OVGP1 inhibitor for preparing medicine for preventing and treating intimal hyperplasia after vascular injury
Through OVGP1-siRNA or OVGP1-shRNA, the treatment problem of endometrial hyperplasia after vascular injury is solved, and effective inhibition of endometrial hyperplasia and prevention of vascular stenosis is achieved.
Patent Information
- Application Number
- CN202510469910.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-15
- Publication Date
- 2025-07-11
AI Technical Summary
The prior art has not yet effectively inhibited restenosis caused by endometrial hyperplasia after vascular injury, and lacks effective treatment methods.
OVGP1-siRNA or OVGP1-shRNA is developed as an inhibitor targeting knockdown of the OVGP1 gene for the preparation of pharmaceutical compositions for the prevention and treatment of endometrial hyperplasia after vascular injury.
It significantly inhibits endometrial hyperplasia after vascular injury, prevents and treats diseases such as vascular stenosis and post-stent surgery, and provides new treatment strategies.
Smart Images

Figure CN120285000A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedical technology, and particularly to the application of OVGP1 as a target in preventing and treating intimal hyperplasia after vascular injury. Background Art
[0002] Intimal hyperplasia caused by vascular injury is the main cause of restenosis after vascular intervention, which can lead to thickening of the arterial wall and stenosis of the lumen, and in severe cases, cause vascular occlusion or necrosis. In the early stage of vascular injury, phenotypic transformation of VSMCs can be observed, from the contractile type to the synthetic type, to complete the proliferation and repair of the neointima. The phenotype of VSMCs cultured in vitro is also regulated by many factors, including Platelet derived growth factor (PDGF-BB), which can induce VSMCs to transform from the contractile type to the synthetic type, and promote proliferation and migration. After vascular injury, VSMCs located in the media are activated, migrate to the intima after phenotypic transformation, proliferate, and secrete a large amount of extracellular matrix components, participating in the formation and thickening of the neointima. However, measures to inhibit the proliferation of VSMCs to reduce the area of the neointima have not achieved definite curative effects clinically, which prompts people to re-understand the mechanism of ISR.
[0003] Oviductal glycoprotein 1 (OVGP1) is a glycoprotein secreted by oviduct epithelial cells. OVGP1 has been found in many mammals, and can promote sperm capacitation by enhancing the acrosome reaction, playing an important role in fertilization and early embryonic development. The expression of OVGP1 is increased in the pathological tissues of patients with chronic rhinosinusitis. It has also been found that hypomethylation of the OVGP1 promoter region leads to elevated blood pressure, indicating its important role in the cardiovascular system. However, the mechanism of action of OVGP1 in restenosis after vascular injury, especially restenosis caused by intimal hyperplasia induced by VSMC phenotypic transformation, is not clear, and its role in endothelial cells has not been studied. Therefore, exploring the mechanism of action of OVGP1 in the process of intimal hyperplasia, and the impact of reducing its activity on intimal hyperplasia through techniques such as gene editing, RNA interference, and inhibitors has positive clinical significance, so as to provide new ideas and targets for the treatment of intimal hyperplasia. At present, the application of OVGP1 as a target in the treatment or prevention of intimal hyperplasia after vascular injury has not been reported at home and abroad.
[0004] Research shows that OVGP1 plays a key regulatory role in the proliferation, migration, and inflammatory response of vascular smooth muscle cells (VSMCs). The present invention discovers for the first time that regulating the expression of this gene can significantly inhibit intimal hyperplasia, providing a new strategy for the treatment after vascular injury. Summary of the Invention
[0005] In view of this, the technical problem to be solved by the present invention is to provide a new inhibitor for preparing drugs for clinically preventing and treating restenosis caused by intimal hyperplasia after vascular injury.
[0006] The present invention discloses an OVGP1 inhibitor for preparing drugs for preventing and / or treating intimal hyperplasia after vascular injury, and the inhibitor is OVGP1-siRNA or OVGP1-shRNA that targets and knocks down the OVGP1 gene.
[0007] Further preferably, the sense strand sequence si-OVGP1-F1 of the OVGP1-siRNA is as shown in SEQ ID NO.1: SEQ ID NO.1: 5'-CCUCAAGAUUCACCACUAUTT-3', The antisense strand sequence si-OVGP1-R1 is as shown in SEQ ID NO.2: SEQ ID NO.2: 3'-AUAGUGGUGAAUCUUGAGGTT-5'; Or the sense strand sequence si-OVGP1-F2 of the OVGP1-siRNA is as shown in SEQ ID NO.3: SEQ ID NO.3: 5'-CCACACAUCGUCCAAACAUTT-3', The antisense strand sequence si-OVGP1-R2 is as shown in SEQ ID NO.4: SEQ ID NO.4: 3'-AUGUUUGGACGAUGUGUGGTT-5'.
[0008] Further preferably, the target sequence of the OVGP1-shRNA is as shown in SEQ ID NO.7: SEQ ID NO.7: CCATAAACTCGTGTGTTATTT; Or as shown in SEQ ID NO.8: SEQ ID NO.8: AGGGCAGACTATGCCTTTAAG; Or as shown in SEQ ID NO.9: SEQ ID NO.9: CTTCTTATATCCTGGACTAAG.
[0009] The present invention also discloses a pharmaceutical composition, comprising the above-mentioned inhibitor and a pharmaceutically acceptable carrier. This pharmaceutical composition can be used for preventing and / or treating intimal hyperplasia after vascular injury.
[0010] Specifically, the above-mentioned pharmaceutical composition can be used to prevent and / or treat diseases such as vascular stenosis, in-stent restenosis, and restenosis after endarterectomy.
[0011] The beneficial effects of the present invention are embodied in: The present invention provides an OVGP1 inhibitor for preparing a drug for preventing and / or treating intimal hyperplasia after vascular injury, which can be widely used as a drug for preventing and treating vascular stenosis diseases and restenosis after vascular injury. Brief Description of the Drawings
[0012] Figure 1 To detect the expression level of OVGP1 in the plasma of AS patients and healthy control groups by ELISA.
[0013] Figure 2 To show the expression of OVGP1 in the vascular plaques of AS model mice.
[0014] Figure 3 To show the expression of OVGP1 in the neointima after vascular injury. Among them, (A) shows the results of immunohistochemical staining to detect the expression of OVGP1 in mice after femoral artery injury; (B) shows the results of EVG staining experiment.
[0015] Figure 4 To show the statistical chart of the promotion of intimal hyperplasia after vascular injury by overexpressing OVGP1. Among them, (A) shows the representative HE staining map of the femoral artery injury model of TG and NTG mice at 28 days when OVGP1 is overexpressed; (B) shows the statistical chart of I / M at 28 days after femoral artery injury; (C) shows the statistical chart of the neointimal area at 28 days after femoral artery injury.
[0016] Figure 5 To show the statistical chart of the inhibition of intimal hyperplasia after vascular injury after knocking out OVGP1. Among them, (A) shows the representative HE staining map of the femoral artery injury model of KO and WT mice at 28 days after knocking out OVGP1; (B) shows the ratio of intima to media thickness I / M; (C) shows the statistical chart of the neointimal area.
[0017] Figure 6 To show the results of proteomic sequencing of overexpressed OVGP1 in smooth muscle cells. Among them, (A) shows the results of heat map analysis; (B) shows the volcano plot; (C) shows the analysis chart of differential genes COG / KOG; (D) shows the KEGG pathway analysis chart; (E) shows the GO analysis chart.
[0018] Figure 7Proteomic sequencing results of overexpressed OVGP1 in endothelial cells. Among them, (A) is the result of heat map analysis; (B) is the volcano plot; (C) is the COG / KOG analysis chart of differential genes; (D) is the KEGG pathway analysis chart; (E) is the visualization heat map of fibrosis-related differential genes; (F) is the GO analysis chart.
[0019] Figure 8 Statistical chart of the effect of knocking down OVGP1 on smooth muscle proliferation. Among them, (A) is a representative picture of the effect of knocking down OVGP1 on cell morphology; (B) is the effect of knocking down OVGP1 on cell proliferation detected by CCK8.
[0020] Figure 9 Zymogram of MMP-2 activity detection after knocking down OVGP1.
[0021] Figure 10 Statistical chart of the situation of OVGP1 promoting smooth muscle cell phenotypic transformation. Among them, (A) is the detection of the expression changes of smooth muscle cell phenotypic transformation markers α-SMA, SMA22α, and OPN in overexpressed OVGP1 at the mRNA level; (B) is the detection of the efficiency of knocking down OVGP1 by siRNA at the mRNA level; (C) is the detection of the expression changes of smooth muscle cell phenotypic transformation markers α-SMA, SMA22α, and OPN and the phosphorylation levels of p-ERK and p-AKT by Western blot; (D) is the statistical chart of the protein expression changes of smooth muscle cell phenotypic transformation markers α-SMA, SMA22α, and OPN; (E) is the statistical chart of the phosphorylation levels of p-ERK and p-AKT.
[0022] Figure 11 Statistical chart of the situation of overexpressed OVGP1 promoting endothelial-mesenchymal transition. Among them, (A) is the establishment of an overexpressed OVGP1 cell model by adenovirus transfection and the expression level of OVGP1 mRNA; (B-C) are the statistical charts of the expression of OVGP1 and His protein levels (OVGP1 protein carries a His tag) and the relative protein expression levels detected by Western blot; (D-E) are the statistical charts of the expression of N-cadherin, α-SMA, E-cadherin, β-catenin, and ZO1 protein levels and the relative protein expression levels detected by Western blot; (F) is the detection of the mRNA levels of endothelial cell markers β-catenin and ZO1 by RT-PCR; (G) is the detection of the mRNA levels of mesenchymal cell markers α-SMA, Fibronectin, and Vimentin by RT-PCR.
[0023] Figure 12Statistical chart of the situation of knocking down OVGP1 to inhibit endothelial-mesenchymal transition. Among them, (A) is the establishment of a cell model with knocked-down OVGP1 through shRNA lentiviral transfection and the expression level of OVGP1 mRNA; (B-C) are statistical charts of the relative expression levels of OVGP1, CD31, α-SMA proteins and the relative phosphorylation level of p-ERK detected by Western blot. Detailed implementation manners
[0024] In order to make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.
[0025] The OVGP1 (Oviductal Glycoprotein 1) gene is a gene encoding oviduct-specific glycoprotein, which is mainly expressed in the oviduct epithelial cells of mammals and plays an important role in the reproductive process.
[0026] The chromosomal location of the OVGP1 gene (human) is: 1p13.2.
[0027] The solution of the present invention is based on the following important findings: First, the relationship between OVGP1 and intimal hyperplasia after vascular injury. It has been proved in clinical samples that the expression of OVGP1 is up-regulated in coronary heart disease specimens, and it has been proved in animal experiments that knocking out OVGP1 inhibits intimal hyperplasia after vascular injury, while overexpressing OVGP1 promotes intimal hyperplasia after vascular injury; Second, OVGP1 leads to intimal hyperplasia by regulating the phenotypic transformation of VSMCs; Third, the regulation of VSMC phenotypic transformation by OVGP1 is mediated by MMPs and ERK / AKT.
[0028] Therefore, by reducing the expression of OVGP1 in cells or tissues, the phenotypic transformation of smooth muscle cells can be inhibited, and the neointima formation of blood vessels can be effectively inhibited, which can be used for the prevention and / or treatment of diseases such as vascular stenosis, stenosis after stent implantation, and stenosis after intimal stripping.
[0029] Based on the above research, this embodiment provides an OVGP1 inhibitor for preparing a drug for preventing and / or treating intimal hyperplasia after vascular injury. The inhibitor is OVGP1-siRNA or OVGP1-shRNA that targets and knocks down the OVGP1 gene.
[0030] In the present invention, as an implementable manner, The sense strand sequence si-OVGP1-F1 of OVGP1-siRNA is: SEQ ID NO.1: 5'-CCUCAAGAUUCACCACUAUTT-3', The antisense strand sequence si-OVGP1-R1 is: SEQ ID NO.2: 3'-AUAGUGGUGAAUCUUGAGGTT-5'; As another implementable mode, The sense strand sequence si-OVGP1-F2 of OVGP1-siRNA is: SEQ ID NO.3: 5'-CCACACAUCGUCCAAACAUTT-3', The antisense strand sequence si-OVGP1-R2 is: SEQ ID NO.4: 3'-AUGUUUGGACGAUGUGUGGTT-5'.
[0031] In the present invention, as an implementable mode, The target sequence of OVGP1-shRNA is: SEQ ID NO.7: CCATAAACTCGTGTGTTATTT; As another implementable mode, The target sequence of OVGP1-shRNA is: SEQ ID NO.8: AGGGCAGACTATGCCTTTAAG; As another implementable mode, The target sequence of OVGP1-shRNA is: SEQ ID NO.9: CTTCTTATATCCTGGACTAAG.
[0032] The present invention also provides a pharmaceutical composition, comprising an inhibitor of OVGP1 and a pharmaceutically acceptable carrier. This pharmaceutical composition can be used for preventing and / or treating intimal hyperplasia after vascular injury.
[0033] In the present invention, the pharmaceutically acceptable carrier includes but is not limited to: water, saline, buffer solution, glycerol, ethanol, liposome, lipid, protein, protein-antibody conjugate, peptide substance, cellulose, nanogel, or a combination thereof. The selection of the carrier should match the pharmaceutical dosage form. The inhibitor of OVGP1 is OVGP1-siRNA or OVGP1-shRNA that targets and knocks down the OVGP1 gene.
[0034] In the following examples, the test methods or testing methods, unless otherwise specified, are all conventional methods; the reagents and materials, unless otherwise specified, are all obtained from conventional commercial channels or prepared by conventional methods.
[0035] To verify and support the technical solution of the present invention, the following test examples are provided for corroboration: Test Example 1: Determination of OVGP1 expression level in patients with coronary heart disease
[0036] 1.1 Detection samples: 44 patients clinically diagnosed with and confirmed by vascular ultrasound as having coronary atherosclerosis (AS) and 44 healthy controls were collected, and the ELISA technique was used to detect the expression changes of OVGP1 in plasma.
[0037] It should be noted that: For all the enrolled cases, the medical history was strictly inquired, and other disease histories were excluded. Clinical baseline data and other biochemical indexes were recorded, including total cholesterol, triglyceride, high-density lipoprotein, low-density lipoprotein, blood glucose and other indexes. The collection of all population samples followed ethics, was approved by the Ethics Committee of Xijing Hospital, and informed consent forms were signed.
[0038] 1.2 ELISA experimental procedure: The human OVGP1 ELISA kit (Life Span BioScience, lnc., No.LS-F20566-1) was used according to the operation instructions.
[0039] ①Dilute the standard product according to the concentration gradient.
[0040] ②Add 100 μL of the standard product, plasma (undiluted), and blank control (sample diluent) to a 96-well plate pre-coated with antibodies, and incubate at 37°C for 2 h.
[0041] ③Discard the liquid, and add 100 μL of Detection Reagent A to each well, and incubate at 37°C for 1 h.
[0042] ④Discard the liquid, and add 350 μL of 1×Wash buffer and wash 3 times.
[0043] ⑤Add 100 μL of Detection Reagent B to each well, and incubate at 37°C for 1 h.
[0044] ⑥Discard the liquid, and add 350 μL of 1×Wash buffer and wash 5 times.
[0045] ⑦Add 90 μL of TMB solution to each well, and incubate at 37°C for 20 min.
[0046] ⑧Add 50 μL of Stop Solution to each well.
[0047] ⑨Measure the absorbance value at 450 nm.
[0048] 1.3. Detection results: The results are as Figure 1 shown. Compared with the control group, OVGP1 is significantly elevated in the plasma of AS patients.
[0049] Experimental example 2: Determination of the expression level of OVGP1 in AS model mice.
[0050] 2.1. Determination method: Purchase 8-month-old ApoE - / - mice and feed them a high-fat diet for 4 months. After harvesting, isolate the aorta. After HE staining, confirm that the mice have developed plaque lesions. Further, detect the expression of OVGP1 in the vascular tissues of AS model mice and control group mice by immunofluorescence staining.
[0051] 2.2. Determination results: The results are as Figure 2 shown. ( Figure 2 In it, OVGP1 is co-stained with α-SMA. Red represents α-SMA, green represents OVGP1, and blue represents DAPI nuclear staining. The scale bar is 50 μm). Compared with the blood vessels of the control group, the expression of OVGP1 is up-regulated in the plaque tissues of mice, and the plaque mainly contains proliferated smooth muscle cells.
[0052] Experimental example 3: Determination of the expression level of OVGP1 in mice with femoral artery wire injury.
[0053] 3.1. Experimental preparation: 1) Construction of the mouse femoral artery wire injury model: Anesthetize the mice with 3% isoflurane (1 L / min) and depilate the legs. Incise along one side of the groin, bluntly separate the muscles, expose the femoral artery, and gently separate the accompanying nerves and veins from the femoral artery. Ligate the proximal and distal ends of the femoral artery with 5-0 silk thread to temporarily control the blood flow. Separate the small branches between the vastus medialis and rectus femoris muscles. Make a small transverse incision in the small artery in this branch and insert a straight metal wire (diameter 0.38 mm, C-SF-15-15, COOK, Bloomington, IN, USA) into the femoral artery, with a length greater than 5 mm. After successful insertion, keep the metal wire in place for 3 minutes to exfoliate and dilate the artery. Remove the metal wire, ligate the distal silk thread of the branch artery, and restore the blood flow of the femoral artery by releasing the proximal and distal ends of the femur. Suture the skin incision with surgical 5-0 silk thread. Observe whether there are any abnormalities in each group of mice and continue to raise them after they wake up.
[0054] 2) Collection of mouse femoral artery On the 28th day after the operation of the model mice, anesthetize the mice and perfuse them with PBS through the left ventricle, and then perfuse and fix them with 4% paraformaldehyde. Cut open the groin skin, cut off the femoral artery and its surrounding muscle tissues together, cut off the damaged blood vessels as much as possible, place them in 4% paraformaldehyde, and keep them at 4°C overnight. Then dehydrate, embed in paraffin, and section.
[0055] 3) Pathological staining of the femoral artery of mice For histological analysis, the injured artery was cut into cross-sections (5 μm thick), stained with HE, and images were captured using an inverted microscope (DM6000B; Leica) to observe the proliferation and repair of the intima.
[0056] 3.2. Detection method: 3.2.1. According to the mouse femoral artery wire injury model constructed above, immunofluorescence staining was used to detect the expression changes of OVGP1 in the 28-day vascular injury model.
[0057] 3.2.2. Experimental steps for EVG staining: ① Deparaffinization and hydration: The paraffin sections were successively immersed in xylene I and xylene II (10 minutes each) for deparaffinization. Hydration was carried out with gradient ethanol (100% → 95% → 80% → 70%), 2 minutes for each grade. Rinse with distilled water for 1 minute.
[0058] ② Hematoxylin staining (nucleus): Immerse in Harris hematoxylin stain for 3 minutes; rinse with running water and blue back for 10 minutes until the sections turn blue.
[0059] ③ Elastic fiber staining (Weigert resorcin fuchsin): Immerse the sections in Weigert resorcin fuchsin stain at room temperature for 30 minutes. Rinse with running water to remove excess stain, and observe under the microscope that the elastic fibers are dark blue to black.
[0060] ④ Differentiation treatment: Differentiate with 1% hydrochloric acid alcohol for several seconds to remove the background color, and immediately rinse with running water to terminate the reaction.
[0061] ⑤ Collagen fiber staining (Van Gieson solution): Drop Van Gieson stain to cover the tissue and stain for 2 minutes. Rinse with running water for 10 seconds to remove the floating color.
[0062] ⑥ Dehydration and clearing: Rapid dehydration with gradient ethanol (95% → 100% ethanol, 10 seconds each). Clear with xylene twice, 2 minutes each time.
[0063] ⑦ Sealing: Seal with neutral balsam and observe under the microscope. The elastic fibers are blue-black or black, the collagen fibers are red, the muscle fibers / cytoplasm are yellow, and the nuclei are blue.
[0064] 3.3. Measurement results: The results of immunohistochemical staining are as Figure 3 (A) shown, and the expression of OVGP1 increased significantly after vascular injury; The results of the EVG staining experiment are as Figure 3 (B) shown, and EVG staining showed that the main cells in the neointima were smooth muscle cells.
[0065] Experimental Example 4: Determination of the effect of overexpression of OVGP1 and knockout of OVGP1 on intimal hyperplasia after vascular injury.
[0066] 4.1 Determination method: Select femoral artery pathological sections for HE staining, and calculate the area of the neointima and the ratio of intima to media thickness (I / M) according to Image J (NIH) software. Select five independent cross-sections of each blood vessel to obtain the average value.
[0067] 4.2 Determination results: The results are as Figure 4 、 Figure 5 shown.
[0068] Figure 4 In, (A) is a representative HE staining map of the femoral artery injury model of TG and NTG mice at 28 days when OVGP1 is overexpressed; (B) is a statistical chart of I / M at 28 days after femoral artery injury; (C) is a statistical chart of the neointimal area at 28 days after femoral artery injury. The results show that compared with the WT group, the I / M and the area of the neointima of the 28-day model of TG group mice are both significantly increased, indicating that overexpression of OVGP1 promotes the formation of neointima after vascular injury.
[0069] Figure 5 In, (A) is a representative HE staining map of the femoral artery injury model of KO and WT mice at 28 days after knocking out OVGP1; (B) is the ratio of intima to media thickness I / M; (C) is a statistical chart of the neointimal area. The results show that knocking out OVGP1 significantly inhibits intimal hyperplasia after vascular injury.
[0070] Experimental Example 5: Proteomic sequencing of overexpressed OVGP1 in smooth muscle cells / endothelium.
[0071] 5.1 Sequencing steps: ① Cell culture: Human aortic smooth muscle cells (HASMC, catalog No. 354-05a) and smooth muscle cell medium (catalog No. 311-500) were purchased from Cell Applications (San Diego, CA). Human umbilical vein endothelial cells (HUVEC) and endothelial cell medium (catalog No. 1001) were purchased from Science Cell. Before cell resuscitation, culture dishes were coated with polylysine (2 μg / cm2) overnight, washed 3 times with PBS the next day, and the cells were resuscitated without centrifugation. Fresh medium was changed on the second day. The cells were cultured in a humidified incubator at 37°C and 5% CO2. Cells at passages 3-6 were used for experimental studies.
[0072] Adenoviruses Ad-OVGP1-His and Ad-GFP (control group) were synthesized by GeneChem (Shanghai, China) for overexpression transfection of OVGP1. HASMC / HUVEC were seeded into 6-well plates with 2 mL of medium. After adherence, 2 μL of recombinant adenovirus per well (titer 109 TU / mL) was added. The medium was changed 6-8 h later, and the cells were continuously infected for 48 h, then digested with trypsin, centrifuged at 1000 rpm for 5 min, and the cells were collected for experiments.
[0073] ② Protein extraction Samples were taken out from -80°C. Four volumes of lysis buffer (8 M urea, 1% protease inhibitor) were added to each group of samples, and the samples were lysed by sonication. Centrifugation was performed at 12,000 g for 10 min at 4°C to remove cell debris. The supernatant was transferred to a new centrifuge tube, and the protein concentration was measured using a BCA kit.
[0074] ③ Trypsin digestion Equal amounts of protein from each sample were digested. The volume was adjusted to the same with lysis buffer, then dithiothreitol (DTT) was added to a final concentration of 5 mM, and the mixture was reduced at 56°C for 30 min. Then iodoacetamide (IAA) was added to a final concentration of 11 mM, and the mixture was incubated in the dark at room temperature for 15 min. TEAB was added to dilute urea to ensure the concentration was below 2 M. Trypsin was added at a ratio of 1:50 (protease:protein, m / m), and digestion was carried out overnight. Then trypsin was added at a ratio of 1:100 (protease:protein, m / m), and digestion continued for 4 h.
[0075] ④ Liquid chromatography-mass spectrometry analysis The peptide segments were dissolved in mobile phase A of liquid chromatography and separated using a Vanquish Neo ultra-high performance liquid system. Mobile phase A was an aqueous solution containing 0.1% formic acid and 2% acetonitrile; mobile phase B was an aqueous solution containing 0.1% formic acid and 90% acetonitrile. The liquid phase gradient was set as follows: 0 - 22.5 min, 6% - 22% B; 22.5 - 26.5 min, 22% - 34% B; 26.5 - 28.5 min, 34% - 80% B; 28.5 - 30 min, 80% B, and the flow rate was maintained at 700 nl / min. After being separated by the ultra-high performance liquid system, the peptide segments were injected into the NSI ion source for ionization and then entered the Orbitrap Exploris 480 mass spectrometer for analysis. The ion source voltage was set to 2300 V, the FAIMS compensation voltage (CV) was set to -45 V, and both the peptide segment precursor ions and their secondary fragments were detected and analyzed using the high-resolution Orbitrap. The primary mass spectrometry scan range was set to 350 - 1400 m / z, and the scan resolution was set to 60000; the starting point of the secondary mass spectrometry scan range was fixed at 120 m / z, and the secondary scan resolution was set to 15000. The data acquisition mode used the data-independent scanning (DIA) program, that is, after the primary scan, the peptide segment ions in multiple consecutive m / z windows entered the HCD collision cell and were fragmented using 27% fragmentation energy, and the secondary mass spectrometry analysis was carried out in sequence. To improve the effective utilization rate of the mass spectrometer, the automatic gain control (AGC) was set to 1E6, and the maximum injection time was set to 22 ms.
[0076] ⑤ Data analysis Based on the Raw files obtained from mass spectrometry detection, 1) construct a sample-specific protein database according to the source of the samples, and then use analysis software for database search; 2) perform quality control analysis at the peptide segment and protein levels based on the results of database search; 3) perform protein quantitative analysis, including quantitative distribution and repeatability analysis, and at the same time display the distribution results of sample quantitative intensity values; 4) perform common functional annotations on the identified proteins, including GO, KEGG, Protein domain, COG / KOG, STRING database, Reactome, WikiPathways, HallMark, and transcription factor (Transcription factor, TF) annotations, etc., where Reactome, WikiPathways, HallMark, and transcription factors only provide relevant bioinformatics analysis for some species; 5) calculate the fold change (FC) and T-test significant P value between two groups according to the quantitative results, perform differential screening according to the set threshold, draw relevant statistical charts for differential analysis. If there are 3 or more Meanwhile, one-way analysis of variance (ANOVA) was performed to calculate the significant P value for multiple groups. Based on the ANOVA P value, differential proteins among multiple groups were screened for subsequent related analyses. 6) Functional classification and statistical analysis were conducted on the differential proteins between two groups, including GO secondary classification, subcellular localization classification, COG / KOG classification, and KEGG pathway classification and statistics. 7) Fisher's exact test was used to perform enrichment analysis on the differential proteins between two groups, and the functions involved were GO, KEGG, Protein domain, Reactome, and WikiPathways. 8) When there are multiple experimental groups in the project, functional connections of differential proteins under different experimental conditions were compared through enrichment clustering analysis. 9) Through protein-protein interaction (PPI) network analysis, key regulatory proteins under specific experimental conditions were screened out.
[0077] 5.2. Sequencing results: The proteomic sequencing results of overexpressing OVGP1 in smooth muscle cells are as Figure 6 shown.
[0078] Among them, Figure 6 (A) is the result of heat map analysis, Figure 6 (B) is the volcano plot. Through proteomic analysis of HASMC overexpressing OVGP1, as Figure 6 shown in (A) Figure 6 and (B), a total of 107 differentially expressed proteins (FoldChange ≥ 1.5 and P value < 0.05) were identified, among which 50 proteins were up-regulated and 57 proteins were down-regulated. Figure 6 (C) is the COG / KOG analysis chart of differential genes. Through COG / KOG functional annotation, it was found that these differentially expressed proteins are involved in various cellular functions, including signal transduction, cytoskeleton, etc. Figure 6 (D) is the KEGG pathway analysis chart, Figure 6 (E) is the GO analysis chart. Through GO and KEGG functional classification, it is shown that these differential proteins are involved in functional pathways such as cell growth and death, cell motility, signal transduction, etc.
[0079] The proteomic sequencing results of overexpressing OVGP1 in endothelial cells are as Figure 7 shown.
[0080] Overexpression of OVGP1 in human umbilical vein endothelial cells (HUVEC) and further proteomic analysis revealed 1,105 differentially expressed proteins (523 up-regulated and 582 down-regulated) (seeFigure 7 (A), Figure 7 (B)); It involves signal transduction, cytoskeleton, vesicle trafficking, and ECM receptor interaction pathways. Further analysis found that after overexpression of OVGP1, significant changes occurred in EndMT-related indicators such as E-cadherin, β-catenin, ZO-1, N-cadherin, and α-SMA (see specifically Figure 7 (C), Figure 7 (D), Figure 7 (E), Figure 7 (F)).
[0081] Among them, Figure 7 (A) is the result of heatmap analysis, Figure 7 (B) is the volcano plot, Figure 7 (C) is the analysis chart of differential genes COG / KOG, Figure 7 (D) is the KEGG pathway analysis chart, Figure 7 (E) is the visualization heatmap of fibrosis-related differential genes, Figure 7 (F) is the GO analysis chart.
[0082] Experimental Example 6: Cell proliferation experiment.
[0083] 6.1 Experimental materials: The siRNA used in the experiment was synthesized by GenePharma (Suzhou, Jiangsu). The siRNA sequences used are shown in Table 1.
[0084] Table 1: siRNA sequences Among them, Scrambled-F and Scrambled-R are the sequences of the universal control group.
[0085] 6.2 Experimental method: The cells were seeded into 6-well plates. When the confluence reached 60 - 70%, siRNA was transfected. The transfection system is shown in Table 2. Prepare siRNA with a concentration of 20 μM, and use Lipofectamine RNAi-MAX (#13778150, Invitrogen) to transfect the cells with siRNA for 48 h, and each group was set with multiple replicates.
[0086] Table 2: Transfection system Add 1900 μL of fresh medium + 100 μL of the above system to each well of the 6-well plate. After 48 hours, the cells were harvested, and the knockout efficiency was detected by qPCR and Western blotting.
[0087] ① Transfect si-OVGP1 and control group virus in 6-well plates, with 3 replicate wells in each group. After culturing in an incubator at 37 °C and 5% CO2 for 48 hours, stimulate with PDGF-BB for 24 h and culture in serum-free medium.
[0088] ② After digesting the cells with trypsin, count the cells and prepare cell suspensions with the same concentration.
[0089] ③ Add 100 μL of cell suspension into 96-well plates, with 5 replicate wells in each well, and culture in an incubator for 24 hours.
[0090] ④ After the cells adhere, add 10 μL of CCK8 reagent to each well and culture in an incubator at 37 °C and 5% CO2 for 30 min.
[0091] ⑤ Measure the absorbance value at 450 nm on an enzyme-linked immunosorbent assay (ELISA) reader.
[0092] ⑥ Calculate the cell viability.
[0093] 6.3 Experimental results: The CCK8 method was used to detect the effect of knocking down OVGP1 on cell proliferation. The results are as Figure 8 shown, Figure 8 (A) is a representative picture of the effect of knocking down OVGP1 on cell morphology; Figure 8 (B) shows the effect of knocking down OVGP1 on cell proliferation detected by CCK8. The results show that compared with the control group, after induction with PDGF-BB, the cell proliferation viability was significantly enhanced (P<0.05), while knocking down OVGP1 significantly inhibited the cell proliferation induced by PDGF-BB.
[0094] Test example 7: Zymography experiment.
[0095] 7.1 Experimental method: ① Prepare the sample: Centrifuge the cell supernatant at 12,000 rpm for 5 minutes to remove impurities.
[0096] ② Prepare the zymography gel: Dissolve gelatin in distilled water at 60 °C. Mix the separating gel components in proportion, add gelatin and mix well, add APS and TEMED, pour the gel and cover it with a water layer, let it stand for polymerization, prepare the stacking gel and insert the comb.
[0097] ③ Electrophoresis: Mix the sample with non-reducing loading buffer. The loading volume per well: 20 μg of protein. Set positive control and molecular weight marker. The electrophoresis conditions are in a low-temperature environment, 80 V for about 30 minutes for the stacking gel; 120 V for about 90 minutes for the separating gel.
[0098] ④ Renaturation of the gel and enzymatic reaction: Washing to remove SDS: After electrophoresis, immerse the gel in a 2.5% Triton X-100 solution and gently shake on a shaker at room temperature for 2 × 30 minutes to remove SDS and renature the protease. Wash the gel twice with the reaction buffer, 10 minutes each time. Immerse the gel in fresh reaction buffer and incubate at 37°C for 12 hours.
[0099] ⑤ Staining and decolorization: Immerse the gel in a 0.5% Coomassie Brilliant Blue R-250 staining solution (dissolved in 30% methanol, 10% acetic acid) and stain on a shaker at room temperature for 2 hours. Replace with the decolorizing solution (30% methanol, 10% acetic acid) and decolorize on the shaker until the background is transparent and the bands are clear.
[0100] 7.2 Experimental results: The results are as Figure 9 shown. The gelatin degradation area shows transparent bands, the non-degraded area is a blue background, and the intensity of the bands is proportional to the activity of MMP-2. It indicates that the activity of MMP-2 is significantly reduced after knocking down OVGP1.
[0101] Test Example 8: Verification of the promotion of smooth muscle cell phenotypic transformation by OVGP1.
[0102] As Figure 10 shown, for the verification of VSMC phenotypic transformation markers, it was found that overexpression of OVGP1 decreased the expression of the VSMC contractile markers α-SMA and SM22α and increased the expression of the secretory marker OPN at the mRNA level (see Figure 10 (A)), indicating that overexpression of OVGP1 promotes VSMC phenotypic transformation; Further knocking down OVGP1, the efficiency of knocking down OVGP1 by siRNA was detected at the mRNA level, and it was observed that OVGP1 was successfully knocked down (see Figure 10 (B)); The changes in the expression of the VSMC phenotypic transformation markers α-SMA, SMA22α, OPN and the phosphorylation levels of p-ERK and p-AKT were detected by Western blot in the smooth muscle cells with knocked-down OVGP1, as shown in Figure 10 (C); Further detecting the VSMC phenotypic transformation markers at the protein level, it was found that knocking down OVGP1 promoted the transformation of VSMC towards the contractile type and activated the p-ERK and p-AKT pathways (see Figure 10 (D), Figure 10 (E)); The results indicate that OVGP1 promotes VSMC phenotypic transformation.
[0103] Test Example 9: Verification of the promotion of endothelial-mesenchymal transition by overexpressing OVGP1.
[0104] We verified these genes by RT-PCR and Western blot. As Figure 11 shown, Figure 11 (A) shows the expression level of OVGP1 mRNA in the overexpression OVGP1 cell model established by adenovirus transfection. Figure 11 (B-C) show the expression of OVGP1 and His protein levels detected by Western blot (the OVGP1 protein carries a His tag) and the relative protein expression levels. Figure 11 (D-E) are statistical graphs showing the expression of N-cadherin, α-SMA, E-cadherin, β-catenin, and ZO1 protein levels detected by Western blot and the relative protein expression levels. Figure 11 (F) shows the mRNA levels of the endothelial cell markers β-catenin and ZO1 detected by RT-PCR. Figure 11 (G) shows the mRNA levels of the mesenchymal cell markers α-SMA, Fibronectin, and Vimentin detected by RT-PCR. The data in the figure are expressed as mean ± standard deviation.
[0105] The results showed that after overexpressing OVGP1, the expression levels of the endothelial-like markers E-cadherin, β-catenin, and ZO-1 decreased in HUVEC cells, while the expression levels of the mesenchymal-like markers N-cadherin and α-SMA increased, which was consistent with the RT-PCR results. This indicates that overexpressing OVGP1 promotes EndMT in HUVEC.
[0106] Experimental Example 10: Verification of the inhibition of endothelial-mesenchymal transition by knocking down OVGP1.
[0107] shRNA lentiviral transfection system: The shRNA lentivirus was commissioned to GeneChem (Shanghai, China) for synthesis and used to transfect and knock down OVGP1.
[0108] The sequences of the shRNA lentivirus are shown in Table 3 below.
[0109] Table 3: shRNA sequences Among them, the transcriptional product sequence structure of OVGP1-Homo-77 is as follows: The transcriptional product sequence structure of OVGP1-Homo-1772 is as follows: The transcriptional product sequence structure of OVGP1-Homo-431 is as follows: HUVECs were seeded into 6-well plates, and 2 mL of culture medium was added. When the confluence rate of adherent growth reached about 40%, 10 μL of recombinant lentivirus per well (titer: 10 8 TU / mL) was added. The medium was changed after 24 h, and the infection continued for 72 h. The cells were digested with trypsin, centrifuged at 1000 rpm for 5 min, and the cells were collected for experiments.
[0110] The results are as Figure 12 shown. Figure 12 (A) shows the expression level of OVGP1 mRNA in the knockdown OVGP1 cell model established by shRNA lentiviral transfection. Figure 12 (B) shows the relative expression levels of OVGP1, CD31, and α-SMA proteins detected by Western blot. Figure 12 (C) is a statistical chart of the relative expression level of p-ERK phosphorylation.
[0111] It was found that after knocking down OVGP1, the expression of CD31 increased, the expression level of α-SMA decreased, and p-ERK / ERK decreased, significantly reversing the EndMT process. It indicates that knocking down OVGP1 inhibits endothelial-mesenchymal transition.
[0112] As described above, it is only a preferred specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed by the present invention should be covered by the protection scope of the present invention. Therefore, the protection scope of the present invention should be subject to the protection scope of the claims.
Claims
1. An OVGP1 inhibitor for preparing a drug for preventing and / or treating intimal hyperplasia after vascular injury, characterized in that, The OVGP1 inhibitor is OVGP1-siRNA or OVGP1-shRNA that targets and knocks down the OVGP1 gene.
2. The inhibitor according to claim 1, wherein The sense strand sequence si-OVGP1-F1 of the OVGP1-siRNA is as shown in SEQ ID NO.1, and the antisense strand sequence si-OVGP1-R1 is as shown in SEQ ID NO.2, or the sense strand sequence si-OVGP1-F2 of the OVGP1-siRNA is as shown in SEQ ID NO.3, and the antisense strand sequence si-OVGP1-R2 is as shown in SEQ ID NO.
4.
3. The inhibitor according to claim 1, wherein The target sequence of the OVGP1-shRNA is as shown in SEQ ID NO.7, or as shown in SEQ ID NO.8, or as shown in SEQ ID NO.
9.
4. A pharmaceutical composition, characterized in that, An inhibitor of OVGP1 as claimed in claim 1, and a pharmaceutically acceptable carrier.