart, of an RNA-LNP composition comprising an RNA encoding an S protein of a Wuhan SARS-CoV-2 strain ("Wuhan (WT) RNA-LNP"), (2) one dose, 49 days after administering the first dose of the Wuhan-adapted RNA-LNP composition, of a bivalent RNA-LNP composition comprising an RNA encoding an S protein of a Wuhan SARS-CoV-2 strain and an RNA encoding an S protein of an Omicron BA.4 / 5 SARS-CoV-2 variant C'WT + BA.4 / 5 RNA-LNP"), (3) one dose, 84 days after administering the first dose of the Wuhan-adapted RNA-LNP composition, of an RNA-LNP composition comprising an RNA encoding an S protein of an Omicron XBB.1.5 SARS- CoV-2 variant ("XBB.1.5 RNA-LNP") and (4) one dose, administered 111 days after the first dose of the Wuhan (WT) RNA-LNP composition, of an RNA-LNP composition comprising an RNA encoding an S protein of an XBB.1.5, JN. l, or KP.2 SARS-CoV-2 variant ("XBB.1.5 RNA-LNP," "JN.l RNA-LNP," and "KP.2 RNA-LNP," respectively). Ill days after administering the first dose of Wuhan (WT) RNA-LNP sera samples were collected (indicated by blood droplets in the Fig. 6). 140 days after administering the first dose of Wuhan (WT) RNA-LNP, the experiment was concluded and final sera and splenocyte samples were collected.

[0143] Fig. 7. JN.l- and KP.2-Adapted Vaccines Neutralize JN.l Sublineages Broadly. Shown are pseudovirus neutralization titers measured for the sera samples collected at day 140 in the experimental design described in Fig. 6. The x-axis indicates the composition administered on day 111. Each bar corresponds to the 50% neutralization titers (geometric mean titers (GMT)) measured using a pseudovirus neutralization assay for the indicated SARS-CoV-2 strain or variant, where titers are shown above each bar. As shown, JN.l and KP.2-adapted RNA induced high neutralization titers against JN. l sublineages, and were significantly improved as compared to the XBB.1.5 RNA-LNP composition.

[0144] Fig. 8. Experimental Design Used to Characterize Immune Responses in Vaccine-Naive Subjects (Mice). Shown is an experimental protocol that was used to characterize immune responses induced by compositions described herein in vaccine-naive mice (i.e., mice not previously administered a vaccine). Each group of mice were administered two doses of an RNA-LNP composition comprising an RNA encoding an XBB.1.5, JN. l, or KP.2 S protein 21 days apart. 49 days after administering the first dose of the RNA-LNP composition, the experiment was concluded and final sera samples and splenocyte samples were collected.

[0145] Fig. 9. JN.l- and KP.2-Adapted Vaccines Neutralize JN.l Sublineages Broadly in Vaccine-Naive Subjects (Mice). The x-axis indicates the RNA-LNP composition administered. Each bar corresponds to the 50% neutralization titers (geometric mean titers (GMT)) measured using a pseudovirus neutralization assay for the indicated SARS-CoV-2 strain or variant, where the titers measured are shown above each bar. As shown, RNA-LNP composition comprising an RNA encoding a JN.l or KP.2 S protein induced high neutralization titers against a broad range of JN. l sublineages, which were consistently higher than those induced by the RNA-LNP composition comprising an RNA encoding an S protein of an XBB.1.5 variant.Detailed DescriptionDefinitions

[0146] The term "about" means approximately or nearly, and in the context of a numerical value or range set forth herein, in one embodiment, means ± 20%, ± 10%, ± 5%, or ± 3% of the numerical value or range recited or claimed.

[0147] The terms "a" and "an" and "the" and similar reference used in the context of describing the present disclosure (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it was individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or Example language (e.g., "such as"), provided herein is intended merely to better illustrate the disclosure and does not pose a limitation on the scope of the claims. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the disclosure.

[0148] As used herein, an "Omicron Variant" (also referred to as B.1.1.529) refers to the SARS-CoV-2 variant first reported to the World Health Organization (WHO) by the Network for Genomics Surveillance in South Africa on November 24, 2021, and subvariants thereof (including, e.g., BA.l, BA.2, BA.4, BA.5, BQ.l, BQ.1.1, XBB. l, XBB.1.5, JN. l, JN.1.6, JN.1.1.2, KP.2, KP.3, XEC and JN.1.1.7, among others).

[0149] As used herein, the term "corresponding to" refers to a relationship between two or more entities. For example, the term "corresponding to" may be used to designate the position / identity of a structural element in a compound or composition relative to another compound or composition e.g., to an appropriate reference compound or composition). For example, in some embodiments, a monomeric residue in a polymer (e.g., an amino acid residue in a polypeptide or a nucleic acid residue in a polynucleotide) may be identified as "corresponding to" a residue in an appropriate reference polymer. For example, those of ordinary skill will appreciate that, for purposes of simplicity, residues in a polypeptide are often designated using a canonical numbering system based on a reference related polypeptide, so that an amino acid "corresponding to" a residue at position 190, for example, need not actually be the 190thamino acid in a particular amino acid chain but rather corresponds to the residue found at 190 in the reference polypeptide; those of ordinary skill in the art readily appreciate how to identify "corresponding" amino acids. For example, those skilled in the art will be aware of various sequence alignment strategies, including software programs such as, for example, BLAST, CS-BLAST, CUSASW++, DIAMOND, FASTA, GGSEARCH / GLSEARCH, Genoogle, HMMER, HHpred / HHsearch, IDF, Infernal, KLAST, USEARCH, parasail, PSI-BLAST, PSI-Search, ScalaBLAST, Sequilab, SAM, SSEARCH, SWAPHI, SWAPHI-LS, SWIMM, or SWIPE that can be utilized, for example, to identify "corresponding" residues in polypeptides and / or nucleic acids in accordance with the present disclosure. Those of skill in the art will also appreciate that, in some instances, the term "corresponding to" may be used to describe an event or entity that shares a relevant similarity with another event or entity (e.g., an appropriate reference event or entity). To give but one example, a gene or protein in one organism may be described as "corresponding to" a gene or protein from another organism in order to indicate, in some embodiments, that it plays an analogous role or performs an analogous function and / or that it shows a particular degree of sequence identity or homology, or shares a particular characteristic sequence element.

[0150] As those skilled in the art are aware, sequence alignment strategies enable consideration, for example, of "gaps" in sequences, and / or of "repeated" residues. Moreover, those skilled in the art understand that insome cases, it is not possible to unambiguously determine the exact location of a sequence change relative to a reference sequence. For example, when a reference sequence includes a stretch of two or more contiguous identical residues, and a changed sequence has one fewer of the residues, it is not possible to assign a particular singular residue in the reference sequence as the one that was deleted, as deletion of any one of the identical contiguous residues would generate the same changed sequence. Those skilled in the art therefore appreciate the convention of arbitrarily assigning one of the reference residue positions as the deleted residue. To give a specific example, SEQ ID NO: 1 is a polypeptide sequence in which two adjacent Y residues are present at positions 144 and 145. If one of these amino acid residues is deleted, a person of skill in the art will not be able to determine whether amino acid 144 or 145 has been deleted in the changed sequence. They will understand, however, that either deletion describes the same polypeptide sequence, and therefore will be able to unambiguously determine the sequence of a polypeptide described as having a deletion at position 144 or 145 of SEQ ID NO: 1 (i.e., they will understand that a polypeptide described as having a deletion at a position corresponding to position 144 of SEQ ID NO: 1 and a polypeptide described as having a deletion at a position corresponding to position 145 of SEQ ID NO: 1 have the same amino acid sequence).RNA

[0151] In the present disclosure, the term "RNA" or "mRNA molecule" relates to a nucleic acid molecule which includes ribonucleotide residues. In preferred embodiments, RNA contains all or a majority of ribonucleotide residues. As used herein, "ribonucleotide" refers to a nucleotide with a hydroxyl group at the 2'-position of a p-D-ribofuranosyl group. RNA encompasses, without limitation, double stranded RNA, single stranded RNA, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as modified RNA that differs from naturally occurring RNA by the addition, deletion, substitution and / or alteration of one or more nucleotides. In some embodiments, such alterations refer to the addition of non-nucleotide material to internal RNA nucleotides or to the end(s) of RNA. It is also contemplated herein that nucleotides in RNA may be non-standard nucleotides, such as chemically synthesized nucleotides or deoxynucleotides. For the present disclosure, these altered RNAs are considered analogs of naturally-occurring RNA.

[0152] As used herein, the term "RNA" or "RNA molecule" encompasses, without limitation, an mRNA molecule and an saRNA molecule. In some embodiments, an RNA molecule does not comprise any modified nucleotides (aside from a 5' cap). In some embodiments, an RNA molecule comprises uridines. In some embodiments, an RNA molecule comprises only uridine molecules (e.g., does not comprise any modified uridines).

[0153] In certain embodiments of the present disclosure, an RNA molecule is a messenger RNA (mRNA) molecule, which relates to an RNA transcript which encodes a peptide or protein. As established in the art, an mRNA molecule generally contains a 5' untranslated region (5'-UTR), a peptide coding region, and a 3' untranslated region (3'-UTR). In some embodiments, an RNA molecule described herein is produced by in vitro transcription or chemical synthesis. In one embodiment, an mRNA molecule described herein is produced by in vitro transcription using a DNA template, where DNA refers to a nucleic acid that contains deoxyribonucleotides.

[0154] In some embodiments, an RNA molecule described herein comprises one or more modified nucleosides. In some embodiments, an RNA molecule comprises a modified nucleoside in place of at least one e.g., every) uridine. In some embodiments, one or more uridines in an RNA molecule described herein is replaced by a modifiednucleoside. In some embodiments, an RNA molecule comprises a modified nucleoside in place of each uridine. In some embodiments, a modified nucleoside is a modified uridine.

[0155] In some embodiments, a modified uridine is Nl-methyl-pseudouridine (mli ), which has the structure:

[0156] In some embodiments, an RNA molecule according to the present disclosure comprises a 5'-cap. The term "5’-cap" refers to a structure found on the 5’-end of an RNA molecule and generally comprises a guanosine nucleotide connected to the RNA molecule via a 5'- to 5'-triphosphate linkage. In some embodiments, this guanosine is methylated at the 7-position. In some embodiments, an RNA molecule comprising a 5'-cap or 5'-cap analog can be produced by in vitro transcription, in which the 5'-cap or 5'-cap analog is co-transcriptionally incorporated into the RNA molecule. In one embodiment, a 5'-cap or 5' cap analog may be attached to RNA post-transcriptionally, e.g., using capping enzymes.

[0157] In some embodiments, a building block cap for an RNA molecule is m27'3 OGppp(mi2' °)ApG (also sometimes referred to as m27,3' OG(5')ppp(5')m2'-OApG), which has the following structure:

[0158] In some embodiments, an RNA molecule according to the present disclosure comprises a 5'-UTR sequence. In some embodiments, a 5'-UTR sequence is derived from the human alpha-globin mRNA. In some embodiments, the 5'-UTR sequence is derived from the human alpha-globin mRNA and has an optimized 'Kozak sequence' to increase translational efficiency.

[0159] In some embodiments, an RNA molecule encoding an amino acid sequence comprising a SARS-CoV-2 S protein, an immunogenic variant thereof, or an immunogenic fragment of the SARS-CoV-2 S protein or the immunogenic variant thereof comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 12, or anucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the nucleotide sequence of SEQ ID NO: 12.

[0160] In some embodiments, an RNA molecule according to the present disclosure comprises a 3'-UTR sequence. In some embodiments, a combination of two sequence elements (FI element) derived from the "amino terminal enhancer of split" (AES) mRNA (called F) and the mitochondrial encoded 12S ribosomal RNA (called I) are placed between the coding sequence and the poly(A) sequence of an RNA molecule to increase maximum protein levels and prolonged persistence of the RNA (e.g., mRNA) molecule. In some embodiments, two re-iterated 3'-UTRs derived from the human beta-globin mRNA are placed between the coding sequence and the poly(A) sequence of an RNA molecule to assure higher maximum protein levels and prolonged persistence of the RNA (e.g., mRNA) molecule.

[0161] In some embodiments, an RNA molecule encoding an amino acid sequence comprising a SARS-CoV-2 S protein, an immunogenic variant thereof, or an immunogenic fragment of the SARS-CoV-2 S protein or the immunogenic variant thereof comprises a 3' UTR comprising the nucleotide sequence of SEQ ID NO: 13, or a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the nucleotide sequence of SEQ ID NO: 13.

[0162] In some embodiments, an RNA molecule according to the present disclosure comprises a poly(A) sequence at the 3' terminus. In some embodiments, a poly(A) sequence measuring about 110 nucleotides in length, comprising (e.g., consisting) of a stretch of about 30 adenosine residues, followed by a linker sequence (e.g., a sequence comprising one or more (e.g., all) non-adenosine residues and / or a linker sequence that is about 10 nucleotides long) and another stretch of about 70 adenosine residues is used. In some embodiments, such a poly(A) sequence can enhance RNA stability and translational efficiency.

[0163] In some embodiments, a poly-A sequence comprises at least 100 nucleotides.

[0164] In some embodiments, a poly-A sequence comprises or consists of the nucleotide sequence of SEQ ID NO: 14, or a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identical to SEQ ID NO: 14.

[0165] In some embodiments, a 3' UTR (e.g., a 3' UTR comprising a sequence that is at least 80% identical to SEQ ID NO: 13) is immediately adjacent to and downstream of a sequence encoding an antigenic polypeptide. In some embodiments, an RNA molecule comprising a 3' UTR that comprises a nucleotide sequence that is at least 80% identical to SEQ ID NO: 13 comprises an intervening sequence that is downstream of the sequence encoding an antigenic polypeptide and upstream of the sequence that is at least 80% identical to SEQ ID NO: 13. In some embodiments, the intervening sequence comprises, in the 5' to 3' direction, the sequence CUCGAG. In some embodiments, the intervening sequence comprises, in the 5' to 3' direction, the sequence GGAUCCGAU.

[0166] In some embodiments, a 3' UTR is adjacent to (e.g., immediately adjacent to and upstream of) a polyA sequence (e.g., a polyA sequence that is at least 80% identical to SEQ ID NO: 14). In some embodiments, a 3' UTR comprises a nucleotide sequence that is at least 80% identical to SEQ ID NO: 13 and a polyA sequence (e.g., a sequence that is at least 80% identical to SEQ ID NO: 14), where there is an intervening sequence between the nucleotide sequence that is at least 80% identical to SEQ ID NO: 14 and the polyA sequence. In some embodiments, the intervening sequence comprises, in the 5' to 3' direction, the sequence CUXGAGCUAGC (SEQ ID NO: 176), where X is G, C, A, or U. In some embodiments, the intervening sequence comprises, in the 5' to 3' direction, the sequence GAGACCUGGUCCAGAGUCGCUAGCCGCGUCGCU (SEQ ID NO: 177).

[0167] In some embodiments, an RNA molecule comprises non-coding elements as described in WO2021 / 213924, WO2023 / 285560A1, or WO2021 / 214204, the contents of each of which is incorporated by reference herein in their entirety.

[0168] In some embodiments, an RNA molecule comprises a 5' cap, a cap proximal sequence e.g., a sequence at the 5' terminus of the RNA molecule, immediately adjacent to the G of the 5' cap), or a combination thereof that is described in W02023 / 073190A1 or WO2021 / 214204, the contents of each of which are incorporated by reference herein in their entirety. For example, in some embodiments, an RNA molecule comprises AGAAU at its 5' terminus. In some embodiments, an RNA molecule comprises AGCAC at its 5' terminus.RNA Encoding a SARS-CoV-2 S protein ofa JN.l, JN.1.6, JN.1.7, KP.2, KP.3, XECJN.1.2, MV.l, MC.l, LP.8.1, or LF.7 VariantTable 11. Exemplary mutations present in the S protein of certain SARS-CoV-2 variants (mutation positions indicated relative to SEQ ID NO: 1)

[0169] The JN.l variant emerged in August 2023, in Luxembourg. It is a descendant of the BA.2.86 variant.BA.2.86 initially drew the attention of health authorities because it had a large number of S protein mutations as compared to previous variants (~30 more than other variants circulating at the time). BA.2.86 never came to dominate circulating SARS-CoV-2 variants, however. Unlike BA.2.86, the JN. l variant (and descendants thereof) has the ability to transmit efficiently between humans, an ability that is thought to be due to the acquisition of an L455S mutation in the S protein (position shown relative to SEQ ID NO: 1). The JN.l rapidly came to dominate SARS-CoV-2 variants, increasing from less than 5% of all variants sequenced in November 2023, to 60% of variants sequenced by January 2024.

[0170] Since the emergence of JN. l, descendants of JN.l have arisen and quickly supplanted the JN. l variant.These JN. l descendants include "SLip" variants (including, e.g., JN.l.16), which include L455S and F456L mutations; and "FLiRT" variants (including, e.g., KS.1.1, KP.2), which include the mutations associated with SLip variants and an additional R346T mutation. FLuQE variants (e.g., KP.3.3), in turn, are descendants of the FLiRT variants, and include the same mutations plus an additional Q493E mutation. The 455 position has also continued to be a mutation hot spot, with "FLip" including mutations L455F and F456L.

[0171] The XEC variant is a hybrid of the KS.1.1 and KP.3.3 variants. A description of the emergence of the JN. l variant and descendants thereof, is provided, e.g., in E. Topol, "Are We FLiRTing With A New Covid Wave?," April 18,2024, accessible at erictopol.substack.com / p / are-we-flirting-with-a-new-covid; and Sankaran, V. "New Covid XEC variant starting to spread in Europe - what we know," September 16, 2024, Independent, accessible at www independent.co.uk / news / science / covid-variant-xec-europe-symptoms-b2.61348S.html, the contents of both of which are incorporated by reference herein in their entirety.

[0172] The MC.l strain is a descendent of the KP.3.1.1 variant, and while it only accounts for 5% of cases, it has caused a growing number of infections as well.

[0173] The LP.8.1 variant has been observed to rapidly outcompete existing liages such as XEC and KP.3.1.1. Is a subvariant of KP.1.1. Expected to have superior immune evasion, enhaced ACE2 bidning, higher growth advantage. Further discussion in Liu, Jingyi, et al. "Virological and antigenic characteristics of SARS-CoV-2 variants LF. 7.2. 1, NP.1, and LP. 8.1." The Lancet Infectious Diseases (2025), the contents of which are incorporated by reference herein in their entirety.

[0174] LP.8.1 is a relatively fast growing lineage, and comprises an S protein that is effectively the same ass that in the KP.3.1.1 variant, with 5 additional Spike mutations: F186L, R190S, R346T, H445R, and K1086R.

[0175] LP.8.1 was first detected through US airport surveillance from a Philippines traveler on 2024-09-06, followed by a second sequence from German RKI on 2024-09-12. Subsequently, numerous sequences have been submitted from Singapore, Canada and US airport surveillance, with the first 5 travel-linked all linked to Philippines travel. Notably, while the 30 sequences from the Philippines collected between August and October 2024 suggest LF.7.1 dominance there, LP.8.1 appears to be spreading efficiently internationally.

[0176] The sublineage, LP.8.1.1, defined by an additional S: K679R mutation, appears to confer an extra growth advantage of approximately 10-30% per week. 679 is adjacent to the Furin cleavage site. This is not the first mutation at the site, it already mutated from wild-type N to K in all Omicrons. The further mutation to R has been observed multiple times but never before appeared so early in a fast-growing lineage's evolution.

[0177] Based on current data, LP.8.1.1 shows the highest growth rate among known lineages with a doubling time of slightly below 2 weeks - though relative fitness likely varies by region depending on the presence of other lineages and population immunity profiles.

[0178] MV. l was first sequenced in Cote d'Ivoire, Egypt and Senegal at the end of June 2024, despite low overall sequencing rates in Africa. This strongly suggests it first became common in Africa. MV.l is descended from JN.1.49 by way of MB.1.1.1. Due to lack of recent samples from Africa, the current prevalence of MV.l is unclear. The country with the highest reported proportion in recent sequences is Qatar where LF.7 may have been dominant at the end of September 2024.

[0179] In some embodiments, RNA described herein encodes a SARS-CoV-2 S protein comprising one or more mutations characteristic of a JN.l, JN.1.2, JN.1.6, KP.2, KP.3, XEC JN.1.7, MV. l, MC.l, LP.8.1, and / or LF.7 variant e.g, one or more mutations described herein). In some embodiments, the one or more mutations include a mutation at a position corresponding to position 455 of SEQ ID NO: 1 (e.g., L455S). In some embodiments, the one or more mutations include mutations at a position corresponding to position 455 of SEQ ID NO: 1 (e.g., L455F). In some embodiments, the one or more mutations include a mutation at a position corresponding to position 456 of SEQ ID NO: 1 (e.g., F456L). In some embodiments, the one or more mutations include mutations at positions corresponding to positions 455 and 456 of SEQ ID NO: 1 (e.g., F456L and L455F). In some embodiments, the one or mutations include a mutation at a position corresponding to position 346 of SEQ ID NO: 1 (e.g., R346T). In some embodiments, the one or more mutations include a mutation at a position corresponding to position 1104 of SEQ ID NO: 1 (e.g., V1104L). In some embodiments, the one or more mutations include mutations at positions corresponding to positions 346 and 1104 of SEQ ID NO: 1 (e.g., R346T and V1104L).

[0180] In some embodiments, one or more mutations associated with a given variant include one or more of the mutations listed in Table 11.

[0181] In some embodiments, one or more mutations characteristic of a JN.l variant include one or more of {e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63 or more of (e.g., all of) insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H,N969K, P1143L, or any combination thereof, where mutations are indicated relative to SEQ ID NO: 1. In some embodiments, one or more mutations characteristic of a JN.l variant include insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, and P1143L, relative to SEQ ID NO: 1. In some embodiments, one or mutations characteristic of a JN. l variant include L455S.

[0182] In some embodiments, one or more mutations characteristic of a JN.1.6 variant include one or more of {e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63 or more of (e.g., all of) insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, and P1143L, where mutations are indicated relative to SEQ ID NO: 1. In some embodiments, one or more mutations characteristic of a JN.1.6 variant include R346T.

[0183] In some embodiments, one or more mutations characteristic of a JN.1.7 variant include one or more of {e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63 or more of (e.g., all of) insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, T572I, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, P1143L, and E1150D, where mutations are indicated relative to SEQ ID NO: 1.

[0184] In some embodiments, one or more mutations characteristic of a JN.1.7 variant include one or more of {e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63 or more of (e.g., all of) insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, T572I, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, and P1143L, where mutations are indicated relative to SEQ ID NO: 1. In some embodiments, one or more mutations characteristic of a JN.1.7 variant include E1150D and / or T572I, wherein positions are indicated relative to SEQ ID NO: 1.

[0185] In some embodiments, one or more mutations characteristic of a JN.1.2 variant include one or more of {e.g, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63 or more of (e.g., all of) insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K,F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, P1143L, and M1229I, where mutations are indicated relative to SEQ ID NO: 1. In some embodiments, one or more mutations characteristic of a JN.1.2 variant include M1229I, where position is indicated relative to SEQ ID NO: 1.

[0186] In some embodiments, one or more mutations characteristic of a KP.2 variant include one or more of (e. ., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63 or more of (e.g., all of) insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, and P1143L, where mutations are indicated relative to SEQ ID NO: 1. In some embodiments, one or mutations characteristic of a KP.2 variant include R346T and V1104L, where positions are indicated relative to SEQ ID NO: 1. In some embodiments, one or mutations characteristic of a KP.2 variant include R346T, F456L, and / or V1104L, where positions are indicated relative to SEQ ID NO: 1.

[0187] In some embodiments, one or more mutations characteristic of a KP.3 variant include one or more of (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63. 64, 65 or more of (e.g., all of) insl6MPLF, T19, A24-26, A27S, S50L, A69 / 70, V127F, G142D, A144, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q493E, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof. In some embodiments one or more mutations characteristic of a KP.3 variant include F456L, Q493E, and / or V1104L, wherein positions are indicated relative to SEQ ID NO: 1.

[0188] In some embodiments, one or more mutations characteristic of a XEC variant include one or more of e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 67 or more of (e.g., all of) insl6MPLF, T19I, R21T, T22N, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, where mutations are indicated relative to SEQ ID NO: 1. In some embodiments one or more mutations characteristic of a XEC variant include T22N, F59S, F456L, Q493E, and / or V1104L, wherein positions are indicated relative to SEQ ID NO: 1.

[0189] In some embodiments, one or more mutations characteristic of an MV.l variant include one or more of (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67 or more of (e.g., all of) insl6MPLF, T19I, R21T, T22N, A24-26, A27S, S31F, S50L, A69-70, V127F, G142D, A144, F157S, R158G, K182N, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T,K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456V, N460K, S477N, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, or P1143L, where mutations are indicated relative to SEQ ID NO: 1.

[0190] In some embodiments, one or more mutations characteristic of an MC.l variant include one or more of (e.g, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68 or more of (e.g., all of) Insl6MPLF, T19I, R21T, A24-26, A27S, A31, S50L, A69-70, V127F, G142D, A144, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q493E, Q498R, N501Y, Y505H, E554K, A570V, T572I, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, or P1143L, where mutations are indicated relative to SEQ ID NO: 1.

[0191] In some embodiments, one or more mutations characteristic of an LP.8.1 variant include one or more of (e.g, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 67, 68, 69, 70, 71 or more of (e.g., all of) Insl6MPLF, T19I, R21T, A24-26, A27S, A31, S50L, A69-70, V127F, G142D, A144, F157S, R158G, F186L, R190S, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445R, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q493E, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, K1086R, V1104L, or P1143L, where mutations are indicated relative to SEQ ID NO: 1. In some embodiments one or more mutations characteristic of an LP.8.1 variant include A31, F186L, R190S, R346T, V445R, F456L, Q493E, K1086R, and / or V1104L, wherein positions are indicated relative to SEQ ID NO: 1.

[0192] In some embodiments, one or more mutations characteristic of an LF.7 variant include one or more of e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 or more of (e.g., all of) Insl6MPLF, T19I, R21T, T22N, A24-26, A27S, S31P, S50L, A69-70, V127F, G142D, A144, F157S, R158G, K182R, R190S, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, K444R, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, or P1143L, where mutations are indicated relative to SEQ ID NO: 1.

[0193] In the present disclosure, when counting the number of mutations in a sequence, each change in an individual amino acid position is counted as one mutation (e.g., A69-70 is counted as two mutations).

[0194] In some embodiments, an S protein encoded by an RNA molecule comprises a majority of mutations associated with a JN.l variant (e.g., as described herein) and one or more additional mutations. In some embodiments an S protein comprises 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63 or more (e.g., all of) mutations associated with a JN.l variant (e.g., as described herein) and one or more additional mutations. In some embodiments, the one or more additionalmutations include one or more of R346T, T572I, E1150D, and M1229I. In some embodiments, an S protein of a JN.1.6 variant includes a majority of mutations associated with a JN. l variant and a mutation at a position corresponding to position 346 (e.g., R346T), where the position of the 346 mutation is indicated relative to SEQ ID NO: 1. In some embodiments, an S protein of a JN.1.7 variant comprises a majority of mutations associated with a JN.l variant and mutations at positions corresponding to positions 572 and 1150 (e.g., T572I and / or E1150D), where the position of the 572 and 1150 mutations is indicated relative to SEQ ID NO: 1. In some embodiments, an S protein of a JN.1.2 variant comprises one or more mutations associated with a JN.l variant and a mutation at a position corresponding to position 1229 (e.g., M1229I), where the location of the 1229 mutation is indicated relative to SEQ ID NO: 1.

[0195] In some embodiments, an S protein encoded by an RNA molecule comprises a majority of mutations associated with a KP.2, KP.3, or XEC variant and one or more additional mutations. In some embodiments an S protein comprises 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63 or more of (e.g., all of) mutations associated with a KP.2, KP.3, or XEC variant {e.g., mutations provided herein) and one or more additional mutations.

[0196] In some embodiments, an S protein comprises a majority of mutations associated with a JN. l variant (e.g., as described herein) and one or more additional mutations. In some embodiments, an S protein comprises a majority of mutations associated with a JN.l variant (e.g., as described herein) and one or more additional mutations associated with a descendent or group of descendants of a JN. l variant (e.g., a descendant or a group of descendants described herein). In some embodiments, an S protein comprises a majority of mutations associated with a JN.l variant (e.g., as described herein) and one or more additional mutations associated with increased spread of a descendent of a JN.l variant (e.g., a descendant described herein).

[0197] In some embodiments, an S protein comprises a majority of mutations associated with a JN. l variant (e.g., as described herein) and:(a) a mutation at a position corresponding to position 22 of SEQ ID NO: 1 (e.g., T22N);(b) a mutation at a position corresponding to position 31 of SEQ ID NO: 1 (e.g., A31 and S31L);(c) a mutation at a position corresponding to position 59 of SEQ ID NO: 1 (e.g., F59S);(d) a mutation at a position corresponding to position 182 of SEQ ID NO: 1 (e.g., K182N or K182R);(e) a mutation at a position corresponding to position 186 of SEQ ID NO: 1 (e.g., F186L);(f) a mutation at a position corresponding to position 190 of SEQ ID NO: 1 (e.g., R190S);(g) a mutation at a position corresponding to position 346 of SEQ ID NO: 1 (e.g., R346T);(h) a mutation at a position corresponding to position 444 of SEQ ID NO: 1 (e.g., K444R);(i) a mutation at a position corresponding to position 445 of SEQ ID NO: 1 (e.g., V445R);(j) a mutation at a position corresponding to position 456 of SEQ ID NO: 1 (e.g., F456L);(k) mutations at positions corresponding to positions 455 and 456 of SEQ ID NO: 1 (e.g., L455S and F456L);(l) a mutation at a position corresponding to position 493 of SEQ ID NO: 1 (e.g., Q493E);(m) a mutation at a position corresponding to position 572 of SEQ ID NO: 1 (e.g., T572I);(n) a mutation at a position corresponding to position 1086 of SEQ ID NO: 1 (e.g., K1086R);(o) a mutation at a position corresponding to position 1104 of SEQ ID NO: 1 (e.g., V1104L); or(p) any combination of (a)-(o).

[0198] In some embodiments, an S protein comprises a majority of mutations associated with a KP.2 and / or JN. l variant and one or more additional mutations. In some embodiments, an S protein comprises a majority of mutations associated with a KP.2 and / or JN.l variant and a mutation at a position corresponding to position 493 of SEQ ID NO: 1 (e.g., Q493E).

[0199] In some embodiments, an S protein of a XEC variant includes a majority of mutations associated with a KP.2, KP.3 and / or JN. l variant and one or more additional mutations. In some embodiments, an S protein comprises a majority of mutations associated with a KP.2, KP.3 and / or JN. l variant and a mutation at a position corresponding to position 22 of SEQ ID NO: 1 (e.g., T22N). In some embodiments, an S protein comprises a majority of mutations associated with a KP.2, KP.3 and / or JN. l variant and a mutation at a position corresponding to position 592 of SEQ ID NO: 1 (e.g., F592).

[0200] In some embodiments, an RNA molecule described herein comprises a nucleotide sequence that encodes a SARS-CoV-2 S protein comprising one more mutations that stabilize said SARS-CoV-2 S protein in a prefusion confirmation. In some embodiments, stabilization of a prefusion conformation of a SARS-CoV-2 S protein may be obtained by introducing two consecutive proline substitutions at residues 986 and 987 in the full-length spike protein (positions shown relative to SEQ ID NO: 1; for variant adapted sequences, proline substitutions can be introduced at corresponding positions). Specifically, in some embodiments, a prefusion-stabilized S protein protein variant can be obtained by exchanging the amino acid residue at the position corresponding to amino acid 986 of SEQ ID NO: 1 (e.g., K986P) to proline and the amino acid residue at the position corresponding to amino acid 987 of SEQ ID NO: 1 to proline (e.g., V987P).

[0201] In some embodiments, at least 4 proline substitutions are made. In some embodiments, at least four of such proline mutations include mutations at positions corresponding to residues 817, 892, 899, and 942 of SEQ ID NO: 1 (e.g., F817P; A892P; A899P; and A942P), e.g., as described in WO 2021243122 A2, the entire contents of which are incorporated herein by reference in its entirety. In some embodiments, a SARS-CoV-2 S protein comprising proline substitutions at positions corresponding to residues 817, 892, 899, and 942 of SEQ ID NO: 1, may further comprise proline substitutions at positions corresponding to residues 986 and 987 of SEQ ID NO: 1 (e.g., F817P; A892P; A899P; A942P; K986P; V987P).

[0202] In some embodiments, a SARS-CoV-2 S protein comprises one or mutations that stabilize an S protein, as described in W02023 / 0147091 or W02023 / 0147092, the contents of both of which are incorporated by reference herein in their entirety. In some embodiments, a SARS-CoV-2 S protein comprises:(a) Proline substitutions at positions corresponding to amino acids 817, 892, 899, 942, 985, and 987 of SEQ ID NO: 1 (e.g., F817P; A892P; A899P; A942P; D985P; V987P), and optionally one or more mutations that disrupt the furin cleavage site of the S protein (e.g., one or more mutations within the region corresponding to amino acids 682-685 of SEQ ID NO: 1 (e.g., RRAR to GSAS));(b) Proline substitutions at positions corresponding to amino acids 817, 892, 899, 942, 986, and 987 of SEQ ID NO: 1 (e.g., F817P; A892P; A899P; A942P; K986P; V987P), optionally mutations to introduce a disulfide bond linkage (e.g., Cys substitutions at positions corresponding to amino acids 547 and 978 of SEQ ID NO: 1), and optionally one or more mutations that disrupt the furin cleavage site (e.g., one or more mutations within the region corresponding to amino acids 682-685 of SEQ ID NO: 1 (e.g., RRAR to GSAS)); or(c) Proline substitutions at positions corresponding to amino acids 817, 892, 899, 942, 986, and 987 of SEQ ID NO: 1 {e.g., F817P; A892P; A899P; A942P; K986P; V987P), optionally mutations to introduce a disulfide bond linkage (e. ., Cys substitutions at positions corresponding to amino acids 547 and 982 of SEQ ID NO: 1), and optionally one or more mutations that disrupt the furin cleavage site {e.g., one or more mutations in the region corresponding to amino acids 682-685 of SEQ ID NO: 1 {e.g., RRAR to GSAS)).

[0203] Additional examples of mutations that can be used to stabilize the prefusion confirmation of the SARS-CoV-2 S protein (along with methods of characterizing and testing S protein variants) are described in Bowen, John E., et al. "SARS-CoV-2 spike conformation determines plasma neutralizing activity elicited by a wide panel of human vaccines," Science Immunology 7.78 (2022): eadfl421; Hsieh, Ching-Un, et al. "Structure-based design of prefusion-stabilized SARS-CoV-2 spikes," Science 369.6510 (2020): 1501-1505; Olmedillas, Eduardo, et al. "Structure-based design of a highly stable, covalently-linked SARS-CoV-2 spike trimer with improved structural properties and immunogenicity" bioRxiv (2021): 2021-05; Halfmann, Peter J., et al. "Multivalent S2-based vaccines provide broad protection against SARS-CoV-2 variants of concern and pangolin coronaviruses," EBioMedicine 86 (2022); Nuqui, Xandra, et al."Simulation-Driven Design of Stabilized SARS-CoV-2 Spike S2 Immunogens," bioRxiv (2023): 2023-10; and Low, Jun Siong, et al. "ACE2-binding exposes the SARS-CoV-2 fusion peptide to broadly neutralizing coronavirus antibodies," Science 377.6607 (2022): 735-742, the contents of each of which is incorporated by reference herein in its entirety.

[0204] In one embodiment, a SARS-CoV-2 S protein variant wherein the prototypical prefusion conformation is stabilized comprises the amino acid sequence shown in SEQ ID NO: 7, and one or more mutations characteristic of a JN. l variant (e.g., as described herein). In one embodiment, a SARS-CoV-2 S protein comprises the following mutations relative to SEQ ID NO: 7: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, and P1143L.

[0205] In some embodiments, an RNA composition described herein comprises an RNA encoding a polypeptide as set forth in SEQ ID NO: 179 or an immunogenic fragment thereof, or a variant thereof e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 179). In some embodiments, said polypeptide comprises (i) one or more mutations characteristic of a JN.l variant {e.g., one or more {e.g., all) mutations characteristic of a JN. l variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide {e.g., as described herein).

[0206] In some embodiments, an RNA molecule described herein comprises a nucleotide sequence comprising SEQ ID NO: 180, or a variant thereof {e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 180). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or more mutations characteristic of a JN.l variant {e.g., one or more {e.g., all) mutations characteristic of a JN.l variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide {e.g., as described herein).

[0207] In some embodiments, an RNA molecule comprises the sequence of SEQ ID NO: 182, or a variant thereof {e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 182). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or more mutations characteristic of a JN. l variant (e.g., one or more (e.g., all) mutations characteristic of a JN. l variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide (e.g., as described herein).

[0208] In some embodiments, an RNA molecule described herein comprises (a) a nucleotide sequence of SEQ ID NO: 182 or a sequence that is at least 70% identical to SEQ ID NO: 182 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 182), (b) a nucleotide sequence of SEQ ID NO: 180 or a sequence that is at least 70% identical to SEQ ID NO: 180 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 180), and / or (c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 179, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 179 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 179). In some embodiments, the SARS-CoV-2 S protein comprises one or more mutations that stabilize a prefusion confirmation (e.g., proline mutations at positions 982 and 983 of SEQ ID NO: 179) and / or one or more mutations characteristic of a JN.l variant (e.g., as described herein). In some embodiments, a composition comprising such an RNA molecule further comprises one or more additional RNA molecules, each encoding an S protein of a non-JN.l SARS-CoV-2 strain or variant (e.g., a Wuhan strain, an Omicron variant (e.g., an Omicron BA.4 / 5 variant, an Omicron BA.2.75.2 variant, and / or an XBB.1.5 variant (e.g., such RNA molecules described herein))).

[0209] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a SARS-CoV-2 S protein comprising one or more mutations characteristic of an Omicron JN. l variant, wherein: a) the SARS-CoV-2 S protein comprises an amino acid sequence of SEQ ID NO: 179, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 179, or an immunogenic fragment thereof; and / or b) the RNA molecule comprising a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide comprises a nucleotide sequence having at least (i) 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 180; and / or (ii) at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 182. In some embodiments, the one or more mutations characteristic of an Omicron JN.l variant are selected from: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, and P1143L, or any combination thereof, relative to SEQ ID NO: 1.

[0210] In some embodiments, an RNA composition described herein comprises an RNA encoding a polypeptide as set forth in SEQ ID NO: 184 or an immunogenic fragment thereof, or a variant thereof (e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 184). In some embodiments, said polypeptide comprises (i) one or more mutations characteristic of a JN.1.6 variant (e.g., one or more (e.g., all) mutations characteristic of a JN.1.6 variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS- CoV-2 S polypeptide (e.g., as described herein).

[0211] In some embodiments, an RNA molecule described herein comprises a nucleotide sequence comprising SEQ ID NO: 185, or a variant thereof {e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 185). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or more mutations characteristic of a JN.1.6 variant {e.g., one or more e.g., all) mutations characteristic of a JN.1.6 variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide {e.g., as described herein).

[0212] In some embodiments, an RNA molecule comprises the sequence of SEQ ID NO: 187, or a variant thereof {e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 187). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or more mutations characteristic of a JN.1.6 variant {e.g., one or more {e.g., all) mutations characteristic of a JN.1.6 variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide {e.g., as described herein).

[0213] In some embodiments, an RNA molecule described herein comprises (a) a nucleotide sequence of SEQ ID NO: 187 or a sequence that is at least 70% identical to SEQ ID NO: 187 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 187), (b) a nucleotide sequence of SEQ ID NO: 185 or a sequence that is at least 70% identical to SEQ ID NO: 185 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 185), and / or (c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 184, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 184 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 184). In some embodiments, the SARS-CoV-2 S protein comprises one or more mutations that stabilize a prefusion confirmation {e.g, proline mutations at positions 982 and 983 of SEQ ID NO: 184) and / or one or more mutations characteristic of a JN.1.6 variant {e.g., as described herein). In some embodiments, a composition comprising such an RNA molecule further comprises one or more additional RNA molecules, each encoding an S protein of a non-JN.1.6 SARS-CoV-2 strain or variant {e.g., a Wuhan strain, an Omicron variant {e.g., an Omicron BA.4 / 5 variant, an Omicron BA.2.75.2 variant, and / or an XBB.1.5 variant {e.g., such RNA molecules described herein))).

[0214] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a SARS-CoV-2 S protein comprising one or more mutations characteristic of an Omicron JN.1.6 variant, wherein: a) the SARS-CoV-2 S protein comprises an amino acid sequence of SEQ ID NO: 184, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 184, or an immunogenic fragment thereof; and / or b) the RNA molecule comprising a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide comprises a nucleotide sequence having at least (i) 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 185; and / or (ii) at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 187. In some embodiments, the one or more mutations characteristic of an Omicron JN.1.6 variant are selected from: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R,N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, and P1143L, or any combination thereof, relative to SEQ ID NO: 1.

[0215] In some embodiments, an RNA composition described herein comprises an RNA encoding a polypeptide as set forth in SEQ ID NO: 189 or an immunogenic fragment thereof, or a variant thereof (e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 189). In some embodiments, said polypeptide comprises (i) one or more mutations characteristic of a IN.1.7 variant (e.g., one or more (e.g., all) mutations characteristic of a JN.1.7 variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS- CoV-2 S polypeptide (e.g., as described herein).

[0216] In some embodiments, an RNA molecule described herein comprises a nucleotide sequence comprising SEQ ID NO: 190, or a variant thereof (e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 190). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or more mutations characteristic of a JN.1.7 variant (e.g., one or more (e.g., all) mutations characteristic of a JN.1.7 variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide (e.g., as described herein).

[0217] In some embodiments, an RNA molecule comprises the sequence of SEQ ID NO: 192, or a variant thereof (e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 192). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or more mutations characteristic of a JN.1.7 variant (e.g., one or more (e.g, all) mutations characteristic of a JN.1.7 variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide (e.g, as described herein).

[0218] In some embodiments, an RNA molecule described herein comprises (a) a nucleotide sequence of SEQ ID NO: 192 or a sequence that is at least 70% identical to SEQ ID NO: 192 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 192), (b) a nucleotide sequence of SEQ ID NO: 190 or a sequence that is at least 70% identical to SEQ ID NO: 190 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 190), and / or (c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 189, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 189 (e.g, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 189). In some embodiments, the SARS-CoV-2 S protein comprises one or more mutations that stabilize a prefusion confirmation (e.g., proline mutations at positions 982 and 983 of SEQ ID NO: 189) and / or one or more mutations characteristic of a JN.1.7 variant (e.g., as described herein). In some embodiments, a composition comprising such an RNA molecule further comprises one or more additional RNA molecules, each encoding an S protein of a non-JN.1.7 SARS-CoV-2 strain or variant (e.g., a Wuhan strain, an Omicron variant (e.g., an Omicron BA.4 / 5 variant, an Omicron BA.2.75.2 variant, and / or an XBB.1.5 variant (e.g., such RNA molecules described herein))).

[0219] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a SARS-CoV-2 S protein comprising one or more mutations characteristic of an Omicron JN.1.7 variant, wherein:a) the SARS-CoV-2 S protein comprises an amino acid sequence of SEQ ID NO: 189, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 189, or an immunogenic fragment thereof; and / or b) the RNA molecule comprising a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide comprises a nucleotide sequence having at least (i) 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 190; and / or (ii) at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 192. In some embodiments, the one or more mutations characteristic of an Omicron JN.1.7 variant are selected from: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, T572I, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, P1143L, and E1150D, or any combination thereof, relative to SEQ ID NO: 1.

[0220] In some embodiments, the one or more mutations characteristic of an Omicron JN.1.7 variant are selected from: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, T572I, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, and P1143L, or any combination thereof, relative to SEQ ID NO: 1.

[0221] In some embodiments, an RNA composition described herein comprises an RNA encoding a polypeptide as set forth in SEQ ID NO: 194 or an immunogenic fragment thereof, or a variant thereof (e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 194). In some embodiments, said polypeptide comprises (i) one or more mutations characteristic of a JN.1.2 variant (e.g., one or more e.g., all) mutations characteristic of a JN.1.2 variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS- CoV-2 S polypeptide (e.g., as described herein).

[0222] In some embodiments, an RNA molecule described herein comprises a nucleotide sequence comprising SEQ ID NO: 195, or a variant thereof (e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 195). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or more mutations characteristic of a JN.1.2 variant (e.g., one or more (e.g., all) mutations characteristic of a JN.1.2 variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide (e.g., as described herein).

[0223] In some embodiments, an RNA molecule comprises the sequence of SEQ ID NO: 197, or a variant thereof (e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 197). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or more mutations characteristic of a JN.1.2 variant (e.g., one or more (e.g., all) mutations characteristic of a JN.1.2 variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide (e.g., as described herein).

[0224] In some embodiments, an RNA molecule described herein comprises (a) a nucleotide sequence of SEQ ID NO: 197 or a sequence that is at least 70% identical to SEQ ID NO: 197 (e.g., at least 80%, at least 85%, at least90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 197), (b) a nucleotide sequence of SEQ ID NO: 195 or a sequence that is at least 70% identical to SEQ ID NO: 195 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 195), and / or (c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 194, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 194 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 194). In some embodiments, the SARS-CoV-2 S protein comprises one or more mutations that stabilize a prefusion confirmation (e.g., proline mutations at positions 982 and 983 of SEQ ID NO: 194) and / or one or more mutations characteristic of a JN.1.2 variant (e.g., as described herein). In some embodiments, a composition comprising such an RNA molecule further comprises one or more additional RNA molecules, each encoding an S protein of a non-JN.1.2 SARS-CoV-2 strain or variant (e.g., a Wuhan strain, an Omicron variant (e.g., an Omicron BA.4 / 5 variant, an Omicron BA.2.75.2 variant, and / or an XBB.1.5 variant (e.g., such RNA molecules described herein))).

[0225] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a SARS-CoV-2 S protein comprising one or more mutations characteristic of an Omicron JN.1.2 variant, wherein: a) the SARS-CoV-2 S protein comprises an amino acid sequence of SEQ ID NO: 194, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 194, or an immunogenic fragment thereof; and / or b) the RNA molecule comprising a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide comprises a nucleotide sequence having at least (i) 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 195; and / or (ii) at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 197. In some embodiments, the one or more mutations characteristic of an Omicron JN.1.2 variant are selected from: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, P1143L, and M1229I, or any combination thereof, relative to SEQ ID NO: 1.

[0226] In one embodiment, a SARS-CoV-2 S protein variant wherein the prototypical prefusion conformation is stabilized comprises the amino acid sequence shown in SEQ ID NO: 7, and one or more mutations characteristic of a KP.2 variant (e.g., as described herein). In one embodiment, a SARS-CoV-2 S protein comprises the following mutations relative to SEQ ID NO: 7: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, and P1143L.

[0227] In some embodiments, an RNA composition described herein comprises an RNA encoding a polypeptide as set forth in SEQ ID NO: 199 or an immunogenic fragment thereof, or a variant thereof (e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 199). In some embodiments, said polypeptide comprises (i) one or more mutations characteristic of a KP.2 variant (e.g., one or more (e.g., all) mutations characteristic of a KP.2variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide (e.g., as described herein).

[0228] In some embodiments, an RNA molecule described herein comprises a nucleotide sequence comprising SEQ ID NO: 200, or a variant thereof (e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 200). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or more mutations characteristic of a KP.2 variant (e.g., one or more e.g., all) mutations characteristic of a KP.2 variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide (e.g., as described herein).

[0229] In some embodiments, an RNA molecule comprises the sequence of SEQ ID NO: 202, or a variant thereof (e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 202). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or more mutations characteristic of a KP.2 variant (e.g., one or more (e.g., all) mutations characteristic of a KP.2variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide (e.g., as described herein).

[0230] In some embodiments, an RNA molecule described herein comprises (a) a nucleotide sequence of SEQ ID NO: 202 or a sequence that is at least 70% identical to SEQ ID NO: 202 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 202), (b) a nucleotide sequence of SEQ ID NO: 200 or a sequence that is at least 70% identical to SEQ ID NO: 200 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 200), and / or (c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 199, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 199 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 199). In some embodiments, the SARS-CoV-2 S protein comprises one or more mutations that stabilize a prefusion confirmation (e.g., proline mutations at positions 982 and 983 of SEQ ID NO: 199) and / or one or more mutations characteristic of a KP.2 variant (e.g., as described herein). In some embodiments, a composition comprising such an RNA molecule further comprises one or more additional RNA molecules, each encoding an S protein of a non-KP.2 SARS-CoV-2 strain or variant (e.g., a Wuhan strain, an Omicron variant (e.g., an Omicron BA.4 / 5 variant, an Omicron BA.2.75.2 variant, and / or an XBB.1.5 variant (e.g., such RNA molecules described herein))).

[0231] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a SARS-CoV-2 S protein comprising one or more mutations characteristic of a KP.2 variant, wherein: a) the SARS-CoV-2 S protein comprises an amino acid sequence of SEQ ID NO: 199, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 199, or an immunogenic fragment thereof; and / or b) the RNA molecule comprising a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide comprises a nucleotide sequence having at least (i) 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 200; and / or (ii) at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 202.

[0232] In some embodiments, the one or more mutations characteristic of an Omicron KP.2 variant are selected from: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I,V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, and P1143L, or any combination thereof, relative to SEQ ID NO: 1.

[0233] In one embodiment, a SARS-CoV-2 S protein variant wherein the prototypical prefusion conformation is stabilized comprises the amino acid sequence shown in SEQ ID NO: 7, and one or more mutations characteristic of a XEC variant (e.g., as described herein). In one embodiment, a SARS-CoV-2 S protein comprises the following mutations relative to SEQ ID NO: 7: insl6MPLF, T19I, R21T, T22N, A24-26, A27S, S50L, F59S, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q493E, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, and P1143L.

[0234] In some embodiments, an RNA composition described herein comprises an RNA encoding a polypeptide as set forth in SEQ ID NO: 204 or an immunogenic fragment thereof, or a variant thereof e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 204). In some embodiments, said polypeptide comprises (i) one or more mutations characteristic of a XEC variant e.g., one or more {e.g., all) mutations characteristic of a XEC variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide {e.g., as described herein).

[0235] In some embodiments, an RNA molecule described herein comprises a nucleotide sequence comprising SEQ ID NO: 205, or a variant thereof {e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 205). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or more mutations characteristic of a XEC variant {e.g., one or more {e.g., all) mutations characteristic of a XEC variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide {e.g., as described herein).

[0236] In some embodiments, an RNA molecule comprises the sequence of SEQ ID NO: 207, or a variant thereof {e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 207). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or more mutations characteristic of a XEC variant {e.g., one or more {e.g., all) mutations characteristic of an XEC variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide {e.g., as described herein).

[0237] In some embodiments, an RNA molecule described herein comprises (a) a nucleotide sequence of SEQ ID NO: 207 or a sequence that is at least 70% identical to SEQ ID NO: 207 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 207), (b) a nucleotide sequence of SEQ ID NO: 205 or a sequence that is at least 70% identical to SEQ ID NO: 205 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 205), and / or (c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 204, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 204 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%,at least 99%, or higher, identity to SEQ ID NO: 204). In some embodiments, the SARS-CoV-2 S protein comprises one or more mutations that stabilize a prefusion confirmation {e.g., proline mutations at positions 982 and 983 of SEQ ID NO: 204) and / or one or more mutations characteristic of a XEC variant {e.g., as described herein). In some embodiments, a composition comprising such an RNA molecule further comprises one or more additional RNA molecules, each encoding an S protein of a non-XEC SARS-CoV-2 strain or variant {e.g., a Wuhan strain, an Omicron variant e.g., an Omicron BA.4 / 5 variant, an Omicron BA.2.75.2 variant, and / or an XBB.1.5 variant {e.g., such RNA molecules described herein))).

[0238] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a SARS-CoV-2 S protein comprising one or more mutations characteristic of a XEC variant, wherein: a) the SARS-CoV-2 S protein comprises an amino acid sequence of SEQ ID NO: 204, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 204, or an immunogenic fragment thereof; and / or b) the RNA molecule comprising a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide comprises a nucleotide sequence having at least (i) 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 205; and / or (ii) at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 207.

[0239] In some embodiments, the one or more mutations characteristic of an Omicron XEC variant are selected from: insl6MPLF, T19I, R21T, T22N, A24-26, A27S, S50L, F59S, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q493E, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, and P1143L, or any combination thereof, relative to SEQ ID NO: 1.

[0240] In one embodiment, a SARS-CoV-2 S protein variant wherein the prototypical prefusion conformation is stabilized comprises the amino acid sequence shown in SEQ ID NO: 7, and one or more mutations characteristic of a MV.l variant (e.g., as described herein). In one embodiment, a SARS-CoV-2 S protein comprises the following mutations relative to SEQ ID NO: 7: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S31F, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, K182N, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456V, N460K, S477N, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, K986P, V987P, P1143L.

[0241] In some embodiments, an RNA composition described herein comprises an RNA encoding a polypeptide as set forth in SEQ ID NO: 209 or an immunogenic fragment thereof, or a variant thereof {e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 209). In some embodiments, said polypeptide comprises (i) one or more mutations characteristic of a MV.l variant {e.g., one or more {e.g., all) mutations characteristic of a MV. l variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS- CoV-2 S polypeptide {e.g., as described herein).

[0242] In some embodiments, an RNA molecule described herein comprises a nucleotide sequence comprising SEQ ID NO: 210, or a variant thereof {e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 210). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or moremutations characteristic of a MV.l variant {e.g., one or more {e.g., all) mutations characteristic of a MV.l variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide {e.g., as described herein).

[0243] In some embodiments, an RNA molecule comprises the sequence of SEQ ID NO: 212, or a variant thereof {e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 212). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or more mutations characteristic of a MV. l variant {e.g., one or more e.g., all) mutations characteristic of an MV. l variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide {e.g., as described herein).

[0244] In some embodiments, an RNA molecule described herein comprises (a) a nucleotide sequence of SEQ ID NO: 212 or a sequence that is at least 70% identical to SEQ ID NO: 212 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 212), (b) a nucleotide sequence of SEQ ID NO: 210 or a sequence that is at least 70% identical to SEQ ID NO: 210 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 210), and / or (c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 209, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 209 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 209). In some embodiments, the SARS-CoV-2 S protein comprises one or more mutations that stabilize a prefusion confirmation {e.g., proline mutations at positions 982 and 983 of SEQ ID NO: 209) and / or one or more mutations characteristic of a MV.l variant {e.g., as described herein). In some embodiments, a composition comprising such an RNA molecule further comprises one or more additional RNA molecules, each encoding an S protein of a non-MV.l SARS-CoV-2 strain or variant {e.g., a Wuhan strain, an Omicron variant {e.g., an Omicron BA.4 / 5 variant, an Omicron BA.2.75.2 variant, and / or an XBB.1.5 variant {e.g., such RNA molecules described herein))).

[0245] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a SARS-CoV-2 S protein comprising one or more mutations characteristic of a MV.l variant, wherein: a) the SARS-CoV-2 S protein comprises an amino acid sequence of SEQ ID NO: 209, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 209, or an immunogenic fragment thereof; and / or b) the RNA molecule comprising a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide comprises a nucleotide sequence having at least (i) 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 210; and / or (ii) at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 212.

[0246] In some embodiments, the one or more mutations characteristic of an Omicron MV.l variant are selected from: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S31F, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, K182N, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456V, N460K, S477N, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, K986P, V987P, P1143L, or any combination thereof, relative to SEQ ID NO: 1.

[0247] In one embodiment, a SARS-CoV-2 S protein variant wherein the prototypical prefusion conformation is stabilized comprises the amino acid sequence shown in SEQ ID NO: 7, and one or more mutations characteristic of a MC.l variant (e.g., as described herein). In one embodiment, a SARS-CoV-2 S protein comprises the following mutations relative to SEQ ID NO: 7: insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S31del, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, E554K, A570V, T572I, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, K986P, V987P, V1104L, P1143L.

[0248] In some embodiments, an RNA composition described herein comprises an RNA encoding a polypeptide as set forth in SEQ ID NO: 214 or an immunogenic fragment thereof, or a variant thereof {e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 214). In some embodiments, said polypeptide comprises (i) one or more mutations characteristic of a MC.l variant e.g., one or more {e.g., all) mutations characteristic of a MC. l variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS- CoV-2 S polypeptide {e.g., as described herein).

[0249] In some embodiments, an RNA molecule described herein comprises a nucleotide sequence comprising SEQ ID NO: 215, or a variant thereof {e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 215). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or more mutations characteristic of a MC.l variant {e.g., one or more {e.g., all) mutations characteristic of a MC.l variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide {e.g., as described herein).

[0250] In some embodiments, an RNA molecule comprises the sequence of SEQ ID NO: 217, or a variant thereof {e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 217). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or more mutations characteristic of a MC. l variant {e.g., one or more {e.g., all) mutations characteristic of an MC. l variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide {e.g., as described herein).

[0251] In some embodiments, an RNA molecule described herein comprises (a) a nucleotide sequence of SEQ ID NO: 217 or a sequence that is at least 70% identical to SEQ ID NO: 217 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 217), (b) a nucleotide sequence of SEQ ID NO: 215 or a sequence that is at least 70% identical to SEQ ID NO: 215 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 215), and / or (c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 214, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 214 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 214). In some embodiments, the SARS-CoV-2 S protein comprises one or more mutations that stabilize a prefusion confirmation {e.g., proline mutations at positions 982 and 983 of SEQ ID NO: 214) and / or one or more mutations characteristic of a MC.l variant {e.g., as described herein). In some embodiments, a composition comprising such an RNA molecule further comprises one or more additional RNAmolecules, each encoding an S protein of a non-MC.l SARS-CoV-2 strain or variant (e.g, a Wuhan strain, an Omicron variant (e.g, an Omicron BA.4 / 5 variant, an Omicron BA.2.75.2 variant, and / or an XBB.1.5 variant (e.g., such RNA molecules described herein))).

[0252] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a SARS-CoV-2 S protein comprising one or more mutations characteristic of a MC.l variant, wherein: a) the SARS-CoV-2 S protein comprises an amino acid sequence of SEQ ID NO: 214, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 214, or an immunogenic fragment thereof; and / or b) the RNA molecule comprising a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide comprises a nucleotide sequence having at least (I) 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 215; and / or (ii) at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 217.

[0253] In some embodiments, the one or more mutations characteristic of an Omicron MC.l variant are selected from: insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S31del, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, E554K, A570V, T572I, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, K986P, V987P, V1104L, P1143L, or any combination thereof, relative to SEQ ID NO: 1.

[0254] In one embodiment, a SARS-CoV-2 S protein variant wherein the prototypical prefusion conformation is stabilized comprises the amino acid sequence shown in SEQ ID NO: 7, and one or more mutations characteristic of a LP.8.1 variant (e.g., as described herein). In one embodiment, a SARS-CoV-2 S protein comprises the following mutations relative to SEQ ID NO: 7: insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S31del, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, F186L, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445R, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, K986P, V987P, K1086R, V1104L, P1143L.

[0255] In some embodiments, an RNA composition described herein comprises an RNA encoding a polypeptide as set forth in SEQ ID NO: 219 or an immunogenic fragment thereof, or a variant thereof (e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 219). In some embodiments, said polypeptide comprises (i) one or more mutations characteristic of a LP.8.1 variant e.g., one or more (e.g., all) mutations characteristic of a LP.8.1 variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS- CoV-2 S polypeptide (e.g., as described herein).

[0256] In some embodiments, an RNA molecule described herein comprises a nucleotide sequence comprising SEQ ID NO: 220, or a variant thereof (e.g, having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 220). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or more mutations characteristic of a LP.8.1 variant (e.g., one or more (e.g, all) mutations characteristic of a LP.8.1 variantdescribed herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide (e.g., as described herein).

[0257] In some embodiments, an RNA molecule comprises the sequence of SEQ ID NO: 222, or a variant thereof (e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 222). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or more mutations characteristic of a LP.8.1 variant (e.g., one or more e.g., all) mutations characteristic of an LP.8.1 variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide (e.g., as described herein).

[0258] In some embodiments, an RNA molecule described herein comprises (a) a nucleotide sequence of SEQ ID NO: 222 or a sequence that is at least 70% identical to SEQ ID NO: 222 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 222), (b) a nucleotide sequence of SEQ ID NO: 220 or a sequence that is at least 70% identical to SEQ ID NO: 220 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 220), and / or (c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 219, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 219 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 219). In some embodiments, the SARS-CoV-2 S protein comprises one or more mutations that stabilize a prefusion confirmation (e.g., proline mutations at positions 982 and 983 of SEQ ID NO: 219) and / or one or more mutations characteristic of a LP.8.1 variant (e.g., as described herein). In some embodiments, a composition comprising such an RNA molecule further comprises one or more additional RNA molecules, each encoding an S protein of a non-LP.8.1 SARS-CoV-2 strain or variant (e.g., a Wuhan strain, an Omicron variant (e.g., an Omicron BA.4 / 5 variant, an Omicron BA.2.75.2 variant, and / or an XBB.1.5 variant (e.g., such RNA molecules described herein))).

[0259] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a SARS-CoV-2 S protein comprising one or more mutations characteristic of a LP.8.1 variant, wherein: a) the SARS-CoV-2 S protein comprises an amino acid sequence of SEQ ID NO: 219, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 219, or an immunogenic fragment thereof; and / or b) the RNA molecule comprising a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide comprises a nucleotide sequence having at least (i) 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 220; and / or (ii) at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 222.

[0260] In some embodiments, the one or more mutations characteristic of an Omicron LP.8.1 variant are selected from: insl6MPLF, T19I, R21T, L24del, P25del, P26del, A27S, S31del, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, F186L, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445R, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q493E, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, K986P, V987P, K1086R, V1104L, P1143L, or any combination thereof, relative to SEQ ID NO: 1.

[0261] In one embodiment, a SARS-CoV-2 S protein variant wherein the prototypical prefusion conformation is stabilized comprises the amino acid sequence shown in SEQ ID NO: 7, and one or more mutations characteristic of aLF.7 variant (e.g., as described herein). In one embodiment, a SARS-CoV-2 S protein comprises the following mutations relative to SEQ ID NO: 7: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S31P, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, K182R, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, K444R, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, K986P, V987P, P1143L.

[0262] In some embodiments, an RNA composition described herein comprises an RNA encoding a polypeptide as set forth in SEQ ID NO: 224 or an immunogenic fragment thereof, or a variant thereof (e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 224). In some embodiments, said polypeptide comprises (i) one or more mutations characteristic of a LF.7 variant e.g., one or more (e.g., all) mutations characteristic of a LF.7 variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide (e.g., as described herein).

[0263] In some embodiments, an RNA molecule described herein comprises a nucleotide sequence comprising SEQ ID NO: 225, or a variant thereof (e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 225). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or more mutations characteristic of a LF.7 variant (e.g., one or more (e.g., all) mutations characteristic of a LF.7 variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide (e.g., as described herein).

[0264] In some embodiments, an RNA molecule comprises the sequence of SEQ ID NO: 227, or a variant thereof (e.g., having at least 70% or more, including, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 227). In some embodiments, said RNA molecule encodes a SARS-CoV-2 S protein comprising (i) one or more mutations characteristic of a LF.7 variant (e.g., one or more (e.g., all) mutations characteristic of an LF.7 variant described herein) and / or (ii) one or more mutations that stabilize a prefusion confirmation of a SARS-CoV-2 S polypeptide (e.g., as described herein).

[0265] In some embodiments, an RNA molecule described herein comprises (a) a nucleotide sequence of SEQ ID NO: 227 or a sequence that is at least 70% identical to SEQ ID NO: 227 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 227), (b) a nucleotide sequence of SEQ ID NO: 225 or a sequence that is at least 70% identical to SEQ ID NO: 225 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 225), and / or (c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 224, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 224 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 224). In some embodiments, the SARS-CoV-2 S protein comprises one or more mutations that stabilize a prefusion confirmation (e.g., proline mutations at positions 982 and 983 of SEQ ID NO: 224) and / or one or more mutations characteristic of a LF.7 variant (e.g., as described herein). In some embodiments, a composition comprising such an RNA molecule further comprises one or more additional RNA molecules, each encoding an S protein of a non-LF.7 SARS-CoV-2 strain or variant (e.g., a Wuhan strain, an Omicronvariant (e.g., an Omicron BA.4 / 5 variant, an Omicron BA.2.75.2 variant, and / or an XBB.1.5 variant {e.g., such RNA molecules described herein))).

[0266] In some embodiments, an RNA molecule comprises a nucleotide sequence that encodes a SARS-CoV-2 S protein comprising one or more mutations characteristic of a LF.7 variant, wherein: a) the SARS-CoV-2 S protein comprises an amino acid sequence of SEQ ID NO: 224, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 224, or an immunogenic fragment thereof; and / or b) the RNA molecule comprising a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide comprises a nucleotide sequence having at least (i) 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 225; and / or (ii) at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 227.

[0267] In some embodiments, the one or more mutations characteristic of an Omicron LF.7 variant are selected from: insl6MPLF, T19I, R21T, T22N, L24del, P25del, P26del, A27S, S31P, S50L, H69del, V70del, V127F, G142D, Y144del, F157S, R158G, K182R, R190S, N211del, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, K444R, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, V483del, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, K986P, V987P, P1143L, or any combination thereof, relative to SEQ ID NO: 1.

[0268] In some embodiments, a composition comprising an RNA molecule that comprises a nucleotide sequence encoding a SARS-CoV-2 S protein comprising one or more mutations characteristic of a JN. l, JN.1.6, JN.1.7, KP.2, XEC, JN.1.2, MV. l, MC. l, LP.8.1, or LF.7 variant further comprises one or more additional RNA molecules, each having a nucleotide sequence encoding a SARS-CoV-2 S protein of a non-JN. l, JN.1.6, JN.1.7, KP.2, JN.1.2, MV. l, MC. l, LP.8.1, or LF.7 variant. In some embodiments, the one or more additional RNA molecule(s) include RNA molecule(s) that encode S proteins of a Wuhan strain, an Omicron BA.4 / 5 strain, a BQ.1.1 variant, and / or an XBB.1.5 variant. In some embodiments, the one or more additional RNA molecule(s) comprise a sequence that is at least 70% identical {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or higher, identity to) SEQ ID NO: 20, 72, 103, or 161.Table 1. Sequence of one example of a JN.l-specific RNA vaccine, encoding a full length SARS-CoV-2 S proteinTable 2. Sequence of one example of a JN.1.6.1-specific RNA vaccine, encoding a full length SARS-CoV-2 S proteinTable 3. Sequence of one example of a JN.1.7-specific RNA vaccine, encoding a full length SARS-CoV-2 S proteinTable 4. Sequence of one example of a JN.1.2-specific RNA vaccine, encoding a full length SARS-CoV-2S proteinTable 5. Sequence of one example of a KP.2-specific RNA vaccine, encoding a full length SARS-CoV-2 S proteinTable 10. Sequence of one example of an XEC-specific RNA vaccine, encoding a full length SARS-CoV-2S proteinTable 12. Sequence of one example of an MV.l-specific RNA vaccine, encoding a full length SARS-CoV-2 S proteinTable 13. Sequence of one example of an MC.l-specific RNA vaccine, encoding a full length SARS-CoV- 2 S proteinTable 14. Sequence of one example of an LP.8.1-specific RNA vaccine, encoding a full length SARS-CoV-2 S proteinTable 15. Sequence of one example of an LF.7-specific RNA vaccine, encoding a full length SARS-CoV-2S proteinTable 16. Sequence of one example of a JN.l-specific RNA vaccine, encoding a full length SARS-CoV-2S proteinTable 17. Sequence of one example of a JN.l-specific RNA vaccine, encoding a full length SARS-CoV-2S proteinTable 18. Sequence of one example of a KP.2-specific RNA vaccine, encoding a full length SARS-CoV-2S proteinTable 19. Sequence of one example of a KP.2-specific RNA vaccine, encoding a full length SARS-CoV-2S proteinTable 20. Sequence of one example of an XEC-specific RNA vaccine, encoding a full-length SARS-CoV-2S proteinTable 21. Sequence of one example of an XEC-specific RNA vaccine, encoding a full-length SARS-CoV-2S proteinTable 22. Sequence of one example of an MV.l-specific RNA vaccine, encoding a full length SARS-CoV-2 S proteinTable 23. Sequence of one example of an MV.l-specific RNA vaccine, encoding a full length SARS-CoV-2 S proteinTable 24. Sequence of one example of an MC.l-specific RNA vaccine, encoding a full length SARS-CoV-2 S proteinTable 25. Sequence of one example of an MC.l-specific RNA vaccine, encoding a full length SARS-CoV-2 S proteinTable 26. Sequence of one example of an LP.8.1-specific RNA vaccine, encoding a full length SARS-CoV-2 S proteinTable 27. Sequence of one example of an LP.8.1-specific RNA vaccine, encoding a full length SARS-CoV-2 S proteinTable 28. Sequence of one example of an LF.7-specific RNA vaccine, encoding a full length SARS-CoV-2S proteinTable 29. Sequence of one example of an LF.7-specific RNA vaccine, encoding a full length SARS-CoV-2S protein

[0272] In some embodiments, an SI domain of a SARS-CoV-2 S protein comprises amino acids 1 to 678 of SEQ ID NO: 1, or a corresponding region in an S protein of a SARS-CoV-2 variant. In some embodiments, an SI domain of a SARS-CoV-2 S protein comprises amino acids 1 to 683 of SEQ ID NO: 1, or a corresponding region in an S protein of a SARS-CoV-2 variant. In some embodiments, an SI domain of a SARS-CoV-2 S protein comprises amino acids 1 to 685 of SEQ ID NO: 1, or a corresponding region in an S protein of a SARS-CoV-2 variant.

[0273] In some embodiments, a fragment of an SI domain comprises an NTD and an RBD of a SARS-CoV-2 S protein, optionally wherein the RBD is at the C-terminus of the fragment of the SI domain. In some embodiments, a fragment of an SI domain comprises a polypeptide sequence corresponding to amino acids 1 to about amino acid 537 of SEQ ID NO: 1.

[0274] In some embodiments, an S2 domain of a SARS-CoV-2 S protein comprises amino acids 679 to 1273 of SEQ ID NO: 1, or a corresponding region in an S protein of a SARS-CoV-2 variant. In some embodiments, an S2 domain of a SARS-CoV-2 S protein comprises amino acids 684 to 1273 of SEQ ID NO: 1, or a corresponding region in an S protein of a SARS-CoV-2 variant. In some embodiments, an S2 domain of a SARS-CoV-2 S protein comprises amino acids 686 to 1273 of SEQ ID NO: 1, or a corresponding region in an S protein of a SARS-CoV-2 variant.

[0275] In some embodiments, an NTD comprises an amino acid sequence corresponding to amino acids 20-318 of SEQ ID NO: 1. In some embodiments, an NTD comprises an amino acid sequence corresponding to amino acids 20- 302 of SEQ ID NO: 1.Table 30. Sequence of one example of a JN.l-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 31. Sequence of one example of a JN.l-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 32. Sequence of one example of a JN.l-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 33. Sequence of one example of an XEC-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 34. Sequence of one example of an XEC-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 35. Sequence of one example of an XEC-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 36. Sequence of one example of an MV.l-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 37. Sequence of one example of an MV.l-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 38. Sequence of one example of an MV.l-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 39. Sequence of one example of an MC.l-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 40. Sequence of one example of an MC.l-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 41. Sequence of one example of an MC.l-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 42. Sequence of one example of an LP.8.1-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 43. Sequence of one example of an LP.8.1-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 44. Sequence of one example of an LP.8.1-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 45. Sequence of one example of an LF.7-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 46. Sequence of one example of an LF.7-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 47. Sequence of one example of an LF.7-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 48. Sequence of one example of a JN.l-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 49. Sequence of one example of a JN.l-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 50. Sequence of one example of a JN.l-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 51. Sequence of one example of an XEC-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 52. Sequence of one example of an XEC-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 53. Sequence of one example of an XEC-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 54. Sequence of one example of an MV.l-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 56. Sequence of one example of an MV.l-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 57. Sequence of one example of an MV.l-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 58. Sequence of one example of an MC.l-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 59. Sequence of one example of an MC.l-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 60. Sequence of one example of an MC.l-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 61. Sequence of one example of an LP.8.1-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 62. Sequence of one example of an LP.8.1-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 63. Sequence of one example of an LP.8.1-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 64. Sequence of one example of an LF.7-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 65. Sequence of one example of an LF.7-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainTable 66. Sequence of one example of an LF.7-specific RNA vaccine, encoding a fragment of a SARS-CoV-2 SI domainLipid nanopartides (LNPs)

[0276] In one embodiment, a nucleic acid, such as an RNA molecule, described herein is administered in the form of lipid nanoparticles (LNPs) (e.g., encapsulated within or associated with an LNP). The LNP may comprise any lipid capable of forming a particle to which the one or more nucleic acid molecules are associated, or in which the one or more nucleic acid molecules are encapsulated.

[0277] In one embodiment, an LNP comprises a cationic lipid, a neutral lipid, a steroid, and / or a polymer conjugated lipid. In one embodiment, the cationic lipid is ALC-0315, the neutral lipid is DSPC, the steroid is cholesterol, and / or the polymer conjugated lipid is ALC-0159.

[0278] In one embodiment, an LNP comprises from 20 to 60 mol percent, 40 to 55 mol percent, 40 to 50 mol percent, 41 to 49 mol percent, 41 to 48 mol percent, 42 to 48 mol percent, 43 to 48 mol percent, 44 to 48 mol percent, 45 to 48 mol percent, 46 to 48 mol percent, 47 to 48 mol percent, or 47.2 to 47.8 mol percent of a cationic lipid. In one embodiment, the LNP comprises about 47.0, 47.1, 47.2, 47.3, 47.4, 47.5, 47.6, 47.7, 47.8, 47.9 or 48.0 mol percent of a cationic lipid.

[0279] In one embodiment, a neutral lipid is present in a concentration ranging from 5 to 25 mol percent, 5 to 15 mol percent, from 7 to 13 mol percent, or from 9 to 11 mol percent. In one embodiment, a neutral lipid is present in a concentration of about 9.5, 10, or 10.5 mol percent.

[0280] In one embodiment, a steroid is present in a concentration ranging from 25 to 55 mol percent, 30 to 50 mol percent, 35 to 45 mol percent, or 38 to 43 mol percent. In one embodiment, a steroid is present in a concentration of about 40, 41, 42, 43, 44, 45 or 46 mol percent.

[0281] In some embodiments, an LNP comprises molar ratios of 20-60% ionizable cationic lipid, 5-25% neutral lipid, 25-55% sterol, and 0.5-15% polymer conjugated (e.g., PEG-modified) lipid.

[0282] In some embodiments, a composition is administered by intramuscular administration, e.g., in aqueous cryoprotectant buffer formulated for intramuscular administration. In some embodiments, a composition is a preservative-free, sterile dispersion of RNA formulated in lipid nanoparticles (LNP) in aqueous cryoprotectant buffer, and optionally is formulated for intramuscular administration.

[0283] In some embodiments, a composition (e.g., pharmaceutical composition) comprises components listed in the below Tables 6-8, e.g., at the proportions or concentrations shown in the below Tables 6-8.Table 6: A First Example FormulationTable 7: A Second Example FormulationTable 8: A Third Example Formulation[1] ALC-0315 = ((4-hydroxybutyl)azanediyl)bis(hexane-6,l-diyl)bis(2-hexyldecanoate) / 6-[N-6-(2- hexyldecanoyloxy)hexyl-N-(4-hydroxybutyl)amino]hexyl 2-hexyldecanoate[2] ALC-0159 = 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide / 2-[2-(w-methoxy(polyethyleneglycol2000) ethoxy]-N,N-ditetradecylacetamide[3] DSPC = l,2-Distearoyl-sn-glycero-3-phosphocholine q.s. = quantum satis (as much as may suffice)

[0284] In some embodiments, particles (e.g., LNPs) disclosed herein are formulated in a solution comprising 10 mM Tris and 10% sucrose, optionally having a pH of about 7.4. In some embodiments, particles disclosed herein are formulated in a solution comprising about 103 mg / ml sucrose, about 0.20 mg / ml tromethamine (Tris base), and about 1.32 mg / ml Tris.

[0285] In some embodiments, a composition comprises:(a) about 0.1 mg / mL of RNA comprising an open reading frame encoding a SARS-CoV-2 protein or an immunogenic fragment or variant thereof,(b) about 1.43 mg / ml ALC-0315,(c) about 0.18 mg / ml ALC-0159,(d) about 0.31 mg / ml DSPC,(e) about 0.62 mg / ml cholesterol,(f) about 103 mg / ml sucrose,(g) about 0.20 mg / ml tromethamine (Tris base),(h) about 1.32 mg / ml Tris (hydroxymethyl) aminomethane hydrochloride (Tris HCI), and(i) q.s. water.

[0286] In one embodiment, the ratio of RNA (e.g., mRNA) to total lipid (N / P) is between 6.0 and 6.5, such as about 6.0 or about 6.3.

[0287] In some embodiments, compositions provided herein are formulated as a multi-dose formulation, optionally in a vial.Methods of Administering

[0288] Also described in the present disclosure, among other things, are methods that comprise administering a composition described herein. In some embodiments, methods described herein induce an immune response in a subject {e.g., an immune response against coronavirus).

[0289] In some embodiments, an amount of RNA described herein of at least about 0.25 pg, at least about 0.5 pg, at least about 1 pg, at least about 2 pg, at least about 3 pg, at least about 4 pg, at least about 5 pg, at least about 10 pg, at least about 15 pg, at least about 20 pg, at least about 25 pg, at least about 30 pg, at least about 40 pg, at least about 50 pg, or at least about 60 pg is administered per dose e.g., using a composition comprising the amountof RNA to be administered). In some embodiments, an amount of RNA described herein of at least 3 pg is administered in at least one dose. In some embodiments, an amount of RNA described herein of at least 3 pg is administered in at least one dose. In some embodiments, an amount of RNA described herein of at least 10 pg is administered in at least one dose. In some embodiments, an amount of RNA described herein of at least 15 pg is administered in at least one dose. In some embodiments, an amount of RNA described herein of at least 20 pg is administered in at least one dose. In some embodiments, an amount of RNA described herein of at least 25 pg is administered in at least one dose. In some embodiments, an amount of RNA described herein of at least 30 pg is administered in at least one dose. In some embodiments, combinations of aforementioned amounts may be administered in a regimen comprising two or more doses (e.g, a prior dose and a subsequent dose can be of different amounts as described herein). In some embodiments, a combination of the aforementioned amounts is administered in a primary regimen and a booster regimen (e.g., different doses can be given in a primary regimen and a booster regimen).

[0290] In some embodiments, a composition comprising an RNA described herein is administered as a first dose and / or as part of a priming vaccination regimen to a subject (e.g., a vaccine-naive subject is administered (i) two doses of such a composition, approximately 21 days apart, or (ii) three doses of such a composition, where the first and the second doses are administered approximately 21 days apart and the second and the third dose are administered about 28 days apart). In some embodiments, a three-dose regimen is administered to an immunocompromised patient, e.g., a cancer patient, an HIV patient, a patient who has received and / or is receiving immunosuppressant therapy (e.g., an organ transplant patient).

[0291] In some embodiments, a composition that comprises an RNA molecule described herein is administered to a subject who has previously been exposed to SARS-CoV-2 (e.g, a subject who has previously received at least one dose e.g, a complete dosing regimen) of a SARS-CoV-2 vaccine and / or previously been infected one or more times with SARS-CoV-2). In some embodiments, a composition comprising an RNA molecule described herein is administered as a booster dose. In some embodiments, a composition comprising an RNA molecule described herein is administered as a booster dose to a subject who has previously received one or more doses (e.g., a complete primary dosing regimen and / or one or more booster doses) of a vaccine that delivers a SARS-CoV-2 S protein of a Wuhan strain (e.g., a composition comprising an RNA molecule that comprises SEQ ID NO: 20, a commercially available vaccine (e.g., a commercially available vaccine described herein, (e.g., BNT162b2)) or any combination thereof).

[0292] Commercially available SARS-CoV-2 vaccines are known in the art, and include, e.g, an mRNA-1273 vaccine (SpikeVax), Comirnaty® (BNT162b2), an Ad26.CoV2.S vaccine, a ChAdxOxl vaccine, an NVX-CoV2373 vaccine, a CvnCoV vaccine, a GAM-COVIDOVac vaccine, a CoronaVac vaccine, a BBIBP-CorV vaccine, an Ad5-nCoV vaccine, a zf2001 vaccine, a SCB-2019 vaccine, or other approved RNA (e.g., mRNA) or adenovector vaccines, etc.

[0293] In some embodiments, an RNA molecule described herein is administered to a subject who has previously been administered at least two doses of BNT162b2 (e.g., two doses of BNT162b2 administered about 21 days apart). In some embodiments, an RNA molecule described herein is administered to a subject who has previously been administered at least three doses of BNT162b2. In some embodiments, such third dose is administered a period of time after the second dose that is comparable to (e.g, the same as) the period of time between the first and second doses. For example, in some embodiments, a third dose may be administered about 21 days following administration of the second dose. In some embodiments, a third dose is administered after a longer period of time relative to thesecond dose than the second dose was relative to the first dose. In some embodiments, a three-dose regimen is administered to an immunocompromised patient, e.g., a cancer patient, an HIV patient, a patient who has received and / or is receiving immunosuppressant therapy {e.g., an organ transplant patient). In some embodiments, the length of time between the second and third dose {e.g., a second and third dose administered to an immunocompromised patient) is at least about 21 days {e.g., at least about 28 days).

[0294] In some embodiments, an RNA molecule described herein is administered to a subject who has previously been administered a vaccine that delivers an antigen of a SARS-CoV-2 variant {e.g., an Omicron BA.4 / 5 variant or an XBB.1.5 variant). For example, in some embodiments, an RNA molecule described herein is administered to a subject previously administered one or more doses of a SARS-CoV-2 vaccine that delivers a SARS-CoV-2 S protein of a Wuhan strain {e.g., BNT162b2), and one or more booster doses of a variant adapted vaccine {e.g., one or more doses of a bivalent vaccine that delivers a SARS-CoV-2 S protein of a Wuhan strain and a SARS-CoV-2 S protein of an Omicron BA.4 / 5 strain, and / or one or more doses of a monovalent vaccine that delivers a SARS-CoV-2 S protein of an XBB.1.5 strain).

[0295] BNT162b2 (which comprises an RNA molecule comprising SEQ ID NO: 20) is an mRNA vaccine for prevention of COVID- 19 and demonstrated an efficacy of 95% or more at preventing COVID-19. The vaccine comprises a 5'capped mRNA molecule encoding for the full-length SARS-CoV-2 spike glycoprotein (S) encapsulated in lipid nanoparticles (LNPs). The finished product can be presented as a concentrate for dispersion for injection containing BNT162b2 as active substance. Other ingredients include: ALC-0315 (4- hydroxybutyl)azanediyl)bis(hexane-6,l-diyl)bis(2-hexyldecanoate), ALC-0159 (2-[(polyethylene glycol)-2000]-N,N- ditetradecylacetamide), l,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC), cholesterol, and, in some embodiments, potassium chloride, potassium dihydrogen phosphate, sodium chloride, disodium phosphate dihydrate, sucrose and water for injection.

[0296] In some embodiments, a composition comprising an RNA molecule described herein is administered to a subject previously administered a priming dosing regimen of a composition {e.g., an RNA composition) that delivers a SARS-CoV-2 S protein of a Wuhan strain {e.g., a subject previously administered (i) two doses of an RNA vaccine that encodes a SARS-CoV-2 S protein of a Wuhan strain, where the first and the second doses were administered about 21 days apart, or (ii) three doses of an RNA vaccine that encodes a SARS-CoV-2 S protein of a Wuhan strain, where the first and the second dose were administered about 21 days apart and the third dose was administered about 28 days after the second dose).

[0297] In some embodiments, a composition comprising an RNA molecule described herein is administered as a further booster dose to a subject previously administered a priming dosing regimen and one or more booster doses of a composition {e.g., an RNA composition) that delivers a SARS-CoV-2 S protein of a Wuhan strain {e.g., a subject previously administered (i) three doses of an RNA vaccine that encodes a SARS-CoV-2 S protein of a Wuhan strain, where the first and the second doses were administered about 21 days apart, and the third dose was administered at least about 2 months after the second dose, (ii) four doses of an RNA vaccine that encodes a SARS-CoV-2 S protein of a Wuhan strain, where the first and the second dose were administered about 21 days apart, the third dose was administered about 28 days after the second dose, and the fourth dose was administered at least about three months after the second dose, or (iii) four doses of an RNA vaccine that encodes a SARS-CoV-2 S protein of a Wuhan strain, where the first and the second dose were administered about 21 days apart, the third dose was administeredat least about 2 months after the second dose, and the fourth dose was administered at least about two months after the second dose).

[0298] In some embodiments, a composition comprising an RNA molecule described herein is administered to a subject previously administered one or more doses of a bivalent composition (e. ., an RNA composition) that delivers a SARS-CoV-2 S protein of a Wuhan strain and a SARS-CoV-2 S protein of an Omicron BA.4 / 5 variant. In some embodiments, a composition comprising an RNA molecule described herein is administered as a booster dose to a subject previously administered a priming dosing regimen of a bivalent composition (e.g, an RNA composition) that delivers a SARS-CoV-2 S protein of a Wuhan strain and a SARS-CoV-2 S protein of an Omicron BA.4 / 5 variant e.g., a subject previously administered (i) two doses of a bivalent RNA vaccine, where the first and the second doses were administered about 21 days apart, or (ii) three doses of a bivalent RNA vaccine, where the first and the second dose were administered about 21 days apart and the third dose was administered about 28 days after the second dose). In some embodiments, a composition comprising an RNA molecule described herein is administered as a further booster dose to a subject previously administered a priming dosing regimen and one or more booster doses of a bivalent composition e.g., an RNA composition) that delivers a SARS-CoV-2 S protein of a Wuhan strain and a SARS- CoV-2 S protein of an Omicron BA.4 / 5 variant {e.g., a subject previously administered (i) three doses of a bivalent RNA vaccine, where the first and the second doses were administered about 21 days apart, and the third dose was administered at least about 2 months after the second dose, (ii) four doses of a bivalent RNA vaccine, where the first and the second dose were administered about 21 days apart, the third dose was administered about 28 days after the second dose, and the fourth dose was administered at least about three months after the second dose, or (iii) four doses of a bivalent RNA vaccine, where the first and the second dose were administered about 21 days apart, the third dose was administered at least about 2 months after the second dose, and the fourth dose was administered at least about two months after the second dose).

[0299] In some embodiments, a composition comprising an RNA molecule described herein is administered to a subject previously administered (i) one or more doses of a composition that delivers a SARS-CoV-2 S protein of a Wuhan strain and (ii) one or more doses of a bivalent composition (e. ., an RNA composition) that delivers a SARS- CoV-2 S protein of a Wuhan strain and a SARS-CoV-2 S protein of an Omicron BA.4 / 5 variant.

[0300] In some embodiments, a composition comprising an RNA molecule described herein is administered to a subject previously administered: i) two doses (administered about 21 days apart) of an RNA vaccine that delivers a SARS-CoV-2 S protein of a Wuhan strain, and a dose of a bivalent composition comprising a first RNA molecule encoding a SARS-CoV-2 S protein of a Wuhan strain and a second RNA molecule encoding a SARS-CoV-2 S protein of an Omicron BA.4 / 5 variant, where the bivalent composition was administered at least about two months after the most recent dose of a composition that delivers a SARS-CoV-2 S protein of a Wuhan strain; ii) three doses of an RNA vaccine that delivers a SARS-CoV-2 S protein of a Wuhan strain (where the first and the second dose were administered about 21 days apart and the third dose was administered about 28 days after the second dose) and at least one dose of a bivalent vaccine comprising a first RNA molecule encoding a SARS-CoV-2 S protein of a Wuhan strain and a second RNA molecule encoding a SARS-CoV-2 S protein of an Omicron BA.4 / 5 variant, where the bivalent composition was administeredat least about 2 months after the most recent dose of a composition that delivers a SARS-CoV-2 S protein of a Wuhan strain; iii) three doses of an RNA vaccine that delivers a SARS-CoV-2 S protein of a Wuhan strain (where the first and the second dose were administered about 21 days apart and the third dose was administered at least about 2 months after the second dose) and at least one dose of a bivalent vaccine comprising a first RNA molecule encoding a SARS-CoV-2 S protein of a Wuhan strain and a second RNA molecule encoding a SARS-CoV-2 S protein of an Omicron BA.4 / 5 variant, where the bivalent composition was administered at least about 2 months after the most recent dose of a composition that delivers a SARS- CoV-2 S protein of a Wuhan strain; iv) four doses of an RNA vaccine that delivers a SARS-CoV-2 S protein of a Wuhan strain (where the first and the second dose were administered about 21 days apart, the third dose was administered about 28 days after the second dose, and the fourth dose was administered at least about 2 months after the third dose) and at least one dose of a bivalent vaccine comprising a first RNA molecule encoding a SARS-CoV-2 S protein of a Wuhan strain and a second RNA molecule encoding a SARS-CoV-2 S protein of an Omicron BA.4 / 5 variant, where the bivalent composition was administered at least about 2 months after the most recent dose of a composition that delivers a SARS-CoV-2 S protein of a Wuhan strain; or four doses of an RNA vaccine that delivers a SARS-CoV-2 S protein of a Wuhan strain (where the first and the second dose were administered about 21 days apart, the third dose was administered at least about 2 months after the second dose, and the fourth dose was administered at least about 4 months after the third dose) and at least one dose of a bivalent vaccine comprising a first RNA molecule encoding a SARS-CoV-2 S protein of a Wuhan strain and a second RNA molecule encoding a SARS-CoV-2 S protein of an Omicron BA.4 / 5 variant, where the bivalent composition was administered at least about 2 months after the most recent dose of a composition that delivers a SARS-CoV-2 S protein of a Wuhan strain.

[0301] In some embodiments, a dose (e. ., a dose administered as part of a primary dosing regimen or a booster regimen) comprises about 30 pg of an RNA molecule described herein. In some embodiments, a dose comprising about 30 pg of RNA molecule described herein is administered to a subject who is 12 years or older.

[0302] In some embodiments, a dose e.g., a dose administered as part of a primary dosing regimen or a booster regimen) comprises about 10 pg of an RNA molecule described herein. In some embodiments, a dose comprising about 10 pg of an RNA molecule described herein is administered to a subject who is 5 years to less than 12 years old.

[0303] In some embodiments, a dose e.g., a dose administered as part of a primary dosing regimen or a booster regimen) comprises about 3 pg of an RNA molecule described herein. In some embodiments, a dose comprising about 3 pg of an RNA molecule described herein is administered to a subject who is 6 months to less than 5 years old.

[0304] In some embodiments, a composition described herein is administered in a volume of between about 200 pl and about 300 pl e.g., about 200 pl or about 300 pl).

[0305] In some embodiments, RNA in a pharmaceutical RNA preparation is diluted prior to administration (e.g., diluted to a concentration of about 0.05 mg / ml). In some embodiments, administration volumes are between about200 pl and about 300 pl. In some embodiments, RNA in a pharmaceutical RNA preparation is formulated in about 10 mM Tris buffer, and about 10% sucrose.

[0306] In some embodiments, an RNA {e.g., mRNA) composition disclosed herein may be administered in conjunction with a vaccine targeting a non-SARS-CoV-2 infectious agent (e.g., influenza, RSV, etc.). In some embodiments, the non-SARS-CoV-2 infectious agent is one that increases the likelihood of a subject experiencing one or more deleterious symptoms associated with infection by SARS-CoV-2 and / or the non-SARS-CoV-2 infectious agent when the subject is coinfected with SARS-CoV-2 and the infectious agent. In some embodiments, the non-SARS- CoV-2 infectious agent is one that increases the severity of one or more deleterious symptoms associated with infection with SARS-CoV-2 and / or the infectious agent. In some embodiments, the non-SARS-CoV-2 infectious agent is one that increases the transmissibility of SARS-CoV-2 when a subject is coinfected with SARS-CoV-2 and the infectious agent.

[0307] In some embodiments, at least one RNA (e.g., mRNA) composition described herein may be administered in combination with a vaccine that targets influenza. In some embodiments, at least two or more different drug products / formulations may comprise at least one RNA {e.g., mRNA) composition described herein and a vaccine targeting a different infectious agent e.g., an influenza vaccine). In some embodiments, different drug products / formulations are separately administered. In some embodiments, such different drug product / formulations are separately administered at the same time {e.g., at the same vaccination session) at different sites of a subject {e.g., at different arms of the subject).

[0308] In one embodiment, the vaccination regimen comprises a first vaccination using at least two doses of RNA described herein, e.g., two doses of RNA described herein (wherein the second dose may be administered about 21 days following administration of the first dose), and a second vaccination using a single dose or multiple doses, e.g., two doses of RNA described herein. In various embodiments, the second vaccination is administered at least about 2 months after a previous dose {e.g., about 3 to about 24 months, about 6 to about 18 months, about 6 to about 12 months, or about 5 to about 7 months after administration of a previous vaccine, e.g., after an initial two-dose regimen or a booster dose). The amount of RNA used in each dose of the second vaccination may be equal or different to the amount of RNA used in each dose of the first vaccination. In one embodiment, the amount of RNA used in each dose of the second vaccination is equal to the amount of RNA used in each dose of the first vaccination. In one embodiment, the amount of RNA used in each dose of the second vaccination and the amount of RNA used in each dose of the first vaccination is about 30 pg per dose. In one embodiment, the same RNA as used for the first vaccination is used for the second vaccination.

[0309] In some embodiments, an RNA composition described herein is co-administered with one or more vaccines against a non-COVID-19 disease. In some embodiments, an RNA composition described herein is co-administered with one or more vaccines against a non-COVID-19 viral disease. In some embodiments, an RNA composition described herein is co-administered with one or more vaccines against a non-COVID-19 respiratory disease. In some embodiments, the non-COVD-19 respiratory disease results from infection with a non-SARS-CoV-2 Coronavirus, an Influenza virus, a Pneumoviridae virus, or a Paramyxoviridae virus. In some embodiments, the Pneumoviridae virus is a Respiratory syncytial virus (RSV) or a Metapneumovirus (MPV). In some embodiments, the Metapneumovirus is a human metapneumovirus (hMPV). In some embodiments, the Paramyxoviridae virus is a Parainfluenza virus or a Henipavirus. In some embodiments the parainfluenzavirus is PIV3. In some embodiments, the non-SARS-CoV-2coronavirus is a betacoronavirus (e.g., SARS-CoV-1). In come embodiments the non-SARS-CoV-2 coronavirus is a Merbecovirus (e.g., a MERS-CoV virus).

[0310] In some embodiments, an RNA composition described herein is co-administered with an RSV vaccine (e.g., a vaccine delivering an RSV A and / or RSV B antigen). In some embodiments, the RSV vaccine comprises an RSV fusion protein (F), an RSV attachment protein (G), an RSV small hydrophobic protein (SH), an RSV matrix protein (M), an RSV nucleoprotein (N), an RSV M2-1 protein, an RSV Large polymerase (L), and / or an RSV phosphoprotein (P), or an immunogenic fragment of immunogenic variant thereof, or a nucleic acid (e.g., RNA), encoding any one of the same.

[0311] Numerous RSV vaccines are known in the art, any one of which can be co-administered with an RNA composition described herein. See, for example, the list of vaccines provided on the website of PATH, a global health organization. Examples of RSV vaccines are also provided in Mazur, Natalie I., et al, "The respiratory syncytial virus vaccine landscape: lessons from the graveyard and promising candidates," The Lancet Infectious Diseases 18.10 (2018): e295-e311, the contents of which is incorporated by reference herein in its entirety. In some embodiments, an RNA composition described herein is co-administered with an RSV vaccine that has been previously published on (e.g., an RSV vaccine described on the PATH website, or in Mazur et al.). In some embodiments, an RNA composition described herein is co-administered with a live-attenuated or chimeric vaccine (e.g., rBCG-N-hRSV (developed by Ponteificia Uinersidad Catolica de Chile), RSV D46 cp AM202 (developed by Sanofi Pasteur / LID / NIAD / NIH), RSV LID AM2-2 1030s (developed by Sanofi Pasteur / LID / NIAD / NIH), RSV ANS2 A1313 / I1314L (developed by Sanofi Pasteur / LID / NIAD / NIH), RSV D46 ANS2 N AM2-2 Hindlll (developed by Sanofi Pasteur / LID / NIAD / NIH) or RSV LID AM2-2 1030s (developed by Sanofi Pasteur / LID / NIAD / NIH), MV-012-968 (developed by Meissa Vaccines), SP0125 (developed by Sanofi), blb201 (developed by Blue lake), CodaVax™-RSV (developed by Cadagenix), RSVDeltaG (developed by Intravacc), or SeVRSV (developed by SIHPL and St. Jude hospital), a particle based vaccine (e.g., RSV F nanoparticle (developed by Novavax) or SynGEM (developed by Mucosis), Icosavzx (developed by IVX-121), or V- 306 (developed by Virometix)), a subunit vaccine (e.g., GSK RSV F (developed by GSK), Arexvy (developed by GSK), DPX-RSV (developed by Dalousie Univeristy, Immunovaccine, and VIB), RSV F DS-Cavl (developed by NIH / NIAID / VRC), MEDI-7510 (developed by Medlmmune), RSVpreF (developed by Pfizer), ADV110 (developed by Advaccine), VN-0200 (developed by Daiichi Sankyo, Inc.)), a vector vaccine (e.g., MVA-BN RSV (developed by Banarian Nordic), VXA-RSVf oral (developed by Vaxart), Ad26.RSV.pref (developed by Janssen), ChAdl55-RSV (developed by GSK) Immunovaccine, DPX-RSV (developed by VIB), or DS-Cavl (developed by NIH / NIAID / VRC) or a nucleic acid vaccine (e.g., an mRNA vaccine being developed by CureVac (currently unnamed) or mRNA-1345 (developed by Moderna), or SP0274 (developed by Sanofi)).

[0312] In some embodiments, an RNA composition described herein is co-administered with an influenza vaccine. In some embodiments, the influenza vaccine is an alpha-influenza virus, a beta-influenza virus, a gamma-influenza virus or a delta-influenza virus vaccine. In some embodiments the vaccine is an Influenza A virus, an Influenza B virus, an Influenza C virus, or an Influenza D virus vaccine. In some embodiments, the influenza A virus vaccine comprises a hemagglutinin selected from Hl, H2, H3, H4, H5, H6, H7, H8, H9, H10, Hll, H12, H13, H14, H15, H16, H17, and H18, or an immunogenic fragment or variant of the same, or a nucleic acid (e.g., RNA) encoding any one of the same. In some embodiments the influenza A vaccine comprises or encodes a neuraminidase (NA) selected from Nl, N2, N3, N4, N5, N6, N7, N8, N9, N10, and Nil, or an immunogenic fragment or variant of the same, or a nucleic acid (e.g., RNA) encoding any one of the same. In some embodiments, the influenza vaccine comprises at least oneInfluenza virus hemagglutinin (HA), neuraminidase (NA), nucleoprotein (NP), matrix protein 1 (Ml), matrix protein 2 (M2), non-structural protein 1 (NS1 ), non-structural protein 2 (NS2), nuclear export protein (NEP), polymerase acidic protein (PA), polymerase basic protein PB1, PB1-F2, and / or polymerase basic protein 2 (PB2), or an immunogenic fragment or variant thereof, or a nucleic acid (e.g., RNA) encoding any of one of the same.

[0313] In some embodiments, an RNA composition described herein can be co-administered with a commercially approved influenza vaccine. In some embodiments, an RNA composition described herein can be co-administered with an inactivated influenza virus (e.g., Fluzone®, Fluzone high-dose quadrivalent®, Fluzone quadrivalent®, Fluzone intradermal quardivalent®, Fluzone quadrivalent southern hemisphere®, Fluad®, Fluad quadrivalent®, Afluria Quardivalent®, Fluarix Quadrivalent®, FluLaval Quadrivalent®, or Flucelvax Quadrivalent®), a recombinant influenza vaccine (e.g., Flublok quadrivalent®), a live attenuated influenza vaccine (e.g., FluMist Quadrivalent®), a non-adjuvanted influenza vaccine, an adjuvanted influenza vaccine, or a subunit or split vaccine.

[0314] In some embodiments, an RNA composition described herein is co-administered with an influenza vaccine and / or an RSV vaccine.

[0315] In one embodiment, a composition or medical preparation is a pharmaceutical composition.

[0316] In one embodiment, a composition or medical preparation is a vaccine.

[0317] In some embodiments, a composition described herein is co-administered with a vaccine against a non- SARS-CoV-2 disease, where the composition described herein is administered in a dose described herein (e.g., in a dose comprising 3 pg, 10 pg, or 30 pg or RNA), and the vaccine against the non-SAR-CoV-2 disease is administered in an approved amount and / or consistent with a manner described in a drug label. In some embodiments, the composition described herein and the vaccine against a non-SARS-CoV-2 disease are administered (e.g., via injection (e.g., via intramuscular injection)) at separate sites (e.g., separate arms). In some embodiments, the composition described herein and the vaccine against a non-SARS-CoV-2 disease are administered (e.g., via injection (e.g., via intramuscular injection)) at the same site (e.g., the same site on an arm). In some embodiments, the composition described herein and the vaccine against a non-SARS-CoV-2 disease are administered (e.g., via injection (e.g., via intramuscular injection)) immediately after one another. In some embodiments, the composition described herein and the vaccine against a non-SARS-CoV-2 disease are mixed shortly before administration (e.g., mixed 30 minutes or less, 20 minutes or less, 15 minutes or less, 10 minutes or less, 5 minutes or less, 1 minute or less). In some embodiments, the composition described herein and the vaccine against a non-SARS-CoV-2 disease are administered immediately after mixing.

[0318] In some embodiments, a composition comprises one or more RNA molecules described herein, and one or more antigens of a non-SARS-CoV-2 infectious agent or a nucleic acid encoding the same (e.g., one or more influenza antigens and / or one or more RSV antigens described herein).Exemplary Embodiments1. A composition comprising an RNA molecule having:(a) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 182;(b) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 182, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 179 and / or (II) one or more of the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G,A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, P1143L, or any combination thereof; and / or(c) a nucleotide sequence of SEQ ID NO: 182; wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.2. The composition of embodiment 1, wherein the RNA molecule has a nucleotide sequence of SEQ ID NO: 182.3. A composition comprising an RNA molecule having:(a) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 187;(b) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 187, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 184 and / or (ii) one or more of the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, P1143L, or any combination thereof; and / or(c) a nucleotide sequence of SEQ ID NO: 187; wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.4. The composition of embodiment 3, wherein the RNA molecule has a nucleotide sequence of SEQ ID NO: 187.5. A composition comprising an RNA molecule having:(a) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 192;(b) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 192, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 189 and / or (ii) one or more of the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, T572I, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, P1143L, E1150D, or any combination thereof; and / or(c) a nucleotide sequence of SEQ ID NO: 192; wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.6. The composition of embodiment 5, wherein the RNA molecule has a nucleotide sequence of SEQ ID NO: 192.7. A composition comprising an RNA molecule having:(a) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 197;(b) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 197, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 194 and / or (ii) one or more of the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, P1143L, M1229I, or any combination thereof; and / or(c) a nucleotide sequence of SEQ ID NO: 197; wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.8. The composition of embodiment 7, wherein the RNA molecule has a nucleotide sequence of SEQ ID NO: 197.9. A composition comprising an RNA molecule having:(a) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 202;(b) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 202, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 199 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof and / or(c) a nucleotide sequence of SEQ ID NO: 202; wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.10. The composition of embodiment 9, wherein the RNA molecule has a nucleotide sequence of SEQ ID NO: 202.11. A composition comprising an RNA molecule having:(a) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 207;(b) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ IDNO: 207, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 204 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, T22N, A24-26, A27S, S50L, F59S, A69-70, V127F, G142D, A145, F157S,R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q493E, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof; and / or(c) a nucleotide sequence of SEQ ID NO: 207; wherein the RNA molecule comprises:(iii) a 5' cap; and(iv) a modified uridine in place of each uridine.12. The composition of embodiment 11, wherein the RNA molecule has a nucleotide sequence of SEQ ID NO: 207.13. The composition of any one of embodiments 1-12, wherein the SARS-CoV-2 S protein further comprises one or more mutations that stabilize a prefusion confirmation of the SARS-CoV-2 S protein (e.g., one or more mutations as described herein, including one or both of the following mutations relative to SEQ ID NO: 1: K986P and V987P).14. The composition of any one of embodiments 1-13, wherein the SARS-CoV-2 S protein comprises:(a) a mutation at a position corresponding to position 22 of SEQ ID NO: 1 (e.g., T22N);(b) mutations at positions corresponding to position 22 and 59 of SEQ ID NO: 1 (e.g., T22NId F59S);(c) a mutation at a position corresponding to position 59 of SEQ ID NO: 1 (e.g., F59S);(d) a mutation at a position corresponding to position 346 of SEQ ID NO: 1 (e.I R346T);(e) mutations at positions corresponding to positions 346 and 1104 of SEQ ID NO: 1 (e.g., R346T and V1104L);(f) mutation at a position corresponding to position 455 of SEQ ID NO: 1 (e.g., L455S or L455F);(g) a mutation at a position corresponding to position 456 of SEQ ID NO: 1 (e.g., F456L);(h) mutations at positions corresponding to positions 455 and 456 of SEQ ID NO: 1 (e.g., F456L and L455F);(i) a mutation at a position corresponding to position 493 of SEQ ID NO: 1 (e.g., Q493E);0) a mutation at a position corresponding to position 1104 of SEQ ID NO: 1 (e.g., V1104L); or(k) any combination of (a)-(j).15. The composition of any one of embodiments 1-14, wherein the modified uridine is Nl-methyl- pseudouridine.16. The composition of any one of embodiments 1-14, wherein the 5' cap comprises m27'3' °Gppp(mi2'- °)ApG.17. The composition of any one of embodiments 1-16, wherein the RNA molecule is encapsulated in or associated with a lipid nanoparticle (LNP).18. The composition of any one of embodiments 1-17, wherein the composition comprises one or more additional RNA molecules, each having a nucleotide sequence encoding an S protein of a SARS-CoV-2 strain or variant that is not JN. l, JN.1.2, JN.1.6, KP.2, XEC, and / or JN.1.7.19. The composition of embodiment 18, wherein the one or more additional RNA molecules comprise a sequence that is at least 95% identical to any one of SEQ ID NOs: 20, 72, 103, or 161.20. A composition comprising an RNA molecule having a nucleotide sequence as set forth in SEQ ID NO: 182, wherein the RNA molecule comprises:(a) Nl-methyl-pseudouridine in place of each uridine; and(b) a 5' cap that comprises m27-3 OGppp(mi2' °)ApG; wherein the RNA molecule is encapsulated in a lipid nanoparticle (LNP).21. A composition comprising an RNA molecule having a nucleotide sequence as set forth in SEQ ID NO: 187, wherein the RNA molecule comprises:(a) Nl-methyl-pseudouridine in place of each uridine; and(b) a 5' cap that comprises m27'3' °Gppp(mi2' °)ApG; wherein the RNA molecule is encapsulated in a lipid nanoparticle (LNP).22. A composition comprising an RNA molecule having a nucleotide sequence as set forth in SEQ ID NO: 192, wherein the RNA molecule comprises:(a) Nl-methyl-pseudouridine in place of each uridine; and(b) a 5' cap that comprises m27'3'0Gppp(mi2' °)ApG; wherein the RNA molecule is encapsulated in a lipid nanoparticle (LNP).23. A composition comprising an RNA molecule having a nucleotide sequence as set forth in SEQ ID NO: 197, wherein the RNA molecule comprises:(a) Nl-methyl-pseudouridine in place of each uridine; and(b) a 5' cap that comprises m27'3' °Gppp(mi2' °)ApG; wherein the RNA molecule is encapsulated in a lipid nanoparticle (LNP).24. A composition comprising an RNA molecule having a nucleotide sequence as set forth in SEQ ID NO: 202, wherein the RNA molecule comprises:(a) Nl-methyl-pseudouridine in place of each uridine; and(b) a 5' cap that comprises m27'3' °Gppp(mi2'0)ApG; wherein the RNA molecule is encapsulated in a lipid nanoparticle (LNP).25. A composition comprising an RNA molecule having a nucleotide sequence as set forth in SEQ ID NO: 207, wherein the RNA molecule comprises:(a) Nl-methyl-pseudouridine in place of each uridine; and(b) a 5' cap that comprises m27'3' °Gppp(mi2' °)ApG; wherein the RNA molecule is encapsulated in a lipid nanoparticle (LNP).26. The composition of any one of embodiments 1-25, comprising about 10 mM Tris buffer and about 10% sucrose.27. The composition of any one of embodiments 1-26, wherein the composition is formulated as a multi-dose formulation in a vial.28. A composition comprising at least one unit dose of LNP-encapsulated RNA molecules, wherein the composition comprises a population of LNPs encapsulating RNA molecules, and wherein:(a) the LNPs comprise an ionizable cationic lipid, a neutral lipid, a sterol, and a PEG-modified lipid; and(b) each LNP in the population encapsulates at least one RNA molecule, wherein the RNA molecule comprises:(i) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 182; or(ii) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 182, and that comprises a nucleotide sequence that encodes a SARS-CoV-2 protein comprising the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, and P1143L;(iii) Nl-methyl-pseudouridine in place of each uridine; and(iv) a 5' cap that comprises m27'3' °Gppp(mi2'0)ApG.29. A composition comprising at least one unit dose of LNP-encapsulated RNA molecules, wherein the composition comprises a population of LNPs encapsulating RNA molecules, and wherein:(a) the LNPs comprise an ionizable cationic lipid, a neutral lipid, a sterol, and a PEG-modified lipid; and(b) each LNP in the population encapsulates at least one RNA molecule, wherein the RNA molecule comprises:(i) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 187; or(ii) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 187, and that comprises a nucleotide sequence that encodes a SARS-CoV-2 protein comprising the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, and P1143L;(iii) Nl-methyl-pseudouridine in place of each uridine; and(iv) a 5' cap that comprises m27'3' °Gppp(mi2'0)ApG.30. A composition comprising at least one unit dose of LNP-encapsulated RNA molecules, wherein the composition comprises a population of LNPs encapsulating RNA molecules, and wherein:(a) the LNPs comprise an ionizable cationic lipid, a neutral lipid, a sterol, and a PEG-modified lipid; and(b) each LNP in the population encapsulates at least one RNA molecule, wherein the RNA molecule comprises:(i) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 192; or(ii) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 192, and that comprises a nucleotide sequence that encodes a SARS-CoV-2 protein comprising the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, T572I, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, P1143L, and E1150D;(iii) Nl-methyl-pseudouridine in place of each uridine; and(iv) a 5' cap that comprises m27'3' °Gppp(mi2'0)ApG.31. A composition comprising at least one unit dose of LNP-encapsulated RNA molecules, wherein the composition comprises a population of LNPs encapsulating RNA molecules, and wherein:(a) the LNPs comprise an ionizable cationic lipid, a neutral lipid, a sterol, and a PEG-modified lipid; and(b) each LNP in the population encapsulates at least one RNA molecule, wherein the RNA molecule comprises:(i) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 197; or(ii) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 197, and that comprises a nucleotide sequence that encodes a SARS-CoV-2 protein comprising the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145. F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, P1143L, and M1229I;(iii) Nl-methyl-pseudouridine in place of each uridine; a...

Claims

CLAIMSWe Claim:

1. An RNA molecule comprising:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 200 or 202, and which encodes a SARS-CoV-2 S protein comprising (I) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 199 and / or (II) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 200 or 202; and / or(c) a nucleotide sequence of SEQ ID NO: 200 or 202; and wherein the RNA molecule comprises:(iii) a 5' cap; and(iv) a modified uridine in place of each uridine.

2. An RNA molecule comprising:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 237 or 239, and which encodes a SARS-CoV-2 S protein comprising (I) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 199 and / or (II) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof; and / or(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 237 or 239; and / or(c) a nucleotide sequence of SEQ ID NO: 237 or 239; and wherein the RNA molecule comprises:(I) a 5' cap; and(ii) a modified uridine in place of each uridine.

3. An RNA molecule comprising:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 242 or 244, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 199 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof; and / or(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 242 or 244; and / or(c) a nucleotide sequence of SEQ ID NO: 242 or 244; and wherein the RNA molecule comprises:(iii) a 5' cap; and(iv) a modified uridine in place of each uridine.

4. An RNA molecule comprising a nucleotide sequence encoding a SARS-CoV-2 S protein, or a fragment of an SARS-CoV-2 S protein, wherein:(a) if the RNA molecule encodes a SARS-CoV-2 S protein, the SARS-CoV-2 S protein comprises all of the following mutations: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, and P1143L, where positions are indicated relative to SEQ ID NO: 1; and(b) if the RNA molecule encodes a fragment of a SARS-CoV-2 S protein, the fragment of a SARS-CoV-2 S protein comprises one or more of the following mutations: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof, where positions are indicated relative to SEQ ID NO: 1, to the extent the mutations are in a region that is present in the fragment of the SARS-CoV-2 S protein; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

5. The RNA molecule of claim 4, comprising:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 180 or 182, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 179 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 180 or 182; and / or(c) a nucleotide sequence of SEQ ID NO: 180 or 182; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

6. The RNA molecule of claim 4, comprising:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 229 or 231, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 179 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 229 or 231; and / or(c) a nucleotide sequence of SEQ ID NO: 229 or 231; and wherein the RNA molecule comprises:(i) a 5' cap; and(ii) a modified uridine in place of each uridine.

7. The RNA molecule of claim 4, comprising:(a) a nucleotide sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 233 or 235, and which encodes a SARS-CoV-2 S protein comprising (i) an amino acid sequence that is at least 95% (e.g., 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 179 and / or (ii) one or more the following mutations relative to SEQ ID NO: 1: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, E554K, A570V, D614G, P621S, H655Y, N679K, P681R, N764K, D796Y, S939F, Q954H, N969K, V1104L, P1143L, or any combination thereof;(b) a nucleotide sequence that is at least 99% identical to SEQ ID NO: 233 or 235; and / or(c) a nucleotide sequence of SEQ ID NO: 233 or 235; and wherein the RNA molecule comprises:(i) a 5' cap; and(i) a modified uridine in place of each uridine.

8. The RNA molecule of any one of claims 1-7, wherein the SARS-CoV-2 S protein comprises one or more mutations that stabilize a prefusion confirmation of the SARS-CoV-2 S protein (e.g., one or more mutations described herein, including one or both of the following mutations relative to SEQ ID NO: 1: K986P and V987P).

9. The RNA molecule of claim 4, wherein the RNA molecule encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 286 or a sequence that is at least 70% identical to SEQ ID NO: 286 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 286),(b) a nucleotide sequence of SEQ ID NO: 288 or a sequence that is at least 70% identical to SEQ ID NO: 228 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 228),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 285, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 285 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 285); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, or any combination thereof, where positions are indicated relative to SEQ ID NO: 1.

10. The RNA molecule of claim 4, wherein the RNA molecule encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 290 or a sequence that is at least 70% identical to SEQ ID NO: 290 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 290),(b) a nucleotide sequence of SEQ ID NO: 292 or a sequence that is at least 70% identical to SEQ ID NO: 292 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 292),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 285, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 285 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 285); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, or any combination thereof, where positions are indicated relative to SEQ ID NO: 1.

11. The RNA molecule of claim 4, wherein the RNA molecule encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 294 or a sequence that is at least 70% identical to SEQ ID NO: 294 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 294),(b) a nucleotide sequence of SEQ ID NO: 296 or a sequence that is at least 70% identical to SEQ ID NO: 296 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 296),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 285, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 285 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 285); or(d) any combination of (a)-(c);optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, or any combination thereof, where positions are indicated relative to SEQ ID NO: 1.

12. The RNA molecule of claim 4, wherein the RNA molecule encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 364 or a sequence that is at least 70% identical to SEQ ID NO: 364 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 364),(b) a nucleotide sequence of SEQ ID NO: 438 or a sequence that is at least 70% identical to SEQ ID NO: 468 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 438),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 363, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 363 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 363); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, or any combination thereof, where positions are indicated relative to SEQ ID NO: 1.

13. The RNA molecule of claim 4, wherein the RNA molecule encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 367 or a sequence that is at least 70% identical to SEQ ID NO: 367 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 367),(b) a nucleotide sequence of SEQ ID NO: 369 or a sequence that is at least 70% identical to SEQ ID NO: 369 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 369),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 363, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 363 {e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 363); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S,R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, or any combination thereof, where positions are indicated relative to SEQ ID NO: 1.

14. The RNA molecule of claim 4, wherein the RNA molecule encodes a fragment of a SARS-CoV-2 S protein, and wherein the RNA molecule comprises:(a) a nucleotide sequence of SEQ ID NO: 370 or a sequence that is at least 70% identical to SEQ ID NO: 370 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 370),(b) a nucleotide sequence of SEQ ID NO: 372 or a sequence that is at least 70% identical to SEQ ID NO: 372 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 372),(c) a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide having an amino acid sequence of SEQ ID NO: 363, or an amino acid sequence that is at least 70% identical to SEQ ID NO: 363 e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, identity to SEQ ID NO: 363); or(d) any combination of (a)-(c); optionally, wherein the fragment of the SARS-CoV-2 S protein comprises one or more mutations corresponding to one or more of: insl6MPLF, T19I, R21T, A24-26, A27S, S50L, A69-70, V127F, G142D, A145, F157S, R158G, A211, L212I, V213G, L216F, H245N, A264D, I332V, G339H, R346T, K356T, S371F, S373P, S375F, T376A, R403K, D405N, R408S, K417N, N440K, V445H, G446S, N450D, L452W, L455S, F456L, N460K, S477N, T478K, N481K, A483, E484K, F486P, Q498R, N501Y, Y505H, or any combination thereof, where positions are indicated relative to SEQ ID NO: 1.

15. The composition of any one of claims 1-14, wherein the modified uridine is Nl-methyl- pseudouridine and / or wherein the 5' cap comprises m27'3,°Gppp(mi2' °)ApG.

16. The composition of any one of claims 1-15, wherein the RNA molecule is encapsulated in or associated with a lipid nanoparticle (LNP).

17. The RNA of any one of any one of claims 1-16, wherein the nucleotide sequence encoding the polypeptide has been codon-optimized (e.g., codon-optimized for expression in human cells) and / or which has been enriched for a G / C content (e.g., has a total G / C content of 40% or higher, 50% or higher, 60% or higher, or 70% or higher).

18. The RNA of any one of any one of claims 1-17, wherein the RNA comprises a 5' cap, a cap proximal sequence, a 5' UTR sequence, a 3' UTR sequence, and a polyA sequence, optionally wherein:(a) the 5' cap comprises a Capl structure;(b) the 5'-UTR sequence comprises a modified human alpha-globin 5'-UTR;(c) the 3'-UTR sequence comprises a first sequence from the amino terminal enhancer of split (AES) messenger RNA and a second sequence from the mitochondrial encoded 12S ribosomal RNA;(d) the polyA sequence comprises at least 100 A nucleotides; or(e) a combination of any one of (i)-(iv).

19. The RNA of claim 18, wherein:(a) the 5' cap comprises a Capl structure, and the Capl structure comprises m7(3'OMeG)(5')ppp(5')(2'OMeAl)pG2, wherein Al is position +1 of the RNA, and G2 is position +2 of the RNA;(b) the polyA sequence comprises an interrupted sequence of A nucleotides, optionally wherein the interrupted sequence comprises 30 adenine nucleotides followed by 70 adenine nucleotides, wherein the 30 adenine nucleotides and 70 adenine nucleotides are separated by a linker sequence, optionally wherein the interrupted polyA tail sequence comprises SEQ ID NO: 14, or a sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 14;(c) 5'-UTR sequence comprises SEQ ID NO: 12, or a sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 12;(d) the 3'-UTR sequence comprises SEQ ID NO: 13, or a sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 13; or(e) any combination of (a)-(e).

20. The RNA of any one of claims 1-19, wherein the RNA is saRNA, self-amplifying RNA, transamplifying RNA (taRNA), or mRNA.

21. A composition comprising an RNA molecule of any one of claims 1-20.

22. The composition of claim 21, wherein the composition comprises one or more additional RNA molecules comprising a nucleotide sequence that encodes an S protein of a SARS-CoV-2 variant, optionally wherein the S protein encoded by each of the one or more additional RNA molecules is not an S protein of a JN. l, JN.1.2, IN.1.6, KP.2, XEC, JN.1.7, MV.l, MC. l, LP.8.1, and / or LF.7 SARS-CoV-2 variant.

23. The composition of claim 21 or 22, comprising about 10 mM Tris buffer and about 10% sucrose.

24. The composition of any one of claims 21-23, wherein the composition is formulated as a multi-dose formulation in a vial.

25. The composition of any one of claims 21-24, wherein the composition is formulated to provide one or more unit doses, wherein each unit dose comprises about 100 pg or less (e.g., about 90 pg or less), or about 60 pg, about 30 pg, about 25 pg, about 20 pg, about 10 pg, about 6 pg, about 5 pg, about 3 pg, about 2 pg, about 1 pg, or about 0.5 pg of the RNA molecule.

26. A method comprising administering to a subject the RNA molecule of any one of claims 1-17, or the composition of any one of claims 21-25.

27. The method of claim 26, comprising administering about 30 pg, about 20 pg, about 10 pg, about 5 pg, about 3 pg, about 2 pg, about 1 pg, or about 0.5 pg of the RNA molecule.

28. The method of claim 26 or 27, wherein:(a) the subject is 12 years or older, and the method comprises administering about 30 pg, about 20 pg, about 10 pg, or about 5 pg of the RNA molecule;(b) the subject is 5 years to less than 12 years old, and the method comprises administering about 10 pg, about 6.6 pg, about 3.3 pg, or about 1.6 pg of the RNA molecule; or(c) the subject is 6 months to less than 5 years old, and the method comprises administering about 3 pg, about 2 pg, about 1 pg, or about 0.5 pg of the RNA molecule.

29. The method of any one of claims 26-28, wherein the composition is administered in a volume of about 200 pL to 300 pL.

30. The method of any one of claims 26-29, wherein the subject was previously administered one or more doses of a SARS-CoV-2 vaccine or wherein the subject has not previously been administered one or more doses of a SARS-CoV-2 vaccine.

31. The method of any one of claims 26-30, further comprising co-administering one or more vaccines against a non-SARS-CoV-2 disease.

32. The method of claim 31, wherein the one or more vaccines comprise an RSV vaccine, an influenza vaccine, or a combination thereof.

Citation Information

Patent Citations

  • Coronavirus vaccine

    WO2021213924A1

  • RNA constructs and uses thereof

    WO2021214204A1

  • Engineered coronavirus spike (s) protein and methods of use thereof

    WO2021243122A2

  • RNA constructs and uses thereof

    WO2023073190A1

  • Coronavirus vaccine

    WO2023147091A1