Viral vectors encoding GAD for treatment of spasticity

Abstract

A method of treating spasm in a subject is provided. The method comprises directly administering a herpes simplex virus type 1 (HSV-1) vector carrying a glutamate decarboxylase (GAD) gene (preferably GAD67) to one or more epithelial regions of the subject.

Description

[0001] Inventors: Gregorz Sarek (Poland), David J Fink (USA), Carmelo Bellardita (Italy) Related Applications

[0002] This application claims priority to French Application Serial No. 2212771, filed on December 05, 2022, the content of which is incorporated herein by reference in its entirety. Technical Field

[0003] This application relates to methods for treating spasticity. Background Art

[0004] Spasticity is a condition of muscle stiffness or tightness that impedes normal, smooth movement. Muscles contract continuously and resist stretching, thus affecting movement, speech, and gait. Spasticity is common in central nervous system (CNS) disorders and typically occurs after spinal cord injury (SCI), affecting upper motor neurons and thus being part of the upper motor neuron (UMN) syndrome. The impact of spasticity on patients ranges from mild neurological signs to severe spasticity (such as clenched fists, twisted wrists and elbows, and the arm fixed in a flexed position), which can cause extreme discomfort, pain, spasms, and contractures. These symptoms may be exacerbated by fatigue, stress, infection, and lesions. In addition, patients with spasticity usually need to expend extra energy in their daily activities to overcome muscle tone and may thus experience increased fatigue every day.

[0005] Spasms usually require both pharmacological and non-pharmacological interventions. Non-pharmacological interventions, such as physical therapy, i.e., stretching and strengthening exercises of muscle groups, can be used as adjuvant therapy. On the other hand, Baclofen has been used as the main pharmacological intervention for treating spasms. Baclofen is a muscle relaxant that acts on the spinal nerves. Although clinical studies have shown that Baclofen is the most effective anti-spasmodic drug treatment, it is often accompanied by side effects, including drowsiness, dizziness, headache, fatigue, muscle weakness, and progressive drug resistance. Baclofen can be administered orally or intrathecally using a pump implanted subcutaneously. Since the dose of Baclofen required for intrathecal administration is much lower, the side effects are fewer, and it is commonly used to treat spastic patients. However, implanting the pump may lead to post-implantation complications, including pump failure, infection, and catheter displacement. Meanwhile, injections of botulinum toxin (Botox) and neurolytic agents (phenol) have also been used alone, in combination with each other, or in combination with Baclofen to relieve spasms. Injections of botulinum toxin and neurolytic agents usually require trained physicians and take a long time: Botulinum toxin may need to be injected into multiple muscles to show a therapeutic effect; while neurolytic agents need to be injected directly into the nerves, for example, which requires finding the nerve to block the contraction signal to the muscle - the patient is sedated and the nerve is located by a specialist using a mild electrical pulse. Whether used alone or in combination with other treatments, injections of botulinum toxin and neurolytic agents have a short-term therapeutic effect in relieving spasms and need to be repeated every 3 - 6 months. Neurolytic agent injections damage nerve conduction by destroying part of the nerve and often cause additional necrosis of adjacent sensory nerves, skin, muscles, blood vessels, and other soft tissues. In addition, although the origin of spasms affecting a single muscle group can be somatotopically mapped to specific spinal segments, currently available intrathecal delivery may not specifically target the designated spinal segments, thus unable to reduce side effects on other spinal segments not affected by spasms.

[0006] In severe cases, neurotomy can be performed to relieve spasms, such as dorsal rhizotomy. Selective dorsal rhizotomy is a spinal surgery that reduces spasms by selectively cutting sensory nerves. Sensory nerves are the main source of spinal cord excitation and form a closed-loop neuromuscular system with other components (spinal cord interneurons, motor neurons, and muscles), naturally generating and regulating movement. However, after spinal cord injury, the affected sensory nerves generate, amplify, and reverberate nerve activity, leading to persistent involuntary muscle contractions. Interrupting this closed-loop system with dorsal rhizotomy has been shown to help reduce spasms after spinal cord injury. However, this surgery is highly invasive and cannot regulate or preserve the sensory function of spinal cord injury patients. These surgeries can usually relieve upper limb spasms but are accompanied by more severe long-term adverse reactions, such as sensory disturbances and decreased motor function in the affected area.

[0007] Accordingly, there is a need for a non-surgical, minimally invasive, region-specific treatment method for treating spasticity. SUMMARY OF THE INVENTION

[0008] The present application provides a method for treating spasticity in a subject, including upregulating the GAD (glutamic acid decarboxylase) gene, thereby treating spasticity in the subject. The upregulation of the GAD gene can be region-specific upregulation of the GAD gene. In some embodiments, the upregulation of the GAD gene includes administering to the subject a viral vector comprising a polynucleotide encoding GAD, wherein GAD is expressed, converting excitatory neurotransmitters into inhibitory neurotransmitters, thereby alleviating spasticity. In one aspect, the GAD gene is overexpressed. The polynucleotide encoding GAD may include the GAD67 gene (GenBank: M81883.1; SEQ ID NO: 1), which encodes GAD67 (SEQ ID NO: 2) and the GAD65 gene (GenBank: M81882.1; SEQ ID NO: 3), which encodes GAD65 (SEQ ID NO: 4). In a preferred embodiment, GAD is GAD67.

[0009] In some embodiments, the viral vector used in the method of the present application is an adeno-associated virus (AAV) vector or a herpes simplex virus (HSV) vector, preferably an HSV-1 vector or an HSV-2 vector, more preferably a defective virus vector derived from HSV-1, such as a recombinant HSV-1 vector, an amplicon HSV-1 vector, or an HSV-1 vector comprising a pre-HSV-1 vector and an inserted GAD expression cassette. In a preferred embodiment, the viral vector used in the method of the present application is a defective virus vector derived from HSV-1, wherein the polynucleotide encoding GAD is inserted into the LAT (latency-associated transcript) locus of the defective virus vector derived from HSV-1.

[0010] In some embodiments, the viral vector comprises a promoter for driving long-term expression of the GAD gene. In some embodiments, the promoters useful in the present invention can be selectively active in afferent neurons. Such promoters can be selected from the promoters of genes encoding sensory nerve receptors, the promoters of genes encoding sensory nerve modulators or sensory neurotransmitters, and the promoters of genes involved in neurite growth and stress response in sensory neurons. In some embodiments, the promoter of the gene encoding a sensory nerve receptor according to the present invention is selected from the promoters of the TRP gene family, more preferably the promoters of TRPV1 or TRPM8. In some embodiments, the promoter of the gene encoding a sensory nerve modulator or sensory neurotransmitter according to the present invention is selected from the promoters of substance P, PACAP, and calcitonin gene-related peptide (CGRP). In some embodiments, the promoter of the gene involved in neurite growth and stress response in sensory neurons is the promoter of the gene encoding advillin (ADVL).

[0011] In some embodiments, the promoters useful in the present invention are ubiquitin promoters, selected from the human cytomegalovirus (HCMV) promoter, the human elongation factor 1α (hEF-1α) promoter, the β promoter, the β-actin promoter, the Rous sarcoma virus (RSV) promoter, the human ubiquitin C (hUBC) promoter, the ubiquitin B promoter, the simian vacuolating virus 40 (SV40) promoter, the phosphoglycerate kinase (PGK) promoter, the β-globin promoter, the NF-κB promoter, the EGRI promoter, the eIF4A1 promoter, the FerL promoter, the GAPDH promoter, the β-Kin promoter, the ROSA26 promoter, and the human surfactant protein C (hSP-C) promoter. Preferably, the promoter used in the present invention is hEF-1α (SEQ ID NO: 5).

[0012] In some embodiments, the viral vector is directly administered to the spinal cord parenchyma of the subject, the intrathecal space of the subject, the subdural space of the subject, or the peripheral spastic muscles of the subject, or to one or more dermatomes of the subject. In a preferred embodiment, the viral vector is directly administered to one or more dermatomes of the subject by one or more injections.

[0013] This application also provides a method for treating spasticity in a subject, comprising administering to the subject a therapeutically effective amount of a viral vector comprising a polynucleotide encoding GAD, thereby treating the spasticity of the subject. In some embodiments, the polynucleotide encoding GAD can comprise the GAD67 gene (SEQ ID NO: 1), which encodes GAD67 (SEQ ID NO: 2) and the GAD65 gene (SEQ ID NO: 3), which encodes GAD65. Preferably, GAD is GAD67.

[0014] In some embodiments, the viral vector is an adeno-associated virus (AAV) vector or a herpes simplex virus (HSV) vector, preferably an HSV-1 vector or an HSV-2 vector, more preferably a defective viral vector derived from HSV-1, such as a recombinant HSV-1 vector, an amplicon HSV-1 vector, or an HSV-1 vector comprising a pre-HSV-1 vector and an inserted GAD expression cassette. In a preferred embodiment, the viral vector used in the methods of the present application is a defective viral vector derived from HSV-1, wherein the polynucleotide encoding GAD is inserted into the LAT (latency-associated transcript) locus of the defective viral vector derived from HSV-1.

[0015] In some embodiments, the viral vector is directly administered to the spinal parenchyma of the subject, the intrathecal space of the subject, the subdural space of the subject, or the peripheral spastic muscles of the subject, or to one or more dermatomes of the subject. In a preferred embodiment, the viral vector is directly administered to one or more dermatomes of the subject.

[0016] In some embodiments, the viral vector comprises a promoter for driving long-term expression of the polynucleotide. In some embodiments, the promoters useful in the present invention can be selectively active in afferent neurons. Such promoters can be selected from the promoters of genes encoding sensory nerve receptors, the promoters of genes encoding sensory nerve modulators or sensory neurotransmitters, and the promoters of genes involved in neurite growth and stress response in sensory neurons. In some embodiments, the promoter of the gene encoding a sensory nerve receptor according to the present invention is selected from the promoters of the TRP gene family, more preferably the promoters of TRPV1 or TRPM8. In some embodiments, the promoter of the gene encoding a sensory nerve modulator or sensory neurotransmitter according to the present invention is selected from the promoters of substance P, PACAP, and calcitonin gene-related peptide (CGRP). In some embodiments, the promoter of the gene involved in neurite growth and stress response in sensory neurons is the promoter of the gene encoding advillin (ADVL).

[0017] In some embodiments, the promoters useful in the present invention are ubiquitin promoters, selected from the human cytomegalovirus (HCMV) promoter, the human elongation factor 1α (hEF-1α) promoter, the β promoter, the β-actin promoter, the Rous sarcoma virus (RSV) promoter, the human ubiquitin C (hUBC) promoter, the ubiquitin B promoter, the simian vacuolating virus 40 (SV40) promoter, the phosphoglycerate kinase (PGK) promoter, the β-globin promoter, the NF-κB promoter, the EGRI promoter, the eIF4A1 promoter, the FerL promoter, the GAPDH promoter, the β-Kin promoter, the ROSA26 promoter, and the human surfactant protein C (hSP-C) promoter. Preferably, the promoter used in the present invention is hEF-1α (SEQ ID NO: 5).

[0018] The present application also provides a treatment regimen for treating a subject suffering from spasticity or a spasticity-related disorder, comprising administering a viral vector comprising a polynucleotide encoding GAD, wherein GAD is expressed, thereby treating spasticity or a spasticity-related disorder. The polynucleotide encoding GAD may comprise the GAD67 gene (SEQ ID NO: 1), which encodes GAD67 (SEQ ID NO: 2), and the GAD65 gene (SEQ ID NO: 3), which encodes GAD65. Preferably, GAD is GAD67. The viral vector is an adeno-associated virus (AAV) vector or a herpes simplex virus (HSV) vector, preferably an HSV-1 vector or an HSV-2 vector, more preferably a defective viral vector derived from HSV, such as a recombinant HSV vector, an amplicon HSV vector, or an HSV-1 vector comprising a pre-HSV-1 vector and an inserted GAD expression cassette. In a preferred embodiment, the viral vector used in the method of the present application is a defective viral vector derived from HSV-1, wherein the polynucleotide encoding GAD is inserted into the LAT (latency-associated transcript) locus of the defective viral vector derived from HSV-1.

[0019] In some embodiments, the viral vector can be directly administered to the spinal parenchyma of the subject, the intrathecal space of the subject, the subarachnoid space of the subject, or the peripheral spastic muscles of the subject, or to one or more dermatomes of the subject. Preferably, the viral vector can be directly administered to one or more dermatomes of the subject.

[0020] Viral vectors may contain a promoter. In some embodiments, the promoter useful in the treatment regimen may be selectively active in afferent neurons. Such promoters may be selected from the promoters of genes encoding sensory nerve receptors, the promoters of genes encoding sensory nerve modulators or sensory neurotransmitters, and the promoters of genes involved in neurite growth and stress response in sensory neurons. In some embodiments, the promoter of the gene encoding a sensory nerve receptor according to the present invention is selected from the promoters of the TRP gene family, more preferably the promoters of TRPV1 or TRPM8. In some embodiments, the promoter of the gene encoding a sensory nerve modulator or sensory neurotransmitter according to the present invention is selected from the promoters of substance P, PACAP, and calcitonin gene-related peptide (CGRP). In some embodiments, the promoter of the gene involved in neurite growth and stress response in sensory neurons is the promoter of the gene encoding advillin (ADVL). In some embodiments, the promoter useful in the treatment regimen is a ubiquitin promoter, selected from the human cytomegalovirus (HCMV) promoter, the human elongation factor 1α (hEF-1α) promoter, the β promoter, the β-actin promoter, the Rous sarcoma virus (RSV) promoter, the human ubiquitin C (hUBC) promoter, the ubiquitin B promoter, the simian vacuolating virus 40 (SV40) promoter, the phosphoglycerate kinase (PGK) promoter, the β-globin promoter, the NF-κB promoter, the EGRI promoter, the eIF4A1 promoter, the FerL promoter, the GAPDH promoter, the β-Kin promoter, the ROSA26 promoter, and the human surfactant protein C (hSP-C) promoter. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1A to Figure 1E Show a statistically significant reduction in tonic muscle hyperactivity when mice are treated with the hEF-1α::GAD67 vector. Figure 1A and Figure 1B Are representative images of the tails of sham control animals ( Figure 1A ) and treated animals ( Figure 1B ) at 3 weeks after injection of the vector in the chronic state of spinal cord injury. Figure 1C Show the severity index characterizing the quantification of abnormal posture caused by tonic stretch hyperreflexia. Figure 1D Show the severity index of each group (n = 10 animals per group). Each point represents an animal, and the bar graph represents the mean ± standard deviation. Statistical analysis by unpaired t-test showed a significant difference between the treated mice and the sham control group (p < 0.05), with a significant reduction in the severity index after hEF1α-hGAD67 treatment. Figure 1EShown that when the total index was decomposed into its three components, only the first curvature θ1 of the tail showed a statistically significant difference between groups. These results suggest that the hEF-1α::GAD67 vector has a local effect on the first muscle segment near the base of the tail.

[0022] Figures 2A to 2C Show the average electromyogram (EMG) changes when the tail (tip or base) is tactilely stimulated compared to the pre-stimulus baseline. Figure 2A Show the EMG recording of the muscle at the base of the tail, which is alleged to be at the same segmental level as the injected dermatome (S1 - S2). Figure 2B and Figure 2C Show the effects of two other tail muscles: one in the middle of the tail and one at the tip of the tail (more caudal).

[0023] Figure 3A to Figure 3C Depict the EMG evaluation of tail spasm when the vector is used in combination with a GABA reuptake inhibitor such as tiagabine. Figure 3A Show the changes in EMG activity of the muscle at the base of the tail when the base and tip are tactilely stimulated. Figure 3B and Figure 3C Show the effects of two other tail muscles: one in the middle of the tail and one at the tip of the tail (more caudal).. Detailed Description

[0024] As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, a reference to "the method" includes one or more methods, and steps of such type as will be apparent to those skilled in the art upon reading this disclosure.

[0025] The term "comprising" is used interchangeably with "including", "containing", or "characterized by" and is inclusive or open-ended language that does not exclude additional, unrecited elements or method steps.

[0026] The phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. The phrase "consisting essentially of" limits the scope of the claim to the specified materials or steps and those that do not materially affect the basic and novel characteristics of the claimed invention. This disclosure encompasses embodiments of the present invention corresponding to the scope of each of these phrases. Thus, a composition or method containing the recited elements or steps encompasses specific embodiments in which the composition or method consists essentially of or consists of those elements or steps.

[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used to practice or test the present invention, the preferred methods and materials are now described.

[0028] As used herein, the term "subject" refers to any individual or patient on whom the described method is performed. Generally, the subject is a human, although as will be understood by those skilled in the art, the subject can be an animal. Thus, other animals including mammals such as rodents (including mice, rats, hamsters, and guinea pigs), cats, dogs, rabbits, farm animals (including cows, horses, goats, sheep, pigs, etc.), and primates (including monkeys, chimpanzees, orangutans, and gorillas) are included within the definition of a subject.

[0029] As used herein, "drug tolerance" refers to a reduced response of a subject to a drug, typically occurring after repeated use of the drug. Increasing the drug dose may re-amplify the effect of the drug; however, this may accelerate tolerance and further reduce the effect of the drug. In some embodiments, the terms "tolerance", "drug resistance", and "insensitivity" may be used interchangeably to describe a decrease in drug potency.

[0030] As used herein, "therapeutic effect" includes therapeutic and / or prophylactic benefits as described herein.

[0031] As used herein, the terms "reduce" and "inhibit" are used together because it should be recognized that in some cases, reduction may be below the level of detection of a particular assay. Thus, it may not always be clear whether the expression level or activity is "reduced" below the level of detection of the assay or is completely "inhibited". However, this will be clearly determinable after treatment according to the present method.

[0032] As used herein, "treatment" or "treating" refers to administering a composition to a subject or system having an adverse condition. The condition may include a disease or disorder. "Prevention" or "preventing" refers to administering a composition to a subject or system at risk of a condition. The condition may include susceptibility to a disease or disorder. The effect of administering a composition to a subject (whether for treatment and / or prophylaxis) can be, but is not limited to, the cessation of one or more symptoms of the condition, the reduction or prevention of one or more symptoms of the condition, the reduction in the severity of the condition, the complete elimination of the condition, the stabilization or delay of the development or progression of a particular event or characteristic, or the minimization of the likelihood of the occurrence of a particular event or characteristic.

[0033] The three terms "polypeptide", "peptide", and "protein" are used interchangeably herein and refer to polymers of amino acid residues. These terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical mimics of the corresponding naturally occurring amino acids, as well as to both naturally occurring and non-naturally occurring amino acid polymers.

[0034] The term "active fragment" refers to an amino acid fragment that is less than the entire amino acid sequence of the molecule and retains substantially the same biological activity or corresponding biological activity, e.g., an activity greater than 50%, such as 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.

[0035] The term "amino acid" refers to both naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function similarly to naturally occurring amino acids. Naturally occurring amino acids refer to those encoded by the genetic code, as well as amino acids that have been subsequently modified, such as hydroxyproline, α-carboxyglutamic acid, and O-phosphoserine. Amino acid analogs refer to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., a carbon atom linked to a hydrogen, a carboxyl group, an amino group, and an R group, such as homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have a modified R group (e.g., norleucine) or a modified peptide backbone, but retain the same basic chemical structure as the naturally occurring amino acid. Amino acid mimetics refer to chemical compounds that have a chemical structure different from that of an amino acid in general, but function similarly to a naturally occurring amino acid.

[0036] Amino acids herein can be represented by their common three-letter symbols or the single-letter symbols recommended by the IUPAC-IUB Commission on Biochemical Nomenclature. Similarly, nucleotides can be represented by their recognized single-letter codes.

[0037] As used herein, a "regulatory gene" or "regulatory sequence" refers to a nucleic acid sequence that encodes a product (such as a transcription factor) that controls the expression of other genes.

[0038] As used herein, a "protein-coding sequence" or a sequence encoding a specific protein or polypeptide refers to a nucleic acid sequence that, under the control of appropriate regulatory sequences, is transcribed into mRNA (in the case of DNA) and translated into a polypeptide in vitro or in vivo. The boundaries of the coding sequence are determined by the start codon at the 5' end (N-terminus) and the translational termination nonsense codon at the 3' end (C-terminus). The coding sequence can include, but is not limited to, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic DNA, and synthetic nucleic acids. The transcription termination sequence is typically located at the 3' end of the coding sequence.

[0039] The term "transgene" refers to a specific nucleic acid sequence encoding an RNA and / or a polypeptide or a part of a polypeptide to be expressed in the cell into which it is introduced. The term "transgene" includes: (1) a nucleic acid sequence that is not naturally present in the cell (i.e., a heterologous nucleic acid sequence); (2) a mutant form of a nucleic acid sequence that is naturally present in the cell into which it is introduced; (3) a nucleic acid sequence for adding an additional copy of the same (i.e., homologous) or a similar nucleic acid sequence that is naturally present in the cell; or (4) a naturally occurring or homologous silenced nucleic acid sequence whose expression is induced in the cell into which it is introduced. "Mutant form" means a nucleic acid sequence containing one or more nucleotides different from the wild-type or naturally occurring sequence, i.e., the mutant nucleic acid sequence contains one or more nucleotide substitutions, deletions, and / or insertions. In some cases, a transgene may also include a sequence encoding a leader peptide or a signal sequence such that the transgene product will be secreted from the cell, or the transgene may include a leader peptide or a signal sequence and a membrane-anchoring peptide, or even a fusion protein between two naturally occurring proteins or parts thereof such that the transgene will remain anchored to the cell membrane, or a sequence allowing the protein to accumulate in a specific region of the cell, such as a nuclear localization signal.

[0040] As used herein, the term "expression cassette" or "transcription cassette" refers to different components of vector DNA, which consists of a gene to be expressed in the transfected cell and regulatory sequences. In each successful transfection, the expression cassette directs the cell's machinery to make RNA and protein(s). Some expression cassettes are designed for modular cloning of protein-coding sequences such that the same cassette can be easily altered to make different proteins. An expression cassette can consist of one or more genes and the sequences controlling their expression. An expression cassette contains at least three components: a promoter sequence, an open reading frame, and a 3' untranslated region, which in eukaryotes typically contains a polyadenylation site.

[0041] As used herein, a "promoter" is defined as a regulatory DNA sequence that is typically located upstream of a gene and mediates the initiation of transcription by directing RNA polymerase to bind to the DNA and initiate RNA synthesis. A promoter can be a constitutively active promoter (i.e., a promoter that is in a continuous active / "on" state), an inducible promoter (i.e., a promoter whose state (active / "on" or inactive / "off") is controlled by an external stimulus, such as the presence of a specific compound or protein), a spatially restricted promoter (i.e., a transcriptional control element, enhancer, etc.; e.g., a tissue-specific promoter, a cell-type specific promoter, etc.), and a temporally restricted promoter (i.e., a promoter that is in an "on" state or an "off" state at a specific stage of embryonic development or a specific stage of a biological process). For the purposes of the present invention, the promoter sequence contains at least the minimum number of bases or elements required to initiate transcription of the gene of interest at a level detectably above background. Within the promoter sequence are the transcription start site and the RNA polymerase binding domain. Eukaryotic promoters typically (but not always) contain a "TATA" box and other DNA motifs, such as a "CAT" or "SP1" box.

[0042] As used herein, the term "gene" refers to a deoxyribonucleotide sequence that contains the coding region of a structural gene. A "gene" can also include the untranslated sequences flanking the coding region on both the 5' and 3' ends such that the gene corresponds to the length of the full-length mRNA. The sequence located at the 5' end of the coding region and present on the mRNA is called the 5' untranslated sequence. The sequence located at the 3' end or downstream of the coding region and present on the mRNA is called the 3' untranslated sequence. The term "gene" encompasses both the cDNA and genomic forms of a gene. The genomic form or clone of a gene contains the coding region interrupted by non-coding sequences called "introns" or "intervening regions" or "intervening sequences". Introns are gene segments that are transcribed into heterogeneous nuclear RNA (hnRNA); introns can contain regulatory elements, such as enhancers. Introns are removed or "spliced out" from the nuclear transcript or primary transcript; thus, introns are not present in messenger RNA (mRNA) transcripts. mRNA is used during translation to specify the amino acid sequence or order in a nascent polypeptide.

[0043] As used herein, the terms "functionally linked" and "operably linked" are used interchangeably and refer to the functional relationship between two or more DNA fragments, particularly the relationship between a gene sequence to be expressed and the sequence controlling its expression. For example, if a promoter / enhancer sequence (including any combination of cis-acting transcriptional control elements) stimulates or regulates the transcription of a coding sequence in a suitable host cell or other expression system, it is operably linked to that coding sequence. A promoter regulatory sequence operably linked to a transcribed gene sequence is physically adjacent to the transcribed sequence.

[0044] "Conservative Modification Variants" apply to amino acid and nucleic acid sequences. For a particular nucleic acid sequence, conservative modification variants are those nucleic acids that encode the same or substantially the same amino acid sequence, or, where the nucleic acid does not encode an amino acid sequence, those sequences that are substantially the same. Due to the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For example, the codons GCA, GCC, GCG, and GCU all encode the amino acid alanine. Thus, at every position where alanine is specified by a codon, the codon can be changed to any of the corresponding codons described above without changing the encoded polypeptide. Such nucleic acid variations are "silent variations" and are one type of conservative modification variant. Every nucleic acid sequence encoding a polypeptide described herein also describes every possible silent variation of that nucleic acid. Those skilled in the art will recognize that each codon in a nucleic acid (except the unique codon AUG for methionine and the unique codon TGG for tryptophan, which are generally) can be modified to produce a molecule with the same function. Thus, every silent variation of each nucleic acid encoding a polypeptide is implicit in each such sequence.

[0045] With respect to amino acid sequences, those skilled in the art will recognize that a single substitution, deletion, or addition to a nucleic acid, peptide, polypeptide, or protein sequence, which changes, adds, or deletes a single amino acid or a small percentage of amino acids in the encoded sequence and where the change results in the substitution of an amino acid with a chemically similar amino acid, is a "conservative modification variant". Tables of conservative substitutions providing functionally similar amino acids are well known in the art. Such conservative modification variants are variants in addition to the polymorphic variants, interspecies homologs, and alleles of the present invention and are not excluded therefrom.

[0046] The following eight groups each contain amino acids that are conservative substitutions for one another:

[0047] 1) Alanine (A), Glycine (G);

[0048] 2) Aspartic acid (D), Glutamic acid (E);

[0049] 3) Asparagine (N), Glutamine (Q);

[0050] 4) Arginine (R), Lysine (K);

[0051] 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V);

[0052] 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W);

[0053] 7) Serine (S), Threonine (T); and

[0054] 8) Cysteine (C), methionine (M) (see, e.g., Creighton, Proteins (1984)).

[0055] Conservative substitutions (also known as conservative replacements or conservative mutations) can include, for example, replacement of a basic amino acid with a basic amino acid, replacement of an acidic amino acid with an acidic amino acid, replacement of a polar amino acid with a polar amino acid, etc. The amino acid groups thus derived may be conservative for structural reasons. These groups can be described in the form of a Venn diagram (Livingstone C.D. and Barton G.J., “Protein sequence alignments: a strategy for the hierarchical analysis of residue conservation”, Comput. Appl. Biosci. (Computers and Biomedical Research), 1993, 9, 745-756; Taylor W.R., “The classification of amino acid conservation”, J. Theor. Biol. (Journal of Theoretical Biology), 1986, 119, 205-218), which is incorporated herein by reference.

[0056] The “percent sequence identity” is determined by comparing two optimally aligned sequences in a comparison window, wherein the polynucleotide sequence portion in the comparison window may include additions or deletions (i.e., gaps) as compared to the reference sequence (e.g., the polypeptide of the present invention) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percent sequence identity.

[0057] In the context of two or more nucleic acid or polypeptide sequences, the terms "identical" or "percent identity" refer to two or more sequences or subsequences that are the same. Two sequences are "substantially identical" if, when compared and optimally aligned over a comparison window or specified region, the two sequences have a specified percentage of identical amino acid residues or nucleotides (i.e., 60% identity over the specified region, optionally 65%, 70%, 75%, 80%, 85%, 90% or 95% identity, or when not specified over the entire sequence), as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. The present invention provides polypeptides that are substantially identical to the polypeptides exemplified herein, and their uses, including but not limited to for the treatment or prevention of nervous system diseases or disorders, such as neurodegenerative diseases or disorders, and / or for the treatment of spinal cord injury. Optionally, the identity exists over a region of at least about 50 nucleotides, or more preferably over a region of 100 to 500 or 1000 or more nucleotides, or over the entire length of the reference sequence.

[0058] For sequence comparison, typically one sequence is designated as the reference sequence, and the test sequence is compared to it. When using a sequence comparison algorithm, the test sequence and the reference sequence are entered into a computer, subsequence coordinates are specified if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be specified. Then, the sequence comparison algorithm calculates the percent sequence identity of the test sequence relative to the reference sequence based on the program parameters.

[0059] As used herein, a "comparison window" refers to a segment selected from the group of 20 to 600 contiguous positions, usually about 50 to about 200, more usually about 100 to about 150 contiguous positions, in which sequences in the segment can be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of sequence alignment for comparison are well known in the art. Optimal alignment of sequences for comparison can be conducted, for example, by the local homology algorithm of Smith and Waterman (Adv. Appl. Math., 1970, 2:482), the homology alignment algorithm of Needleman and Wunsch (J. Mol. Biol., 1970, 48:443), the similarity search method of Pearson and Lipman (Proc. Nat'l. Acad. Sci. USA, 1988, 85:2444), computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection (see, e.g., Ausubel et al., Current Protocols in Molecular Biology, 1995, Supplement).

[0060] Two algorithms suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., Nuc. Acids Res., 1977, 25, 3389-3402 and Altschul et al., J. Mol. Biol., 1990, 215, 403-410, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. The algorithm first identifies high-scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with words of the same length in a database sequence. T is referred to as the neighborhood word score threshold. These initial neighborhood word hits serve as seeds for initiating a search to find longer HSPs that contain them. Word hits are extended in both directions along each sequence as long as the cumulative alignment score can increase. For nucleotide sequences, the cumulative score is calculated using parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for a mismatch residue; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. The extension of word hits in each direction stops when the cumulative alignment score drops by an amount X from its maximum achieved value, when the cumulative score becomes zero or lower due to the accumulation of one or more negative-scoring residue alignments, or when the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses a default word length (W) of 11, an expectation value (E) of 10, M = 5, N = -4, and comparison of both strands. For amino acid sequences, the BLASTP program uses a default word length of 3, an expectation value (E) of 10, the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915), an alignment (B) of 50, an expectation value (E) of 10, M = 5, N = -4, and comparison of both strands.

[0061] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 1993, 90, 5873-5787). One measure of similarity provided by the BLAST algorithm is the minimum sum probability (P(N)), which represents the probability that a match between two nucleotide or amino acid sequences would occur by chance. For example, if the minimum sum probability when a test nucleic acid is compared to a reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001, then the nucleic acid is considered similar to the reference sequence.

[0062] "Nucleic acid" refers to polymers of deoxyribonucleotides or ribonucleotides and their single-stranded or double-stranded forms, as well as their complements. The term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which analogs or modifications are synthetic, naturally occurring, and non-naturally occurring, and which have binding properties similar to reference nucleic acids and are metabolized in a manner similar to reference nucleotides. Examples of such analogs include, but are not limited to, phosphorothioates, phosphoramidates, methylphosphonates, chiral methylphosphonates, 2'-O-methyl ribonucleotides, and peptide nucleic acids (PNAs). In various embodiments, the nucleic acid is isolated when purified from other cellular components or other contaminants (such as other nucleic acids or proteins present in the cell) by standard techniques including alkaline / SDS treatment, CsCl banding, column chromatography, agarose gel electrophoresis, etc. See, e.g., Current Protocols in Molecular Biology, F. Ausubel et al. (eds.), 1987, Greene Publishing and Wiley Interscience, New York. In various embodiments, the nucleic acid is, for example, DNA or RNA and may or may not contain intron sequences. In a preferred embodiment, the nucleic acid is a cDNA molecule.

[0063] As used herein, "pharmaceutically acceptable carrier" encompasses any standard pharmaceutical carrier, such as phosphate buffered saline solutions, water, and emulsions (such as oil / water or water / oil emulsions), and various types of wetting agents.

[0064] As used herein, the term "neuron" includes neurons and one or more portions thereof (e.g., neuron cell bodies, axons, or dendrites). "Neuron" as used herein refers to cells of the nervous system, which include a central cell body or soma, and two types of extensions or processes: dendrites (which generally carry most neuronal signals to the cell body) and axons (which generally carry most neuronal signals from the cell body to effector cells, such as target neurons or muscles). Neurons can transmit information from tissues and organs to the central nervous system (afferent or sensory neurons) and transmit signals from the central nervous system to the muscles and glands of the body (efferent or motor neurons). Other neurons, known as interneurons, connect neurons within the central nervous system (brain and spinal cord). Examples of specific types of neurons that may be subject to treatment or methods according to the invention include cerebellar granule neurons, dorsal root ganglion neurons, and cortical neurons.

[0065] The term "neuronal degeneration" is used broadly to refer to any pathological changes in neuronal cells, including but not limited to death or loss of neuronal cells, any changes prior to cell death, and any decrease or loss in neuronal cell activity or function. These pathological changes can be spontaneous or induced by any event, including, for example, pathological changes associated with apoptosis. The neurons can be any neurons, including but not limited to sensory neurons, sympathetic neurons, parasympathetic neurons, or enteric neurons, such as dorsal root ganglion neurons, motor neurons, and central neurons (e.g., interneurons in the spinal cord). Neuronal degeneration or cell loss is characteristic of a variety of neurological diseases or disorders, such as neurodegenerative diseases or disorders. In some embodiments, the neurons are sensory neurons; in some embodiments, the neurons are motor neurons; in some embodiments, the neurons are damaged spinal cord neurons.

[0066] As used herein, the term "dorsal root ganglion", also known as "DRG", "spinal ganglion", or "posterior root ganglion", refers to a cluster of neurons (ganglion) in the dorsal root of the spinal nerve. The dorsal root is the afferent sensory root that carries sensory information to the brain. The cell bodies of sensory neurons (referred to as first-order neurons) are located in the dorsal root ganglion. The axons of dorsal root ganglion neurons are called afferent fibers. In the peripheral nervous system, afferent fibers are axons that transmit sensory information to the central nervous system (i.e., the brain and spinal cord).

[0067] As used herein, the term "afferent neuron" carries information from sensory receptors in the skin and other organs to the central nervous system (i.e., the brain and spinal cord), while an "efferent neuron" transmits motor information from the central nervous system to the muscles and glands of the body. In this application, "afferent" means inward transmission to a central organ or location, i.e., a nerve that conducts impulses from the body periphery to the brain or spinal cord.

[0068] As used herein, the term "systemic" refers to involving or affecting the whole body rather than a part thereof. "Region-specific" as used herein means affecting only a specific region of the body (such as specific cell types, specific dermatomes, and specific spinal nerves) and having no or minimal effect on the rest of the body.

[0069] As used herein, the term "sensory neuron", also known as "afferent neuron", is a neuron in the nervous system that converts a specific type of stimulus into an action potential or graded potential through a receptor, a process called sensory transduction. The cell bodies of sensory neurons are located in the dorsal root ganglia of the spinal cord. In the present application, "sensory neuron", "sensory fiber", and "afferent neuron" may be used interchangeably. Sensory neurons can be classified in a variety of ways, such as according to their morphology, location, and the type of stimulus they are responsible for detecting. For example, according to the stimulus they are responsible for detecting, sensory neurons are classified as: olfactory sensory neurons for detecting odors, taste receptors for detecting taste, photoreceptors that convert light into electrical signals, thermoreceptors for detecting temperature changes, mechanoreceptors for detecting changes in pressure or mechanical stress, proprioceptors (also known as position sensors) for perceiving the relative position of body parts, and nociceptors for processing pain and temperature sensations. Additionally, according to their size and degree of myelination (and thus different conduction velocities), sensory neurons can also be classified into types A, B, and C, where type A can be further divided into subtypes α, β, γ, and δ.

[0070] Spasm

[0071] As used herein, "spasm" refers to a condition in which certain muscles exhibit hypersensitivity to the stretch reflex. A "spastic muscle" can be used to describe a muscle that is continuously contracting due to spasm. This contraction can cause muscle stiffness or tightness and may interfere with normal movement, speech, and gait. Additionally, the symptoms of spasm can range from mild muscle stiffness or tightness to painful and uncontrollable spasms. Joint pain or tightness is also common in spasm. Spasm mainly occurs in central nervous system diseases that affect upper motor neurons in the form of lesions, such as spastic paraplegia or upper motor neuron syndrome, and can also be present in various types of multiple sclerosis, where spasm is a symptom of the progressive deterioration of myelin attacks and is thus not related to the types of spastic diseases that are the root cause of neuromuscular cerebral palsy. Without being bound by theory, spasm is triggered when damage to the spinal cord and / or central nervous system leads to an imbalance between excitatory and inhibitory inputs to motor neurons. This damage causes a change in the signal balance between the nervous system and the muscles, which in turn leads to an increase in motor neuron excitability and muscle hyperactivity. Drug interventions such as baclofen attempt to reduce muscle excitability and thus relieve spasm. Spasm can be seen in cases where the brain and / or spinal cord are damaged or fail to develop normally, including cerebral palsy, multiple sclerosis, spinal cord injury, and acquired brain injuries including stroke and traumatic brain injury.

[0072] In cases of spasticity caused by spinal cord injury (SCI), the maladaptive state of the spinal cord below the injury leads to enhanced spinal reflexes, increased muscle tone, and the appearance of involuntary tonic muscle contractions or spasms. These clinical symptoms represent the clinical condition known as spasticity in humans. Regardless of the type and extent of the lesion, more than 70% of patients with spinal cord injury develop spasticity one year after the traumatic event, and this will become a lifelong permanent movement disorder.

[0073] γ-aminobutyric acid (GABA)

[0074] γ-aminobutyric acid (GABA) and glutamate are the major inhibitory and excitatory neurotransmitters in mammals. A "neurotransmitter" is a signaling molecule secreted by a neuron that acts on another cell through a synapse. Specifically, an "excitatory neurotransmitter" has an excitatory effect on a neuron, meaning that it increases the likelihood that the neuron will trigger a signal called an action potential in the receiving cell. Neurotransmitters can act in a predictable manner, but they are also affected by drugs, diseases, and interactions with other chemical messengers. The balance between GABA and glutamate controls multiple processes such as neurogenesis, movement, circadian rhythms, tissue development, and blood glucose regulation. The cause of spasticity is thought to be an imbalance in the excitatory and inhibitory inputs to α-motoneurons due to spinal cord and / or central nervous system injury. The loss of GABA-mediated inhibition may play a key role in the progressive enhancement of spinal reflexes and the appearance of spasticity.

[0075] GABA acts at inhibitory synapses in the brain by binding to specific transmembrane receptors in the plasma membranes of presynaptic and postsynaptic neuronal processes. This binding causes ion channels to open, allowing negatively charged chloride ions to flow into the cell or positively charged potassium ions to flow out of the cell. This action causes a negative change in the transmembrane potential, usually resulting in hyperpolarization. There are two known classes of GABA receptors: the GABAA receptor (which acts as part of a ligand-gated ion channel complex) and the GABAB metabotropic receptor (which is a G-protein-coupled receptor that opens or closes ion channels through an intermediary (G-protein)). It is believed that the mechanism by which baclofen treats spasticity is its action as an agonist of the GABAB receptor to regulate ion channels.

[0076] Glutamic acid decarboxylase (GAD)

[0077] GABA is synthesized from glutamate by the catalytic action of the 67 kDa and 65 kDa isoforms of glutamic acid decarboxylase (GAD67 and GAD65), with pyridoxal phosphate (PLP) as a cofactor. This process converts glutamate to GABA, that is, the major excitatory neurotransmitter to the major inhibitory neurotransmitter, thereby reducing the excitability of neurons.

[0078] Human GAD67 and GAD65 are encoded by the GAD1 gene (chromosome 2) and the GAD2 gene (chromosome 10), respectively, and have been isolated and cloned by Bu et al. (Proc. Natl. Acad. Sci. USA 89:2115-2119, 1992). Human GAD67 cDNA (GenBank: M81883.1; SEQ ID NO:1) encodes a polypeptide with a molecular weight of 67,000 and having 594 amino acid residues (Genbank accession number: NM_000817; SEQ ID NO:2). Human GAD65 cDNA (GenBank: M81882.1; SEQ ID NO:3) encodes a polypeptide with a molecular weight of 65,000 and having 585 amino acid residues (Genbank accession number: NM_000818). All of the above are incorporated herein by reference.

[0079] In the literature, GAD67 and GAD1 are often used interchangeably to describe the gene encoding GAD67, and GAD65 and GAD2 are often used interchangeably to describe the gene encoding GAD65. In some embodiments, GAD67 and GAD65 may refer, respectively, to two different enzymes, namely glutamate decarboxylase 67 and glutamate decarboxylase 65. In some embodiments, GAD67 and GAD65 may refer, respectively, to two different genes encoding different enzymes, namely the glutamate decarboxylase 67 gene and the glutamate decarboxylase 65 gene. In some embodiments, GAD1 and GAD2 may refer, respectively, to two different genes encoding different enzymes, namely glutamate decarboxylase 67 and glutamate decarboxylase 65. In some embodiments, GAD1 may be used interchangeably with GAD67, and GAD2 may be used interchangeably with GAD65.

[0080] In some embodiments, "glutamate decarboxylase" or "GAD" as used herein may include wild-type or modified GAD67, wild-type or modified GAD65, and active fragments thereof. For example, "a polynucleotide encoding GAD" may refer to a polynucleotide encoding wild-type or modified GAD67, wild-type or modified GAD65, or an active fragment thereof.

[0081] This application provides a method for treating spasm in a subject, comprising upregulating a GAD gene, thereby treating spasm in the subject. In some embodiments, GAD may include wild-type or modified GAD67, wild-type or modified GAD65, or an active fragment thereof. In some embodiments, GAD is wild-type or modified GAD67 or an active fragment thereof.

[0082] Herpes simplex virus (HSV)

[0083] Gene therapies that can upregulate GAD genes (including GAD1 / GAD67 and GAD2 / GAD65) can provide a way to treat spasticity, where a viral vector is used to deliver a therapeutic gene product, such as wild-type or modified GAD or an active fragment thereof.

[0084] As used herein, the term "viral vector" or "viral expression vector" refers to a nucleic acid vector that contains at least one viral genomic element and can be packaged into viral particles. In the context of the present invention, the term "viral vector" should be understood broadly to include nucleic acid vectors (such as DNA viral vectors) and the viral particles produced therefrom. In the present application, the viral expression vector is an adeno-associated virus (AAV) vector or a herpes simplex virus (HSV) vector, preferably an HSV-1 vector or an HSV-2 vector, more preferably a defective viral vector derived from HSV-1. As used herein, a "defective viral vector" refers to a viral vector that lacks one or more genes or portions of genes necessary for successful completion of the viral replication life cycle.

[0085] The term "AAV" refers to adeno-associated virus itself or its derivatives, including recombinant AAV vector particles. In addition, as used herein, "AAV" includes many different serotypes that have been isolated from human and non-human primate samples. Preferred AAV serotypes are human serotypes, more preferably human AAV of serotypes 2, 5, and 9, and most preferably human AAV of serotype 5, which exhibits the highest level of neurotropism.

[0086] "Herpes simplex virus (HSV)" is a complex non-integrating DNA virus that can infect a very wide range of human and animal cells. HSV includes two serotypes, namely herpes simplex virus type 1 (HSV-1) and herpes simplex virus type 2 (HSV-2). The genome size of HSV-1 is approximately 153 kilobase pairs and contains approximately 90 protein-coding genes and more than 12 microRNAs. The HSV-1 genome consists of two unique segments, UL and US, each flanked by inverted repeat sequences encoding key diploid genes.

[0087] "Defective viral vectors derived from HSV" include defective recombinant HSV vectors, amplicon HSV vectors, and "pre-HSV-1 vectors" as defined herein. As used herein, "defective recombinant HSV" refers to a vector that does not require a helper virus and whose genome is at least completely deleted of the genes encoding two essential proteins, namely ICP4 and ICP27. The ICP4 gene exists in two copies in the inverted repeat sequences (referred to as c and c') of the viral genome, and both copies are deleted. The gene encoding ICP27 is located in the unique long (UL) sequence of the viral genome.

[0088] Preferably, the helper virus-free vector according to the present invention embeds a therapeutic transcription cassette into the LAT (latency-associated transcript) locus, which is a repetitive locus contained within the inverted repeat sequences (referred to as b and b') of the viral genome (see Berthomme et al., “Evidence for bidirectional element located downstream from the herpes virus simplex type 1 latency-associated promoter that increases its activity during latency”, JOURNAL OF VIROLOGY, 2000, Vol. 74, pp. 3613-3622; and Berthomme et al., “Enhancer and long-term expression functions of herpes simplex virus type 1 latency-associated promoter are both located in the same region”, JOURNAL OF VIROLOGY, 2001, Vol. 75, pp. 4386-4393; the contents of which are incorporated herein by reference).

[0089] More preferably, the transcription cassette is placed between the latency-associated promoter (LAP) and the long-term expression (LTE) region (site 1), or between the LTE region and the DNA insulator (INS) sequence located downstream of LTE (site 2). The defective recombinant HSV-1 vector according to the present invention carries a transcription cassette expressing the above-mentioned GAD gene to restore GABA-mediated inhibition and the balance of excitatory and inhibitory inputs, for example, expressing wild-type or modified GAD67 and / or wild-type or modified GAD65 or active fragments thereof driven by a promoter. The b and b' sequences of the viral genome are also referred to as TRL (terminal repeat long sequence) and IRL (internal repeat long sequence), respectively, while the c' and c sequences are also referred to as IRS (internal repeat short sequence) and TRS (terminal repeat short sequence), respectively, where L and S refer to the unique long (L) sequence and unique short (S) sequence of the HSV-1 genome, respectively.

[0090] In addition, the helper virus-free vectors according to the present invention may comprise additional deletions of genes encoding non-essential proteins (such as ICP34.5, UL55, UL56 and UL41 proteins). These defective HSV vectors proliferate in cell lines that simultaneously express ICP4 and ICP27 proteins (Marconi et al., “HSV-1-derived helper-independent defective vectors, replicating vectors and amplicon vectors, for the treatment of brain diseases”, CURRENT OPINION IN DRUG DISCOVERY AND DEVELOPMENT, Vol. 13, 2010, pp. 169-183; the content of which is incorporated herein by reference).

[0091] WO2006 / 050211 discloses the use of defective HSV-1 vectors for the treatment of pain in gene therapy. However, the vectors of the present invention are different from the vectors described in WO2006 / 050211 in several important aspects, which are crucial for the utility and efficacy of the vectors of the present invention. Most importantly, the transgene transcription cassette of the present invention is introduced into the LAT locus because this region contains LTE and DNA insulator sequences (INS), which confer long-term expression ability to the promoter driving the expression of the transgene in the transcription cassette of the present invention, while the vectors described in WO2006 / 050211 are designed for short-term action and thus their transcription cassettes are not introduced into the LAT region.

[0092] “Amplicon or amplicon vector” refers to a helper virus-dependent vector whose genome lacks most or all of the HSV genes encoding viral proteins. The genome of the amplicon vector is a concatemer DNA composed of multiple tandem copies of a plasmid (called an amplicon plasmid), which carries a DNA replication origin and a packaging signal from the HSV-1 genome, as well as the transgene DNA of interest (i.e., the transcription cassette). The amplicon plasmid according to the present invention carries a transcription cassette expressing the above-mentioned GAD gene to restore GABA-mediated inhibition and the balance of excitatory and inhibitory inputs, such as expressing wild-type or modified GAD67 and / or wild-type or modified GAD65 or active fragments thereof driven by a promoter. In some embodiments, the promoter may be the DRG-specific promoter described in the present invention; in some embodiments, the promoter may be the ubiquitin promoter.

[0093] In a preferred embodiment, the vector according to the invention is a defective recombinant vector that is at least deficient in genes encoding the essential proteins ICP4 and ICP27, preferably a vector that is deficient in both ICP4 and ICP27. The vector may be deficient in other genes encoding non-essential proteins (such as ICP34.5, UL55, UL56, and / or UL41 proteins), and the transcription cassette is embedded in the LAT region of the vector genome.

[0094] In any of the embodiments described herein, the defective recombinant vector is deficient in one copy of the ICP0 gene. In a preferred embodiment, one copy of the IPC0 gene is removed from the LAT, ICP0, UL34.5 cluster in the IRL region of the HSV vector.

[0095] In some embodiments, the vector according to the invention is an amplicon vector carrying a transcription cassette driven by a promoter as described elsewhere herein. In a preferred embodiment, the transcription cassette according to the invention is introduced into the LAT locus. As used herein, "recombinant DNA" refers to a nucleic acid molecule, i.e., a polynucleotide derived from genomic, cDNA, viral, semi-synthetic, and / or synthetic sources, which is not associated with all or part of the polynucleotide that is naturally associated with it due to its origin or manipulation. The term "recombinant" as used with respect to a virus refers to a virus carrying a recombinant genome or that has been engineered to introduce mutations, deletions, or one or more heterologous polynucleotides (including genes). The term "recombinant" as used with respect to a protein or polypeptide refers to a polypeptide produced by the expression of a recombinant nucleic acid. The term "recombinant" as used with respect to a host cell refers to a host cell that carries recombinant DNA within it or a recombinant vector in which recombinant DNA is inserted into its genome. The term "infection" refers to the ability of a viral vector to enter a host cell, organ, or subject, or the ability of the gene product of a viral vector to enter a host cell.

[0096] Defective vectors derived from HSV are capable of infecting neighboring sensory neurons and establishing latent infections in the nuclei of these neurons (depending on the site of infection, such as the trigeminal ganglion or dorsal root ganglion (DRG)). In particular, HSV-1 naturally infects sensory neurons and establishes a lifelong latent infection in the nuclei of these neurons. For example, subcutaneous inoculation of an HSV vector encoding GAD67 into the foot can infect DRG neurons, resulting in continuous production of GAD and release of GABA to treat pain associated with spinal cord injury (see Liu et al., MOLECULAR THERAPY, 2004, Vol. 10, No. 1, pp. 57-66). After injection into a dermatome, defective vectors derived from HSV-1 as disclosed herein will reach the sensory DRG that innervates the dermatome, where they will stably express a therapeutic transgene provided that there is an appropriate promoter driving its long-term expression. In some embodiments, the promoter may comprise an afferent neuron-specific promoter and a ubiquitin promoter; in some embodiments, the promoter is a ubiquitin promoter, preferably EF-1α; in some embodiments, the promoter is an afferent neuron-specific promoter as disclosed in WO2017220800A1.

[0097] Pre-HSV-1 vector

[0098] In some embodiments, the viral vector used in the methods of the present application may comprise a pre-HSV-1 vector.

[0099] As used herein, a "pre-HSV-1 vector" is a small HSV-1 backbone (also referred to as "mini-HSV-1" or "pre-HSV-1 vector") in which non-essential genes, essential genes, or a combination thereof have been deleted to obtain a genome comprising less than 130 kbp and greater than 75 kbp. The pre-vector or small vector "backbone" embodying the present invention should be understood such that, as a "backbone", a polynucleotide encoding GAD (with or without foreign control elements) can be inserted therein. In some embodiments, GAD can be wild-type or modified GAD67, wild-type or modified GAD65, or an active fragment thereof.

[0100] As used herein, the term "essential gene" or the qualifier "essential" in the expression "non-essential gene" means that the gene is essential (or non-essential) for the replication and packaging of the viral genome to produce infectious progeny virus particles. HSV-1 essential genes include UL1, UL5-UL9, UL12, UL14, UL15, UL17-UL19, UL22, UL25-UL38, UL42, UL48, UL49, UL52-UL54, US6, ICP4 (2 copies). HSV-1 non-essential genes include ICP34.5 (2 copies), ICP0 (2 copies), LAT (2 copies), UL2-UL4, UL10, UL11, UL13, UL16, UL20, UL21, UL23, UL24, UL39, UL40, UL41, UL43-UL47, UL50, UL51, UL55, UL56, US1-US5, US7-US12.

[0101] In some embodiments, gene clusters that can be deleted include, but are not limited to: UL2, UL3, UL4 genes (10.200-12.600); UL10, UL11 genes (23.200–25.200); UL16 gene (30.200–31.400); UL20, UL21 genes (40.800–43.700); UL23, UL24 genes (46.700–48.600); UL39, UL40, UL41 genes (86.400-92.700); UL43 to UL47 genes (94.700–103.200); UL50, UL51 genes (107.700–109.100); UL55, UL56 genes (115.400–117.100); one copy of LAT, ICP0, UL34.5 (IRL) genes (118.700-126.100); US2 to US5 genes (134.000–138.200); US7 to US12 genes (139.700–145.600); and / or the second copy of the ICP0 gene when the first copy in the LAT, ICP0, UL34.5 cluster has been deleted.

[0102] In some embodiments, the mini-HSV-1 comprises a genome from which at least 30 kbp has been deleted. In some embodiments, the mini-HSV-1 comprises a genome from which at least 40 kbp has been deleted. In some embodiments, the mini-HSV-1 comprises a genome from which at least 45 kbp has been deleted. In some embodiments, the mini-HSV-1 comprises a genome from which at least 50 kbp has been deleted. In some embodiments, the mini-HSV-1 comprises a genome from which at least 55 kbp has been deleted. In some embodiments, the mini-HSV-1 comprises a genome from which at least 60 kbp has been deleted. In some embodiments, the mini-HSV-1 comprises a genome from which at least 65 kbp has been deleted. In some embodiments, the mini-HSV-1 comprises a genome from which at least 75 kbp has been deleted.

[0103] In some embodiments, the mini-HSV-1 comprises a genome from which 25 kbp to 80 kbp has been deleted. In some embodiments, the mini-HSV-1 comprises a genome from which 30 kbp to 75 kbp has been deleted. In some embodiments, the mini-HSV-1 comprises a genome from which 35 kbp to 70 kbp has been deleted. In some embodiments, the mini-HSV-1 comprises a genome from which 40 kbp to 60 kbp has been deleted.

[0104] A pre-HSV-1 from which non-essential genes, essential genes, or a combination thereof has been deleted to obtain a genome less than 130 kbp and greater than 75 kbp may permit the insertion therein of a polynucleotide encoding GAD (with or without foreign control elements). As a non-limiting example, recombination techniques based on the markerless Red recombination system can be used to generate scarless point mutations, deletions, and insertions of smaller or larger sequences (e.g., Tischer et al., En Passant Mutagenesis: A Two Step Markerless Red Recombination System, Chapter 30, In Vitro Mutagenesis Protocols: Third Edition, Methods in Molecular Biology, Volume 634, DOI 10.1007 / 978-1-60761-652-8_30, Springer Science+Business Media, LLC 2010). In some embodiments, as used in the present invention, the pre-HSV-1 vector comprises a modified HSV-1 genome from which non-essential genes, essential genes, or a combination thereof has been deleted to obtain a genome less than 130 kbp and greater than 75 kbp.

[0105] In some embodiments, a transgene of interest can be introduced into the LAT (latency-associated transcript) locus, which is a repetitive locus contained within the inverted repeat sequences (termed b and b') of the viral genome. The b and b' sequences of the viral genome are also referred to as the TRL (terminal repeat long sequence) and IRL (internal repeat long sequence), respectively. In some embodiments, the viral genome contains two LAT regions, one in the TRL and the other in the IRL. In some embodiments, one of the LAT regions in the TRL or IRL has been deleted. In some embodiments, when the vector genome contains two LAT loci, the transgene of interest can be introduced into both loci in the TRL region and the IRL region. In some embodiments, when the LAT locus in the IRL region is deleted, the transgene of interest can only be introduced into the LAT locus in the TRL region. In some embodiments, when the LAT locus in the TRL region is deleted, the transgene of interest can only be introduced into the LAT locus in the IRL region.

[0106] The LAT locus includes an upstream DNA insulator (INS) sequence, a latency-associated promoter (LAP), a region conferring long-term expression (LTE), and a downstream DNA insulator (INS). In some embodiments, the transgene of interest is introduced between the latency-associated promoter (LAP) and the long-term expression (LTE) region, or between the LTE region and the DNA insulator (INS) sequence located downstream of the LTE.

[0107] Importantly, the LAT locus contains the LTE and the DNA insulator sequence (INS), which confer the ability of long-term expression to the polynucleotide encoding GAD introduced into this site.

[0108] A "long-term expression sequence" or "long-term expression element (LTE)" refers to a nucleotide sequence that, when operably linked to an exogenous DNA of interest, allows the gene product to be continuously expressed for more than 15 to 45 days, or 30 to 45 days, or 45 to 90 days, or 90 to 365 days, or 365 days to several years or even the patient's lifetime. The long-term expression (LTE) sequence in HSV-1 was identified as the region of the latency-associated transcript (LAT), which is derived from the LAT-associated promoter (LAP). This LTE is located downstream of the LAT transcription start site.

[0109] In fact, viruses carrying the 3' DNA fragment of the LAT promoter maintain detectable promoter expression throughout latency (Lokensgard et al., "The latency-associated promoter of herpes simplex virus type 1 requires a region downstream of the transcription start site for long-term expression during latency", Journal of Virology, 1997, Vol. 71, pp. 6714-6719); Berthomme et al., "Evidence for bidirectional element located downstream from the herpes virus simplex type 1 latency-associated promoter that increases its activity during latency", JOURNAL OF VIROLOGY, 2000, Vol. 74, pp. 3613-3622); and Berthomme et al., "Enhancer and long-term expression functions of herpes simplex virus type 1 latency-associated promoter are both located in the same region", JOURNAL OF VIROLOGY, 2001, Vol. 75, pp. 4386-4393; the contents of which are incorporated herein by reference). Preferably, the LTE is contained between about 1.5 kb and about 3 kb downstream of the LAT transcription start site (Perng et al., "The spontaneous reactivation function of the herpes simplex virus type 1 LAT gene resides completely within the first 1.5 kilobases of the 8.3-kilobase primary transcript", JOURNAL OF VIROLOGY, 1996, Vol. 70, pp. 976-984; the contents of which are incorporated herein by reference).Recently, other sequences upstream and downstream of the LTE region, termed DNA insulators, have also been described (Amelio et al., “A chromatin insulator-like element in the herpes simplex virus type 1 latency-associated transcription region binds CCCTC-binding factor and displays enhancer-blocking and silencing activities”, JOURNAL OF VIROLOGY, 2006, Vol. 80, pp. 2358-2368; the content of which is incorporated herein by reference). These sequences may also contribute to providing long-term expression for a given transcription cassette by suppressing epigenetic silencing and are incorporated as part of the LTE element into the present invention to confer long-term expression ability to the expression cassette. Interestingly, the sequences that confer long-term expression to the transcription cassette (LTE and DNA insulator sequences) can be located upstream and / or downstream of the GAD expression cassette.

[0110] Those skilled in the art will recognize that other LTE-like sequences and other DNA insulator sequences have been described and continue to be discovered. All such LTE-like sequences and DNA insulator sequences are encompassed by the present invention.

[0111] In some embodiments, one or more exogenous genes of interest are introduced into the pre-HSV-1 vector. In some embodiments, a combination of one or more HSV-1 essential genes, one or more HSV-1 non-essential genes, and one or more exogenous genes of interest are introduced into the pre-HSV-1 vector. In some embodiments, a combination of one or more HSV-1 essential genes and one or more exogenous genes of interest are introduced into the pre-HSV-1 vector. In some embodiments, a combination of one or more HSV-1 non-essential genes and one or more exogenous genes of interest are introduced into the pre-HSV-1 vector.

[0112] Importantly, the pre-HSV-1 vector used herein needs to retain sufficient HSV-1 genome to avoid becoming an HSV-1 amplicon. An "amplicon or amplicon vector" refers to a helper virus-dependent vector whose genome lacks most or all of the HSV genes encoding viral proteins. The genome of an amplicon vector is concatemeric DNA composed of multiple tandem copies of a plasmid (referred to as an amplicon plasmid), which carries a DNA replication origin and a packaging signal from the HSV-1 genome. In the presence of an HSV-1 genome as a helper virus, in cells expressing the full set of HSV-1 structural, replication, and DNA packaging functions, the amplicon plasmid is amplified into long head-to-tail concatemers by a rolling circle mechanism and then cleaved and packaged into HSV-1 virions (upper limit of genome size) (Kwong and Frenkel, 1985; Bataille and Epstein, 1997). Thus, an amplicon vector is concatemeric plasmid DNA packaged into HSV-1 particles.

[0113] Compared with amplicons, the pre-HSV-1 vector of the present invention is a helper virus-free vector platform, that is, it does not require the presence of an HSV-1 genome as a helper virus for vector replication and packaging.

[0114] HSV-1 vector

[0115] As described above, the pre-vector or mini-vector "scaffold" used in the method of the present invention is a vector template into which a polynucleotide encoding GAD (with or without foreign control elements) can be inserted. For example, in some embodiments, the polynucleotide encoding GAD can be introduced into the LAT region of the pre-HSV-1 vector. In embodiments according to the present invention, a transcription cassette expressing the above GAD gene (to restore GABA-mediated inhibition and the balance of excitatory and inhibitory inputs, such as expressing wild-type or modified GAD67 and / or wild-type or modified GAD65 or active fragments thereof driven by a promoter) can be introduced into the LAT region of the pre-HSV-1 vector.

[0116] In one embodiment used in the methods and treatment regimens of the present invention, the HSV-1 vector comprises the pre-HSV-1 vector described herein, into which a polynucleotide encoding GAD has been introduced, and the HSV-1 vector is capable of constitutively expressing GAD. In some embodiments, the LAT region of the HSV-1 vector can be used to introduce the polynucleotide encoding GAD. GAD as defined above can comprise wild-type or modified GAD67, wild-type or modified GAD65, and active fragments thereof. In a preferred embodiment used in the methods and treatment regimens of the present invention, the HSV-1 vector comprises the pre-HSV-1 vector described herein, into which a polynucleotide encoding GAD67 (SEQ ID NO:1) has been introduced, and the HSV-1 vector is capable of constitutively expressing the protein product GAD67 (SEQ ID NO:2). In some embodiments, the LAT region of the HSV-1 vector can be used to introduce the polynucleotide encoding GAD67.

[0117] In a preferred embodiment, the HSV-1 vector comprises a polynucleotide encoding GAD operably linked to one or more LTEs and / or DNA insulator sequences within the HSV vector genome. "Operably linked" is understood to mean that the one or more LTEs and / or DNA insulator sequences permit the polynucleotide encoding GAD to be expressed in a cellular environment where other genetic elements (i.e., "genes") within the HSV genome are transcriptionally silent.

[0118] As described herein, the pre-HSV-1 vector of the present invention comprises deletions of the HSV genome such that the genome of the pre-HSV-1 vector is less than 130 kbp and greater than 75 kbp. These deletions create genomic space that allows the introduction and delivery of very large exogenous DNA fragments. Introducing the GAD expression cassette into the LAT region increases the genome size (i.e., the number of base pairs) of the resulting HSV-1 vector.

[0119] As used herein, "one or more exogenous genes of interest" can include, but are not limited to: reporter genes (such as GFP, RFP, luciferase, or fusion proteins, etc.) driven by a transient promoter for internal expression control or biodistribution studies; recombinases driven by an inducible promoter to allow in vivo modification of cellular or viral genes; antibiotic resistance genes (such as chloramphenicol); tetracycline-inducible system (TRE) elements; the GAD gene, or combinations thereof. Using a reporter gene (such as, but not limited to, cherry red fluorescent protein, RFP, GFP, or CFP) can facilitate the identification of the recombinant genome and the counting of infectious particles (PFU) and transduction units (TU).

[0120] In some embodiments, the modified HSV-1 vector may optionally contain a DNA sequence introduced into the genomic gene region, such as an endogenous and / or exogenous DNA sequence encoding a cell-targeting protein. The cell-targeting protein can re-target the virus to enter any tissue or cell type of interest. Cell-targeting genes that can be inserted into the HSV-1 vector used in the present invention include, but are not limited to, HER-2, IL13α2, or modified versions thereof. Examples of HSV-modified glycoprotein D can be found, for example, in EP3469071, the content of which is incorporated herein by reference.

[0121] Promoter

[0122] Within the GAD expression cassette inserted into the viral vector as described herein, there is at least one promoter sequence, and the expression of the polynucleotide encoding GAD can be controlled by this promoter.

[0123] The promoter may comprise a DNA sequence starting at least 2 kb, preferably 3 kb, more preferably 4 kb upstream of the start site of the polynucleotide encoding GAD. These sequences preferably contain known promoter sequence elements, such as specific transcription binding sites, and distal sequences upstream of the gene, including additional regulatory elements.

[0124] The promoters useful in the present invention can be any promoters for controlling / regulating the expression of the polynucleotide encoding GAD. Exemplary promoters useful in the methods and treatment regimens of the present application include, but are not limited to: the human ubiquitin promoter and the human synaptophysin promoter. In addition, other known tissue-specific or cell-specific promoters can also be used.

[0125] In some embodiments, the promoter is a constitutive mammalian promoter (such as EF-1α, UBC, β-actin, PGK, etc. known in the art).

[0126] In some embodiments, the promoters useful in the present invention can be selectively activated in afferent neurons. As used herein, "selectively activated in afferent neurons" means that the promoter is primarily or only active in afferent neurons and drives the transcription of RNA. Promoters for afferent neurons can be selected from, but are not limited to: promoters of genes encoding sensory nerve receptors (such as transient receptor potential vanilloid subtype 1 (TRPV1) or transient receptor potential cation channel subfamily M member 8 (TRPM8)); and promoters of genes encoding sensory neuromodulators or sensory neurotransmitters (such as substance P, PACAP, calcitonin gene-related peptide (CGRP)). In some embodiments, the promoter of the gene encoding a sensory nerve receptor of the present invention is a promoter of the TRP gene family, more preferably the promoter of TRPV1 or TRPM8. In some embodiments, the promoter of the gene encoding a sensory neuromodulator or sensory neurotransmitter of the present invention is the promoter of CGRP, or a promoter of a gene involved in sensory neuron axon growth and stress response (preferably the promoter of the gene encoding advillin (ADVL)). In other embodiments, the promoter inserted into the GAD expression cassette of the viral vector as described herein can be an inducible promoter.

[0127] Those skilled in the art will recognize that many such mammalian afferent neuron-specific promoters are known and new afferent neuron-specific promoters are constantly being discovered. All such afferent neuron-specific promoters are encompassed by the present invention. As non-limiting examples, the afferent neuron-specific promoters can be selected from the promoters disclosed in WO2017220800A1 and Joussain et al. (Int. J. Mol. Sci. 2022, 23, 8474).

[0128] In some embodiments, the promoters useful in the present invention can be ubiquitin promoters (ubiquitous promoters), including but not limited to: human cytomegalovirus (HCMV) promoter, human elongation factor 1α (hEF-1α) promoter, β-actin promoter, Rous sarcoma virus (RSV) promoter, human ubiquitin C (hUBC) promoter, ubiquitin B promoter, simian virus 40 (SV40) promoter, phosphoglycerate kinase (PGK) promoter, β-globin promoter, NF-κB promoter, EGR1 promoter, eIF4A1 promoter, FerL promoter, GAPDH promoter, β-Kin promoter, ROSA26 promoter, and human surfactant protein C (hSP-C) promoter. As used herein, "ubiquitin promoter" or "non-specific promoter" means a promoter that is active in a wide range of cells, tissues, and / or organs.

[0129] In some embodiments, the non-specific promoters of the present invention are selected from the hEF-1α promoter of SEQ ID NO:5, the HCMV promoter of SEQ ID NO:6, the RSV promoter of SEQ ID NO:7, the hUBC promoter of [[SEQ ID NO:8]], the SV40 promoter of SEQ ID NO:9, the PGK promoter of SEQ ID NO:10, the β-globin promoter, the NF-κB promoter, and the hSP-C promoter.

[0130] In a preferred embodiment, the non-specific promoter available in the present method is the hEF-1α promoter (SEQ ID NO:5).

[0131] The viral expression vectors of the present invention are more specifically directed to vertebrates, preferably mammals, more preferably primates and humans. Thus, those skilled in the art will recognize that such promoters are species-specific and can select the homologous sequences of a particular target species. For example, the promoter of the present invention can be the human homolog of rat TRPV1 or the promoter of human TRPM8, rat CGRP or human CGRP, rat advillin or human advillin, etc.

[0132] Dermatome

[0133] A "dermatome" is a skin area mainly innervated by the afferent nerve fibers of the dorsal root of any given spinal nerve. In other words, a dermatome is a specific skin area defined by its connection to one of the 30 spinal nerves. Spinal nerves include 8 cervical nerves (C1-C8, where C1 has no dermatome), 12 thoracic nerves (T1-T12), 5 lumbar nerves (L1-L5), and 5 sacral nerves (S1-S5). Each nerve transmits sensations (including pain) from a specific skin area (i.e., a specific dermatome) to the brain. Dermatomes are clinically significant and can help diagnose various diseases. For example, symptoms occurring along a specific dermatome may indicate a disease related to a specific spinal nerve.

[0134] In some embodiments, for the treatment of spasticity, the viral vector for upregulating the GAD gene described herein can be administered by one or more injections into one or more dermatomes. In some embodiments, for the treatment of spasticity, the viral vector can be administered by multiple injections (preferably by subcutaneous inoculation) into multiple dermatomes. Multiple injections may be required to recruit as many afferent nerves as possible to achieve sufficient expression of the GAD gene. In some embodiments, the viral vector can be administered by 1 - 30 injections (preferably by subcutaneous inoculation) into multiple dermatomes. In some embodiments, it can be administered by 5 - 20 injections (preferably by subcutaneous inoculation) into multiple dermatomes. In some embodiments, it can be administered by 10 - 15 injections (preferably by subcutaneous inoculation) into multiple dermatomes. In some embodiments, it can be administered by 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 injections (preferably by subcutaneous inoculation) into multiple dermatomes. In some embodiments, it can be administered by 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 injections (preferably by subcutaneous inoculation) into 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 dermatomes, where each dermatome receives 1 to 20 injections. In some embodiments, the dermatome into which the viral vector for upregulating the GAD gene is injected can be determined according to the spastic muscle targeted for treatment by the viral vector.

[0135] In some embodiments, for the treatment of spasticity, the viral vector can be administered by multiple injections (preferably by subcutaneous inoculation) into a single dermatome. In some embodiments, it can be administered by multiple subcutaneous injections into a single dermatome. In some embodiments, the multiple subcutaneous injections include 1 - 20 injections at 1 - 20 sites in the target dermatome to cover all or most of the surface of the target dermatome. In some embodiments, it includes 5 - 15 injections at 5 - 15 sites in the target dermatome. In some embodiments, it includes 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 injections at 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 sites in the target dermatome to cover all or most of the surface of the target dermatome.

[0136] In some embodiments, a medical device for performing multiple subcutaneous injections may be used to perform multiple injections at multiple sites in a target skin area at one time to cover all or most of the surface of the target skin area. In some embodiments, the medical device may perform 1-10 injections at multiple sites in the target skin area at one time to cover at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% of the surface. In some embodiments, 2-9 injections may be performed at one time to cover all or most of the surface. In some embodiments, 3, 4, 5, 6, 7, or 8 injections may be performed at one time. The medical device for performing multiple subcutaneous injections may include any known or newly discovered device capable of performing subcutaneous injections at multiple sites in a minimally invasive manner (e.g., multi-syringe, circular 7-needle connector, Mesoram ). In a preferred embodiment, the viral vector for upregulating the GAD gene is the defective viral vector derived from HSV described herein. Depending on the severity of the spasm or the specific spastic muscle, in some embodiments, a single injection into a specific skin area may be sufficient to achieve a therapeutic effect; in some embodiments, multiple injections into a specific skin area may be required over a specific period of time; in some embodiments, multiple injections into each of multiple specific skin areas (whether adjacent or separated by several skin areas) may be required to achieve a therapeutic effect. After injection into the skin area, the viral vector (such as a vector derived from HSV-1) will reach the sensory dorsal root ganglion (DRG) that innervates the skin area and stably express the therapeutic transgene under the drive of an appropriate promoter. The therapeutic transgene described herein may be a polynucleotide encoding wild-type or modified GAD or an active fragment thereof, such as wild-type or modified GAD67 or an active fragment thereof, or wild-type or modified GAD65 or an active fragment thereof.

[0137] Drug composition

[0138] The viral vectors described in the present application may be administered by a drug composition comprising a pharmaceutically acceptable carrier. The carrier of the composition may be any suitable carrier for the carrier. The carrier is usually a liquid, but may also be a solid, or a combination of liquid and solid components. Ideally, the carrier is pharmaceutically acceptable (such as physiologically or pharmacologically acceptable) carrier (such as excipient or diluent). The composition may further comprise any other suitable components, especially components for enhancing the stability of the composition and / or its ultimate use. Therefore, there are a variety of suitable formulations for the viral vector composition. The following formulations and methods are only exemplary and in no way restrictive.

[0139] Formulations suitable for parenteral administration include aqueous and non-aqueous isotonic sterile injection solutions which may contain antioxidants, buffers, bacteriostats and solutes to render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may contain suspending agents, solubilizers, thickening agents, stabilizers and preservatives. The formulations may be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition, requiring only the immediate addition of a sterile liquid excipient, such as water for injection, prior to use. The temporary injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the afore-mentioned types.

[0140] In addition, the composition may comprise additional therapeutic or bioactive agents. For example, therapeutic factors for treating specific indications may be present. Factors that control inflammation, such as ibuprofen or steroids, may be part of the composition to reduce swelling and inflammation associated with in vivo administration of the viral vector and physiological stress. Immunosuppressive agents may be co-administered with the composition to reduce any immune response to the vector itself or associated with the disease. Alternatively, immunostimulants may be included in the composition to up-regulate the body's natural defenses against the disease. Antibiotics (i.e., microbicides and fungicides) may be present to reduce the risk of infection associated with gene transfer procedures and other conditions.

[0141] The method of treating spasticity may further include administering (i.e., pre-administering, co-administering and / or post-administering) other therapies and / or agents to modify (e.g., enhance) the effectiveness of the method. The method of the invention may further include administering other substances that locally or systemically modify (i.e., attenuate or enhance) the effect of the composition on the host. For example, substances that attenuate any systemic effect of a protein produced by expression of a vector nucleic acid sequence in a host may be used to control the systemic toxicity level of the host. Similarly, substances that enhance the local effect of a protein produced by expression of a vector nucleic acid sequence in a host may be used to reduce the level of protein required to produce a prophylactic or therapeutic effect in the host. Such substances include antagonists (e.g., soluble receptors or antibodies directed against a protein produced by expression of a vector nucleic acid sequence) and agonists of the protein.

[0142] Dermatome-specific administration

[0143] In some embodiments, the present application also provides a method of administering a viral vector to a subject for treating spasticity.

[0144] As used herein, the term "administer" or "administration" is defined to include the act of providing to a subject a pharmaceutical composition of a viral vector as described herein when practicing the methods of the invention. Exemplary routes of administration include, but are not limited to, intravenous, intra-articular, intrathecal, intraocular, intraventricular, intrathecal, subcutaneous, subpial, intramuscular, intraperitoneal, intradermal, intracavitary, etc., and combinations of any two or more routes. In some embodiments, the defective viral vector derived from HSV described herein can be directly delivered to the spinal cord parenchyma, the intrathecal space of the spinal column, the subpial space of the spinal cord of the subject, and / or the surrounding spastic muscles to effect spinal cord upregulation of the GAD gene (see, e.g., WO2016 / 122791). In some embodiments, the defective viral vector can be peripherally delivered to any skin area to transfect the connected afferent neurons (see, e.g., Liu et al., MOLECULAR THERAPY, 2004, Vol. 10, No. 1, pp. 57-66).

[0145] A "therapeutically effective amount" or "effective amount" refers to the amount of viral vector that will elicit the biological or medical response of a tissue, system, animal, or human that a researcher, veterinarian, physician, or other clinician is seeking, such as upregulation of the GAD gene (including the GAD67 gene and the GAD65 gene, preferably the GAD67 gene) in the afferent nerve fibers supplying the skin area. Thus, "therapeutically effective amount" as used herein refers to any dosage that, when repeatedly administered to the affected area over a period of time, results in a significant improvement in the spasm-related disorder. This amount will vary depending on the disorder being treated, the stage of progression of the disorder, and the type and concentration of the preparation being administered.

[0146] Determination of a therapeutically or prophylactically effective amount of the delivery vector can be accomplished using conventional computational methods based on animal data. Suitable dosages will depend particularly on the specific delivery vector selected, the route of administration, the number of injection sites, the mammalian subject being treated (such as a human or non-human primate or other mammal), the age, weight, and general condition of the subject, the severity of the disorder being treated, the location of the cardiac area being treated, and the mode of administration. Accordingly, suitable dosages may vary from patient to patient.

[0147] Dosing regimens can be single-dose or multi-dose. In addition, the appropriate number of doses can be administered to the subject. It may be necessary to adjust the dosage to account for alternative routes of administration, decreased expression efficacy over time, or to balance the therapeutic benefit with any side effects.

[0148] HSV-1 vectors can effectively infect cells and resist immune clearance, which may be attributed to the innate immune evasion properties of HSV envelope proteins. The combination of innate immune evasion function and deletion of IE genes (such as ICP4, ICP22, and ICP27) from the HSV-1 vector backbone allows for multiple administrations of defective viral vectors derived from HSV-1 to improve transduction efficiency and makes the vector particularly suitable for gene therapy (see Heldwein et al., Cell. Mol. Life Sci. (Cell and Molecular Life Sciences), 2008, Vol. 65, pp. 1653–1668; Tognarelli et al., Front. Cell. Infect. Microbiol. (Frontiers in Cellular and Infection Microbiology), 2019, Vol. 9, p. 127; Yang et al., Front. Immunol. (Frontiers in Immunology), 2019, Vol. 10, p. 2196; Gurevich et al., Nature Medicine, 2022, Vol. 28, pp. 780–788).

[0149] This article also provides a method for treating spasm in a subject, including administering multiple doses of the HSV-1 vector described herein to the subject. During the treatment of spasm, multiple doses of the HSV-1 vector described herein can be administered according to the severity of the spasm symptoms, usually 1-10 doses, at intervals of about 21 days (three weeks) to about three years. For example, if the treatment regimen needs to be modified to improve the treatment effect or reduce side effects, an interval of about 3 months to about 12 months can be used. During the treatment of spasm, 2-10 treatments can be administered (each treatment, for example, includes one or more subcutaneous injections, with or without the multi-injection device described herein), usually 2-4 treatments, at intervals of about 3, about 6, about 12, about 24, or about 36 months. In some embodiments, the vector can be administered to the subject at a dose of about 1×10 6 vg / kg to about 1×101 5 vg / kg body weight. In some embodiments, the dose can be about 1×10 7 vg / kg to about 1×10 12 vg / kg body weight. During the treatment of spasm, the dose can be kept constant over time, or can be reduced or increased over time to optimize the treatment effect and minimize side effects.

[0150] Optionally, HSV-1-mediated delivery according to the present invention can be combined with the delivery of other viral and non-viral vectors. Such other viral vectors can include, but are not limited to, adenoviral vectors, adeno-associated virus (AAV) vectors, retroviral vectors, lentiviral vectors, and baculoviral vectors. Non-viral vectors can include, but are not limited to, liposomes, lipid-based carriers, polyplex carriers, molecular conjugates, polyamines, and polycationic carriers.

[0151] In a preferred embodiment, the present application provides a method for treating spasticity in a subject, comprising upregulating the GAD gene, thereby treating spasticity in the subject. The upregulation of the GAD gene comprises administering to the subject a viral vector comprising a polynucleotide encoding GAD, wherein GAD is expressed, thereby alleviating spasticity. The viral vector is a defective virus vector derived from HSV as described herein. The polynucleotide can encode wild-type or modified GAD67 and / or wild-type or modified GAD65 or an active fragment thereof, more preferably wild-type or modified GAD67 or an active fragment thereof. The HSV-derived defective virus vector described herein is directly administered to one or more skin regions of the subject. In one aspect, the HSV-derived defective virus vector is directly administered to one or more skin regions of the subject by subcutaneous inoculation. As described herein, depending on the severity of spasticity or the specific spastic muscle, in some embodiments, a single injection of the vector into a specific skin region may achieve a therapeutic effect; in some embodiments, multiple injections of the vector into a specific skin region are required within a specific time period. In some embodiments, multiple injections are required into each of multiple specific skin regions (whether adjacent or separated by several skin regions) to achieve a therapeutic effect. In some embodiments, the skin regions selected for administering the viral vector are associated with the spastic muscle group. Administering the viral vector to the skin region can infect sensory neurons associated with the spastic muscle group, prompting the sensory neurons to produce and release GABA and transform into inhibitory neurons to alleviate spasticity.

[0152] In a preferred embodiment, a method for treating spasticity in a subject comprises administering to the subject a therapeutically effective amount of a viral vector comprising a polynucleotide encoding GAD, thereby treating spasticity in the subject. The viral vector is a defective virus vector derived from HSV as described herein. The polynucleotide can encode wild-type or modified GAD67 and / or wild-type or modified GAD65 or an active fragment thereof, more preferably wild-type or modified GAD67 or an active fragment thereof. The HSV-derived defective virus vector described herein is directly administered to one or more skin regions of the subject. In one aspect, the HSV-derived defective virus vector is directly administered to one or more skin regions of the subject by subcutaneous inoculation. As described herein, depending on the severity of spasticity or the specific spastic muscle, one or more injections of the vector into one or more skin regions may be required to achieve a therapeutic effect.

[0153] In another aspect, the present invention also provides a treatment regimen for treating a subject suffering from spasm or a spasm-related disorder. The treatment regimen includes the afferent neuron-specific upregulation of the GAD gene (including the GAD67 gene and the GAD65 gene, preferably the GAD67 gene). As discussed in detail above, the upregulation of GAD (preferably GAD67) can include administering a viral vector encoding the GAD gene (preferably the GAD67 gene), wherein GAD (preferably GAD67) is expressed, causing neurons to produce and release GABA, that is, converting an excitatory neurotransmitter into an inhibitory neurotransmitter, and treating spasm or a spasm-related disorder. As described herein, depending on the severity of the spasm or the specific spastic muscle, it may be necessary to inject the vector one or more times into one or more dermatomes to achieve a therapeutic effect.

[0154] Mechanism of action

[0155] In some embodiments, the present application presents the mechanism of action of using the viral vectors described herein (preferably defective viral vectors derived from HSV-1) to treat spasm. The disclosed method for treating spasm has regional specificity (i.e., it only acts on the spinal microcircuits that produce abnormal muscle activity, avoiding widespread inhibition of spinal cord function or even other brain functions like baclofen) and adjustability (e.g., being able to regulate neural activity according to the severity of spasm symptoms), and provides a long-term anti-spasmodic effect.

[0156] After injecting the viral vectors described herein into a dermatome, the vector will infect the afferent nerve fibers connected to that dermatome, causing sensory neurons to stably express the GAD gene (preferably the GAD67 gene) under the drive of the promoter described herein. GAD (preferably GAD67), as an enzyme, can induce and promote the synthesis of the inhibitory neurotransmitter GABA from the excitatory neurotransmitter glutamate. The sensory neurons infected by the vector will be able to produce and release GABA at a higher level, thereby reducing muscle excitability and treating or alleviating spasm.

[0157] The new combination of HSV-1-mediated GAD gene upregulation and dermatome-specific drug delivery enables the treatment to target the designated spinal cord levels associated with specific dermatomes, thereby exerting a therapeutic effect on specific spastic muscles. Due to the neurotropism of the HSV-1 vector and the dermatome-specific drug delivery method, the therapeutically effective amount required for treating spasm will be significantly reduced, and the systemic toxicity and side effects will also be minimized. The present invention provides a non-surgical, minimally invasive, region-specific method for treating spasm.

[0158] The following examples are intended to illustrate and not limit the present invention. All documents cited in this disclosure are hereby expressly incorporated herein by reference.

[0159] Examples

[0160] Experiments can be conducted to evaluate the effect of the disclosed method on converting glutamatergic sensory neurons into GABAergic neurons in vivo, regulating the hyperexcitability of the spinal cord circuit, and thus treating spasticity.

[0161] The HSV-GAD67 viral vector can be directly injected into a mouse model with chronic sacral spinal cord injury to infect sensory afferent neurons and thus relieve spasticity. The behavioral effects of the direct injection on the mouse model can be evaluated and compared with the effect of baclofen. Anatomical evaluation can be performed to further verify the effect of the direct injection of the HSV vector described herein as an effective and minimally invasive treatment method for treating spasticity.

[0162] Neuromodulatory HSV-mediated gene therapy for spasticity after spinal cord injury

[0163] The following experiments are designed to determine the effect of converting glutamatergic sensory neurons into GABAergic neurons in vivo to regulate the hyperexcitability of the spinal cord circuit (a typical feature of spasticity).

[0164] In the following experiments, all mice (n = 20) underwent complete spinal cord transection at the sacral S1-S2 level. Such animals exhibit a tail spasticity phenotype, specifically manifested as abnormal tail posture, accompanied by enhanced tonic stretch reflex and spontaneous or induced spasticity (associated with enhanced phasic reflex).

[0165] Eight weeks after spinal cord transection, when the spasticity phenotype had formed, the mice were randomly divided into a treatment group and a control group (n = 10 in each group). The treatment group was subcutaneously injected with 20 μl of a non-replicating HSV-1 vector expressing GAD67 (described below) at 6 sites around the base of the tail. This vector contains the main enzyme that converts glutamate into GABA; the control group was injected with ultraviolet-inactivated product in the same manner. The injection sites at the base of the tail were located in the sacral dermatome.

[0166] Carrier description: This vector (referred to herein as hEF-1α::GAD67) is a non-replicating recombinant herpes simplex virus type 1 (HSV-1)-derived vector that expresses human glutamate decarboxylase (hGAD67) under the drive of the human elongation factor 1α (hEF-1α) promoter. The transcription cassette is inserted into the latency-associated transcript (LAT) locus of the HSV-1 genome. The vector lacks the viral immediate-early (IE) genes ICP4 and ICP27 to block its replication ability, and at the same time deletes a single copy of the ICP0 gene to reduce the vector toxicity. The hEF-1α::GAD67 vector is dissolved in phosphate-buffered saline (PBS) in the form of purified virus particles at a concentration of 1.3×10 5 PFU (plaque-forming units) / μl (titrated by monolayer cell plaque assay).

[0167] Therapeutic evaluation of tail posture characteristics for tonic activity

[0168] As described by Marcantoni et al. (Sci. Transl. Med., 12, eay0167 (2020)), the model has defined a severity index to characterize the enhanced tonic stretch reflex that leads to the quantification of abnormal postures ( Figure 1C ). Figure 1A and 1B shows representative images of the mouse tail of animals in the injury control group ( Figure 1A ) and the treatment group ( Figure 1B ) at the chronic stage of spinal cord injury (3 weeks after vehicle injection). Figure 1D Shows the severity index for each group (N = 10 animals per group). Each point represents an animal, and the bar graph represents the mean ± standard deviation. Statistical analysis by unpaired t-test showed a significant difference between the treated mice and the injury control group (p < 0.05), with a significant decrease in the severity index after hEF1α::GAD67 treatment. When the overall index was decomposed into 3 components ( Figure 1E ), only the first tail bending angle θ1 showed a statistically significant difference between the groups. These results suggest that the hEF-1α::GAD67 vector has a local effect on the first muscle segment (proximal to the base of the tail). Thus, a statistically significant reduction in tonic muscle hyperactivity was confirmed when mice were treated with the hEF-1α::GAD67 vector.

[0169] Electromyography assessment of the effect of the vector on tail spasticity

[0170] In spinal cord-injured mice, similar to humans, muscles below the injury level may develop spasms spontaneously or be induced by sensory stimuli. To evaluate the effect of the vector on such spasms, electromyography (EMG) was used to measure muscle activity. Animals were evaluated at least 3 weeks after injection (3 to 13 weeks post-injection) to allow the vector to reach a stable pseudo-latent stage in infected cells. For each animal, EMG recordings were made for 2 seconds (repeated 10 times) and the area under the curve was calculated during periods of no stimulation (animal at rest, no contact with the tail except for EMG electrodes) or during cutaneous tactile stimulation. Tactile stimulation was applied at two different sites: the base of the tail where the vector had been previously injected, and the tip of the tail. Figure 2 shows the mean EMG changes for each animal during stimulation (tip or base) relative to the no-stimulation baseline. Panel (A) of Figure 2 shows the EMG recording of the muscle at the base of the tail, which is alleged to be at the same homologous segmental level as the injected dermatome (S1-S2). The control group showed increased activity during both tip and base stimulation. The treatment group showed increased activity during tip stimulation of the tail (no statistically significant difference from the control group), but significantly decreased activity during base stimulation of the tail (p < 0.05 - two-way ANOVA with Tukey's multiple comparisons). Thus, the hEF-1α::GAD67 vector can limit stimulus-induced tail spasms, and this effect appears to be localized to the stimulated area of infected neurons.

[0171] To further investigate the effect of the hEF-1α::GAD67 vector, similar EMG recordings were made of two additional tail muscles while the muscle at the base was being evaluated: one in the middle of the tail and the other at the tip of the tail (more caudal), which are believed to be mainly driven by more caudal homologous segmental levels. The results showed no statistically significant effect on spasm intensity, indicating that the effect of the vector may be limited to muscle activity driven by homologous segmental levels of the injected dermatome (see Figure 2B and 2C ).

[0172] Electromyography (EMG) assessment of the effect of the vector in combination with tiagabine on tail spasms

[0173] Next, it was investigated whether the effect of increased GABA release at the spinal cord level due to GAD67 overexpression could be further enhanced by GABA reuptake inhibitors such as tiagabine. Both the control group and the treatment group were injected with 15 mg / kg tiagabine before the evaluation and the same EMG assessment was performed.

[0174] Figure 3AIt shows the changes in electromyogram activities of the caudal base muscles under tactile stimulation at the base and tip. As shown in the above treatment without tiagabine, only the treatment group did not show an increase in electromyogram activities, so caudal base muscle spasms were not induced only under tactile stimulation at the caudal base. It is worth noting that the difference between the treatment group and the control group was highly significant (p < 0.001 - two-way ANOVA with Tukey's multiple comparisons). From the activities induced by stimulation at the caudal tip, it can be seen that tiagabine alone has no effect on preventing spasms. In addition, muscle activities decreased in 5 out of 10 animals under caudal base stimulation. This experiment confirmed the regulatory effect of the combination of tiagabine and the vector.

[0175] In the presence of tiagabine, the activities of the middle and caudal muscles after basal stimulation ( Figure 3B and 3C ) were evaluated, and no statistically significant differences in the induced muscle activities were observed compared with the control animals.

[0176] Conclusion

[0177] Overall, these experiments support the following conclusion: local subcutaneous injection of the hEF-1α::GAD67 vector has a local effect on muscle tone and muscle spasms, and this effect can be synergistically enhanced by tiagabine.

[0178] Without wishing to be bound by any particular theory, it is believed that after the sensory nerves in the injection skin area are infected by the vector, GABA will be released from their axon terminals at the spinal cord level, rather than only glutamate. This release of GABA is considered to affect the overall excitability of motor neurons, and motor neurons are known to be hyperactive in the spastic state.

[0179] Tactile stimulation of the skin at the injection site induces sensory nerve discharge, but the results show a decrease in local muscle activities rather than triggering typical spasms. This effect seems to be limited to the muscles mainly driven by the same homologous segment level as the injection skin area, indicating that the GABA released at the spinal cord level may not have a diffusion effect.

[0180] SEQ ID NO:1 1785

[0182] DNA

[0183] Human glutamate decarboxylase 67 (hGAD67) gene sequence

[0184]

[0185] SEQ ID NO:2 594

[0187] AA

[0188] Amino acid sequence of human glutamate decarboxylase 67 (hGAD67)

[0189] MASSTPSSSATSSNAGADPNTTNLRPTTYDTWCGVAHGCTRKLGLKICGFLQRTNSLEEKSRLVSAFRERQSSKNLLSCENSDRDARFRRTETDFSNLFARDLLPAKNGEEQTVQFLLEVVDILLNYVRKTFDRSTKVLDFHHPHQLLEGMEGFNLELSDHPESLEQILVDCRDTLKYGVRTGHPRFFNQLSTGLDIIGLAGEWLTSTANTNMFTYEIAPVFVLMEQITLKKMREIVGWSSKDGDGIFSPGGAISNMYSIMAARYKYFPEVKTKGMAAVPKLVLFTSEQSHYSIKKAGAALGFGTDNVILIKCNERGKIIPADFEAKILEAKQKGYVPFYVNATAGTTVYGAFDPIQEIADICEKYNLWLHVDAAWGGGLLMSRKHRHKLNGIERANSVTWNPHKMMGVLLQCSAILVKEKGILQGCNQMCAGYLFQPDKQYDVSYDTGDKAIQCGRHVDIFKFWLMWKAKGTVGFENQINKCLELAEYLYAKIKNREEFEMVFNGEPEHTNVCFWYIPQSLRGVPDSPQRREKLHKVAPKIKALMMESGTTMVGYQPQGDKANFFRMVISNPAATQSDIDFLIEEIERLGQDL*

[0190] SEQ ID NO:3 2400

[0192] DNA

[0193] Gene sequence of human glutamate decarboxylase 65 (hGAD65)

[0194]

[0195] SEQ ID NO:5 1179

[0197] DNA

[0198] Human elongation factor 1α (hEF-1α) promoter sequence

[0199]

[0200] SEQ ID NO:6 508

[0202] DNA

[0203] Cytomegalovirus (CMV) promoter sequence

[0204] CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT

[0205] SEQ ID NO:7 522

[0207] DNA

[0208] Rous sarcoma virus (RSV) promoter sequence

[0209] GGTGCACACCAATGTGGTGAATGGTCAAATGGCGTTTATTGTATCGAGCTAGGCACTTAAATACAATTATCTCTGCAATGCGGTATTCAGTGGTTCGTCCAATCCATGTCAGACCCGTCTGTTGCCTTCCTAATAAGGCACGATCGTACCACCTTACTTCCACCAATCGGCATGCACGGTGCTTTTTCTCTCCTTGTAAGGCATGTTGCTAACTCATCGTTACCATGTTGCAAGACTACAAGAGTATTGCATAAGACTACATTTCCCCCTCCCTATGCAAAAGCGAAACTACTATATCCTGAGGGGACTCCTAACCGCGTACAACCGAAGCCCCGCTTTTCGCCTAAACACACCCTAGTCCCCTCAGATACGCGTATATCTGGCCCGTACATCGCGAAGCAGCGCAAAACGCCTAACCCTAAGCAGATTCTTCATGCAATTGTCGGTCAAGCCTTGCCTTGTTGTAGCTTAAATTTTGCTCGCGCACTACTCAGCGACCTCCAACACACAAGCAGGGAGCAG

[0210] SEQ ID NO:8 1212

[0212] DNA

[0213] Ubiquitin C promoter sequence

[0214]

[0215] SEQ ID NO:9 331

[0217] DNA

[0218] Simian vacuolating virus 40 (SV40) promoter sequence

[0219] GTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAA

[0220] SEQ ID NO:10 500

[0222] DNA

[0223] Phosphoglycerate kinase (PGK) promoter sequence

[0224] GGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAGGCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCCGGGCCTTTCG

Claims

1. A method for treating spasm in a subject, comprising upregulating the GAD (glutamic acid decarboxylase) gene, thereby treating the spasm in the subject.

2. The method according to claim 1, wherein the upregulation of the GAD gene is a region-specific upregulation of the GAD gene.

3. The method according to claim 1, wherein the upregulation of the GAD gene comprises administering to the subject a viral vector comprising a polynucleotide encoding GAD, wherein GAD is expressed, thereby alleviating spasm.

4. The method according to claim 3, wherein the GAD gene is overexpressed.

5. The method according to claim 1, wherein the viral vector is an adeno-associated virus (AAV) vector or a herpes simplex virus (HSV) vector, preferably an HSV-1 vector or an HSV-2 vector, more preferably a defective viral vector derived from HSV, such as a recombinant HSV vector, an amplicon HSV vector, or an HSV-1 vector comprising a pre-HSV-1 vector and a GAD expression cassette.

6. The method according to claim 5, wherein the viral vector is a defective viral vector derived from HSV-1, and wherein the polynucleotide encoding GAD is inserted into the LAT (latency-associated transcript) locus of the defective viral vector derived from HSV-1.

7. The method according to claim 3, wherein the GAD gene is the GAD67 gene (SEQ ID NO: 1) or the GAD65 gene (SEQ ID NO: 3), preferably GAD67.

8. The method according to claim 5, wherein the viral vector comprises a promoter.

9. The method according to claim 8, wherein the promoter is an afferent neuron-specific promoter, selected from the promoters of genes encoding sensory nerve receptors, preferably the promoters of the TRP gene family, more preferably the promoters of TRPV1 or TRPM8; or the promoters of genes encoding sensory nerve modulators or sensory neurotransmitters, preferably the promoters of substance P, PACAP, CGRP, ADVL, more preferably the promoters of CGRP or ADVL.

10. The method according to claim 8, wherein the promoter is a non-specific promoter, selected from the hEF-1α promoter (SEQ ID NO: 5), the cytomegalovirus (CMV) promoter (SEQ ID NO: 6), the Rous sarcoma virus (RSV) promoter (SEQ ID NO: 7), the human ubiquitin C (hUBC) promoter (SEQ ID NO: 8), the simian vacuolating virus 40 (SV40) promoter (SEQ ID NO: 9), the phosphoglycerate kinase (PGK) promoter (SEQ ID NO: 10), the β-globin promoter, the NF-κB promoter, the EGR1 promoter, the eIF4A1 promoter, the FerL promoter, the GAPDH promoter, the β-Kin promoter, the ROSA26 promoter, and the human surfactant protein C (hSP-C) promoter; and preferably, wherein the promoter is the hEF-1α promoter (SEQ ID NO: 5).

11. The method according to claim 3, wherein the viral vector is directly administered into the spinal cord parenchyma of the subject, into the intrathecal space of the subject, into the subpial space of the spinal cord of the subject, or into the peripheral spastic muscle of the subject, or into one or more dermatomes of the subject.

12. The method according to claim 11, wherein the viral vector is directly administered into one or more dermatomes of the subject by one or more injections.

13. A method of treating spasticity in a subject, comprising administering to the subject a therapeutically effective amount of a viral vector comprising a polynucleotide encoding GAD, thereby treating spasticity in the subject.

14. The method according to claim 13, wherein the viral vector is an adeno-associated virus (AAV) vector or a herpes simplex virus (HSV) vector, preferably an HSV-1 vector or an HSV-2 vector, more preferably a defective viral vector derived from HSV, such as a recombinant HSV vector, an amplicon HSV vector, or an HSV-1 vector comprising a pro-HSV-1 vector and a GAD expression cassette.

15. The method according to claim 14, wherein the viral vector is a defective viral vector derived from HSV-1, and wherein the polynucleotide encoding GAD is inserted into the LAT (latency-associated transcript) locus of the defective viral vector derived from HSV-1.

16. The method according to claim 13, wherein GAD is GAD67 or GAD65, preferably GAD67.

17. The method according to claim 12, wherein the viral vector comprises a promoter.

18. The method according to claim 17, wherein the promoter is an afferent neuron-specific promoter selected from the promoters of genes encoding sensory nerve receptors, preferably the promoters of the TRP gene family, more preferably the promoters of TRPV1 or TRPM8; or the promoters of genes encoding sensory nerve modulators or sensory neurotransmitters, preferably the promoters of substance P, PACAP, CGRP, ADVL, more preferably the promoters of CGRP, ADVL.

19. The method according to claim 17, wherein the promoter is a non-specific promoter selected from the hEF-1α promoter, the cytomegalovirus (CMV) promoter, the Rous sarcoma virus (RSV) promoter, the human ubiquitin C (hUBC) promoter, the simian virus 40 (SV40) promoter, the phosphoglycerate kinase (PGK) promoter, the β-globin promoter, the NF-κB promoter, the EGR1 promoter, the eIF4A1 promoter, the FerL promoter, the GAPDH promoter, the β-Kin promoter, the ROSA26 promoter, and the human surfactant protein C (hSP-C) promoter; and preferably, wherein the promoter is the hEF-1α promoter.

20. The method according to claim 13, wherein the viral vector is directly administered into the spinal cord parenchyma of the subject, into the intrathecal space of the subject, into the subpial space of the spinal cord of the subject, or into the perispastic muscle of the subject, or into one or more dermatomes of the subject.

21. The method according to claim 20, wherein the viral vector is directly administered into one or more dermatomes of the subject by one or more injections.

22. A treatment regimen for treating a subject suffering from spasticity or a spasticity-related disorder, comprising administering a viral vector comprising a polynucleotide encoding GAD, wherein GAD is expressed, thereby treating the spasticity or spasticity-related disorder.

23. The treatment regimen according to claim 22, wherein the viral vector is an adeno-associated virus (AAV) vector or a herpes simplex virus (HSV) vector, preferably an HSV-1 vector or an HSV-2 vector, more preferably a defective viral vector derived from HSV, such as a recombinant HSV vector, an amplicon HSV vector, or an HSV-1 vector comprising a pro-HSV-1 vector and a GAD expression cassette.

24. The treatment regimen according to claim 23, wherein the viral vector is a defective viral vector derived from HSV-1, and wherein the polynucleotide encoding GAD is inserted into the LAT (latency-associated transcript) locus of the defective viral vector derived from HSV-1.

25. The treatment regimen according to claim 22, wherein GAD is GAD67 or GAD65, preferably GAD67.

26. The treatment regimen according to claim 23, wherein the viral vector comprises a promoter.

27. The treatment regimen according to claim 26, wherein the promoter is an afferent neuron-specific promoter, selected from the promoters of genes encoding sensory nerve receptors, preferably the promoters of the TRP gene family, more preferably the promoters of TRPV1 or TRPM8; or the promoters of genes encoding sensory nerve modulators or sensory neurotransmitters, preferably the promoters of substance P, PACAP, CGRP, ADVL, more preferably the promoters of CGRP, ADVL.

28. The treatment regimen according to claim 26, wherein the promoter is a non-specific promoter, selected from the hEF-1α promoter, the cytomegalovirus (CMV) promoter, the Rous sarcoma virus (RSV) promoter, the human ubiquitin C (hUBC) promoter, the simian virus 40 (SV40) promoter, the phosphoglycerate kinase (PGK) promoter, the β-globin promoter, the NF-κB promoter, the EGR1 promoter, the eIF4A1 promoter, the FerL promoter, the GAPDH promoter, the β-Kin promoter, the ROSA26 promoter, and the human surfactant protein C (hSP-C) promoter; and preferably, wherein the promoter is the hEF-1α promoter.

29. The treatment regimen according to claim 22, wherein the viral vector is directly administered into the spinal cord parenchyma of the subject, into the intrathecal space of the subject, into the subpial space of the subject, or into the peripheral spastic muscle of the subject, or into one or more dermatomes of the subject.

30. The treatment regimen according to claim 29, wherein the viral vector is directly administered into one or more dermatomes of the subject by one or more injections.

Images