Coupling preparation of oncolytic virus and protein degradation targeted chimera prodrug as well as preparation method and application of coupling preparation
By coupling the PROTAC prodrug targeted degradation of BRD4 with oncolytic adenovirus to form a coupling preparation, the problems of insufficient immune response of oncolytic virus therapy and low PROTAC drug uptake efficiency are solved, efficient targeted treatment and immune activation of tumor cells are achieved, and anti-tumor effect is significantly enhanced.
Patent Information
- Application Number
- CN202510467407.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-15
- Publication Date
- 2025-07-11
AI Technical Summary
The existing oncolytic virus therapy has limited effect when activates the immune response. The PROTAC drug is insufficient in the uptake of target cells and may lead to off-target effects, affecting the tumor treatment effect.
The PROTAC prodrug targeting degradation of BRD4 is coupled to the surface of oncolytic adenovirus to form a coupling preparation, which enhances the infection and selectivity of the virus to tumor cells, promotes the degradation of BRD4 protein, activates the anti-tumor immune response, and can be used in combination with immune checkpoint inhibitors.
It significantly enhances the targeted therapeutic effect on tumor cells, promotes the secretion of type I interferon and the maturation of dendritic cells, improves the anti-tumor immune response, and improves the effectiveness and safety of treatment.
Smart Images

Figure CN120285024A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of nanopharmaceuticals, and particularly relates to a conjugate preparation of an oncolytic virus (OVs) and a proteolysis targeting chimera (PROTAC) prodrug, and a preparation method and application thereof, and more particularly relates to a conjugate preparation of an oncolytic adenovirus (AD) and a PROTAC prodrug targeting the degradation of bromodomain and extra terminal domain 4 (BRD4), and a preparation method and application thereof. Background Art
[0002] Globally, the incidence and mortality of cancer are still rising rapidly. In current clinical practice, early-stage tumors are treated by surgery, while advanced-stage tumors are treated by radiotherapy, chemotherapy, and immunotherapy. Whether it is intensity-modulated radiotherapy, small-molecule chemotherapy drugs, or immune-related checkpoint inhibitors, there are problems such as large toxic side effects, low specificity, and multi-drug resistance. Oncolytic virus (OV) immunotherapy is a new method for treating cancer that selectively destroys tumor tissue without overly harming normal non-cancerous cells. Currently, several OV drugs have been approved for market. In 2003, the adenovirus modified with the P53 gene (Gendicine, China) was the first OV product approved for market. Talimogene laherparepvec (T-VEC) is a genetically modified herpes simplex virus type 1 (HSV-1) that can replicate in tumor cells and express the immune-activating protein granulocyte-macrophage colony-stimulating factor (GM-CSF). In 2015, the US Food and Drug Administration (FDA) and the European Medicines Agency (EMA) approved T-VEC for the treatment of advanced melanoma. In addition, RIGVIR (an anti-cancer drug based on oncolytic virus technology, which is transformed from the non-pathogenic ECHO-7 enterovirus and was first approved for the treatment of melanoma in Latvia in 2004) is also sold in Latvia, Georgia, and Armenia. All of these OV drugs are injected intratumorally and are targeted at patients with refractory malignant tumors resistant to second-line or even third-line treatment regimens. In recent years, due to the good safety of OVs in clinical practice, a large number of OV clinical trials have been carried out. From 2000 to 2020, 97 clinical trials using OVs have been conducted, but the results show that OVs are not significantly effective against solid tumors.
[0003] The antitumor activity of OVs is usually mediated by two mechanisms: First, OVs can induce tumor cell lysis; Second, after OVs lyse tumor cells, specific tumor-associated antigens are released, promoting T cell recognition of tumor antigens and thus establishing tumor-specific T cell immunity. Most OVs entering clinical trials and those currently in clinical trials have been genetically modified to locally release co-stimulatory molecules, chemokines, cytokines, and immune checkpoint inhibitors to enhance the therapeutic effect of OVs. OVs have the potential to induce immunogenic cell death, leading to the release of tumor antigens, danger-associated molecular patterns, and type I interferons. These immunogenic substances, especially tumor antigens, can activate systemic tumor-specific immune responses, resulting in the regression of distant or uninfected tumors. However, the activated immune response is often limited and insufficient to effectively attack tumors, which may be due to the low activation level of antigen-presenting cells and the failure to effectively and continuously activate the adaptive immune response. Therefore, improving the efficacy of OVs is an urgent clinical need.
[0004] PROTACs are a new class of small molecule drugs with the ability to selectively degrade disease (such as cancer)-related proteins through the endogenous pathway in cells, showing potential in the treatment of various cancers. For example, the patent document CN119661657A discloses that a PROTAC drug targeting BRCA2 can provide a new treatment strategy for prostate cancer treatment; the patent document CN119504710A discloses a series of PROTAC degrading compounds targeting PRMT5, which can effectively induce the degradation of PRMT5 and significantly inhibit the proliferation, growth, migration, invasion, colony formation, and metastasis of tumor cells, promote the apoptosis of cancer cells, promote autophagy of tumor cells, prevent or overcome resistance to BTK inhibitors, and / or extend the survival period of cancer patients; the patent document CN115894439A discloses a PROTAC chimera targeting the degradation of GPX4, which can bind to the GPX4 protein and induce effective degradation, effectively downregulate the level of GPX4 protein, and cause ferroptosis; the patent document CN119119002A discloses a PROTAC compound targeting the degradation of ALK protein, which can effectively solve the problem that existing small molecule inhibitors cannot degrade the ALK protein, and this compound can inhibit the proliferation of ALK drug-resistant mutant cell lines. However, the clinical translation of PROTACs into an effective cancer treatment modality still faces some challenges. A major challenge in PROTAC development lies in insufficient uptake by target cells and its potential off-target effects. Achieving good therapeutic effects largely depends on efficiently delivering these molecules into target cells while minimizing off-target effects on healthy tissues. Another key consideration lies in the impact of PROTACs on the antitumor immune response. Recent evidence suggests that PROTAC-induced protein degradation may affect the presentation of tumor-associated antigens and impair the generation of an effective immune response against tumors, which has raised concerns about the potential immunosuppressive effects of PROTACs.
[0005] Therefore, there is an urgent need in the art for more effective tumor treatment strategies. Summary of the Invention
[0006] In view of the deficiencies of PROTAC drugs themselves and the fact that the immune responses activated by OVs themselves are often limited and insufficient to effectively attack tumors, the present invention provides a conjugate preparation of an oncolytic virus (especially oncolytic adenovirus) and a PROTAC prodrug, and its preparation method and application. The present invention can connect a PROTAC prodrug to the surface groups of an oncolytic virus while not affecting or even enhancing the infectivity of the oncolytic virus itself, thereby achieving the synergistic effect of the oncolytic virus and PROTAC and significantly enhancing the anti-tumor effect. The present invention effectively solves the three main challenges encountered in the clinical transformation of PROTAC: limited cellular uptake efficiency, off-target effects, and insufficient immune responses, paves the way for the design of bioconjugated PROTACs, and provides a new method for the combination of oncolytic viruses and PROTACs. Moreover, the present invention also has the characteristics of good biocompatibility, strong stability, high safety, high bioavailability, etc.
[0007] The present invention is mainly achieved through the following technical solutions.
[0008] In a first aspect, the present invention provides a conjugate preparation, which comprises an oncolytic virus and a proteolysis-targeting chimera prodrug linked to the surface of the oncolytic virus.
[0009] In some embodiments, the proteolysis-targeting chimera prodrug is a prodrug of a proteolysis-targeting chimera that targets the degradation of BRD4 (which is a protein that plays a key role in epigenetic regulation and plays a key role in tumorigenesis, metastasis, and drug resistance, such as hematological malignancies (such as acute myeloid leukemia, multiple myeloma, etc.) and solid tumors (such as melanoma, breast cancer, liver cancer, neuroblastoma, etc.)), and is linked to the surface of the oncolytic virus.
[0010] In some embodiments, the prodrug of the proteolysis-targeting chimera that targets the degradation of BRD4 has the following structure of formula (I):
[0011]
[0012] In formula (I):
[0013] R 1 -R 7 Each independently selected from -H, C l-5 alkyl;
[0014] R 8 Selected from F, Cl, Br, and I;
[0015] L is selected from -(CH2CH2O) m CH2-, -CH2CH2OCH2CH2CH2OCH2-, and -CH2(CH2OCH2) m CH2-, where m is an integer from 1 to 10;
[0016] n is an integer from 1 to 10.
[0017] In some embodiments, the prodrug of the proteolysis-targeting chimera for targeted degradation of BRD4 has the following structure shown in formula (I-1), (I-2), (I-3), or (I-4):
[0018]
[0019]
[0020] In some embodiments, the oncolytic virus is oncolytic adenovirus Ad5.
[0021] In some embodiments, the particle size of the conjugate preparation is 106 - 108 nm, the polydispersity index PDI is 0.11 - 0.13, and the zeta potential is -25 mV to -29 mV.
[0022] In a second aspect, the present invention provides a method for preparing a conjugate preparation, which includes the following steps:
[0023] 1) Mix the oncolytic virus with a solution of the proteolysis-targeting chimera prodrug to obtain a first mixture;
[0024] 2) Subject the first mixture to ultrasonic treatment in an ice bath to obtain a second mixture;
[0025] 3) Remove the excess prodrug in the second mixture to obtain the conjugate preparation.
[0026] In some embodiments, in step 1), the proteolysis-targeting chimera prodrug and the oncolytic virus are mixed at a ratio of 0.8 - 1.33×10 -9 nmol / VP.
[0027] In some embodiments, in step 2), the temperature of the ice bath can be 2 - 5 °C.
[0028] In some embodiments, in step 2), the power of the ultrasonic treatment can be 200 - 300 W.
[0029] In some embodiments, in step 2), the time of the ultrasonic treatment can be 20 - 40 min.
[0030] In some embodiments, in step 3), the excess prodrug in the second mixture can be removed by a HiTrap desalting column.
[0031] In a third aspect, the present invention provides a composition comprising the conjugate preparation provided in the first aspect of the present invention and an immune checkpoint inhibitor. Optionally, the immune checkpoint inhibitor is αPD-1.
[0032] In a fourth aspect, the present invention provides the use of the conjugate preparation provided in the first aspect of the present invention or the composition provided in the third aspect of the present invention in the preparation of a drug for targeted anti-tumor. The tumor can be a tumor related to the BRD4 protein, such as hematological tumors (such as acute myeloid leukemia, multiple myeloma, etc.) and solid tumors (such as melanoma, breast cancer, liver cancer, neuroblastoma, etc.).
[0033] In a fifth aspect, the present invention provides the use of the conjugate preparation provided in the first aspect of the present invention or the composition provided in the third aspect of the present invention in the preparation of a drug for activating the cGAS-STING pathway of tumor cells in vitro and / or in vivo.
[0034] In a sixth aspect, the present invention provides the use of the conjugate preparation provided in the first aspect of the present invention or the composition provided in the third aspect of the present invention in the preparation of a drug for enhancing the maturation of dendritic cells.
[0035] In a seventh aspect, the present invention provides the use of the conjugate preparation provided in the first aspect of the present invention or the composition provided in the third aspect of the present invention in the preparation of a drug for activating anti-tumor immunity in vivo.
[0036] Compared with the prior art, the present invention has the following beneficial effects: Oncolytic viruses (OVs) are a novel immunotherapy, but the in-situ killing and anti-tumor immunity mediated by them usually cannot produce lasting effects on solid tumors. In preclinical studies and clinical trials, there are generally two methods to improve the anti-tumor efficacy of OVs. First, non-essential viral genes are deleted to enhance virus replication in tumor cells and reduce virus pathogenicity; then, OVs are equipped with co-stimulatory molecules, chemokines, cytokines, and immune checkpoint inhibitors to release the immunosuppressive microenvironment around the tumor. Herein, the present invention provides a conjugate preparation of OVs and PROTAC prodrugs, which conjugates the PROTAC prodrug (pmMZ1) targeting the degradation of BRD4 to the surface of oncolytic adenovirus (Ad5), and the conjugation of pmMZ1 does not affect or even significantly improves the infectivity of the oncolytic adenovirus itself. The highly efficient and highly specific infection of Ad5 on tumor cells enhances the cellular uptake and targeted delivery of PROTAC to the tumor, thereby enhancing the targeted therapeutic effect. After infection, the prodrug pmMZ1 is released from the surface of Ad5 and is converted from the prodrug to mMZ1 to degrade the BRD4 protein. In addition, the selective replication of Ad5 in tumor cells synergizes with the degradation of BRD4, and also significantly promotes the secretion of type I interferon, thereby promoting the maturation of dendritic cells and promoting the anti-tumor immune response. And the conjugate preparation provided by the present invention can also be combined with the immune checkpoint inhibitor αPD-1 for tumor treatment to further enhance the anti-tumor effect. Description of the Drawings
[0037] Figure 1 : a is the in vitro release curve of the conversion of pmMZ1 to mMZ1 in Example 1; b is the in vitro release detection result of the conversion of pmMZ1 to mMZ1 in Example 1.
[0038] Figure 2 is the Western-blot result of the degradation effect of mMZ1 on BRD4 in Example 2.
[0039] Figure 3 : a is the transmission electron microscopy and particle size characterization results of Ad5 in Example 1, and the scales are 100 nm (low magnification) and 50 nm (high magnification) respectively; b is the transmission electron microscopy and particle size characterization results of BPAD in Example 1, and the scales are 100 nm (low magnification) and 50 nm (high magnification) respectively.
[0040] Figure 4 : a is the average particle size results of Ad5 and BPAD in Example 1; b is the ζ potential detection results of Ad5 and BPAD in Example 1.
[0041] Figure 5The Western-blot results of the degradation of BRD4 by BPAD prepared with different pmMZ1 / Ad5 ratios in Example 4.
[0042] Figure 6 : a shows the Western-blot results of the degradation of BRD4 by different preparations under in vitro conditions in Example 5; b shows the Western-blot results of the degradation of BRD4 by different preparations under in vivo conditions in Example 6.
[0043] Figure 7 : a shows the representative flow cytometry analysis results of the BRD4 expression in B16F10-mCAR cells after being treated with different preparations in vitro in Example 5; b shows the proportion of BRD4 - (BRD4-negative) cells in Example 5; c shows the representative flow cytometry analysis results of the BRD4 expression in B16F10-mCAR cells after being treated with different preparations in vivo in Example 6; d shows the proportion of BRD4 - cells in Example 6.
[0044] Figure 8 : Detection results of the effect of the coupling of Ad5 and pmMZ1 on the infectivity of the virus.
[0045] Figure 9 : a shows the proportions of B16F10-mCAR and B16F10-GFP cells after being treated with different preparations in Example 8; b shows the representative flow cytometry analysis results of the proportions of B16F10-mCAR and B16F10-GFP cells after being treated with different preparations in Example 8.
[0046] Figure 10 : a-b show the proportion of BRD4-negative cells and the expression of BRD4 in B16F10-GFP cells detected by flow cytometry after being treated with different preparations in vitro in Example 8; c-d show the proportion of BRD4-negative cells and the expression of BRD4 in B16F10-mCAR cells detected by flow cytometry after being treated with different preparations in vitro in Example 8; e-f show the proportion of BRD4-positive cells and the expression of BRD4 in CD45 + cells after being treated with different preparations in vivo in Example 9.
[0047] Figure 11 GO enrichment analysis of the related gene pathways of B16F10-mCAR cells treated with the BPAD group and the PBS group in Example 10.
[0048] Figure 12 : a is the mRNA expression level of IFN-α of B16F10-mCAR after treatment with different formulations in vitro in Example 10; b is the mRNA expression level of IFN-β of B16F10-mCAR after treatment with different formulations in vitro in Example 10.
[0049] Figure 13 : a is the expression of proteins related to the cGAS-STING signaling pathway in B16F10-mCAR cells after treatment with different formulations in vitro in Example 10; b is the expression of proteins related to the cGAS-STING signaling pathway in B16F10-mCAR tumor tissues after treatment with different formulations in vivo in Example 10.
[0050] Figure 14 : a-b are the amounts of IFN-α and IFN-β secreted after treating B16F10-mCAR with different formulations in vitro in Example 10; c-d are the amounts of IFN-α and IFN-β secreted in tumor tissues after treating with different formulations in vivo in Example 11.
[0051] Figure 15 : a is a schematic diagram for evaluating the effect of BPAD on the activation of DCs in the co-culture model of B16F10-mCAR and DCs in Example 12; b is the proportion of mature DCs cells in different treatment groups in vitro analyzed by flow cytometry and its quantitative results in Example 12.
[0052] Figure 16 : a is the level of mature DCs in the tumor tissues of tumor-bearing mice after treatment with different formulations in vivo analyzed by flow cytometry and its quantitative results in Example 13; b is the level of mature DCs in the lymph nodes of tumor-bearing mice after treatment with different formulations in vivo analyzed by flow cytometry and its quantitative results in Example 13; c is the level of type I macrophages in the tumor tissues of tumor-bearing mice after treatment with different formulations in vivo analyzed by flow cytometry and its quantitative results in Example 13; d is the level of cytotoxic CD8 + T cells in the tumor tissues of tumor-bearing mice after treatment with different formulations in vivo analyzed by flow cytometry and its quantitative results in Example 13.
[0053] Figure 17 : a are the ex vivo tumor photos of mice bearing B16F10-mCAR subcutaneous tumors at the end point of the pharmacodynamic experiment in Example 14 after treatment with different formulations, scale bar: 2 cm; b is the tumor growth curve after treatment with different formulations in Example 14.
[0054] Figure 18: a shows the ex vivo tumor photos of mice bearing subcutaneous B16F10-mCAR tumors in Example 14 at the end point of the combined H151 efficacy experiment, treated with different formulations. Scale bar: 2 cm; b shows the tumor growth curves after treatment with different formulations in Example 14.
[0055] Figure 19 : a shows the ex vivo tumor photos of mice bearing subcutaneous B16F10-mCAR, B16F10-cGAS-KO, and B16F10-STING-KO tumors in Example 14 at the end point of the efficacy experiment, treated with different formulations. Scale bar: 2 cm; b shows the tumor growth curves after treatment with different formulations in Example 14.
[0056] Figure 20 : a shows the ex vivo tumor photos of mice bearing subcutaneous B16F10-mCAR tumors in Example 14 at the end point of the combined αPD-1 efficacy experiment, treated with different formulations. Scale bar: 2 cm; b shows the tumor growth curves after treatment with different formulations in Example 14. Detailed implementation mode
[0057] The present invention aims to provide a conjugate preparation of an oncolytic virus and a PROTAC prodrug to overcome the deficiencies of PROTAC drugs themselves and the fact that the immune responses activated by OVs themselves are often limited and insufficient to effectively attack tumors. Specifically, the present invention uses the abundant groups (such as amino groups) on the surface of the oncolytic virus to link the PROTAC prodrug to its surface to obtain the conjugate preparation.
[0058] In the present invention, the PROTAC prodrug that can be linked to the surface of the oncolytic virus can be selected as the prodrug of a proteolysis-targeting chimera targeting the degradation of BRD4, and its structure can be shown as the following formula (I):
[0059]
[0060] In formula (I):
[0061] R 1 -R 7 Each independently selected from -H and C l-5 alkyl, for example, can be selected from: methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, and neopentyl;
[0062] R 8 Selected from F, Cl, Br, and I;
[0063] L is selected from -(CH2CH2O) m CH2-, -CH2CH2OCH2CH2CH2OCH2-, and -CH2(CH2OCH2) mCH2-, where m is an integer from 1 to 10, such as an integer from 1 to 6, an integer from 1 to 5, an integer from 1 to 4, an integer from 1 to 3, or an integer from 1 to 2, and specifically can be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;
[0064] n is an integer from 1 to 10, such as an integer from 1 to 6, an integer from 1 to 5, an integer from 1 to 4, an integer from 1 to 3, or an integer from 1 to 2, and specifically can be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
[0065] In a preferred embodiment, the structure of the prodrug of the proteolysis-targeting chimera that targets the degradation of BRD4 can be shown as the following formula (I-1), (I-2), (I-3), or (I-4):
[0066]
[0067] In formulas (I-1) to (I-4), n is an integer from 1 to 10, such as an integer from 1 to 6, an integer from 1 to 5, an integer from 1 to 4, an integer from 1 to 3, or an integer from 1 to 2, and specifically can be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
[0068] Hereinafter, only some exemplary embodiments are simply described. As those skilled in the art can recognize, the described embodiments can be modified in various different ways without departing from the spirit or scope of the present invention. Therefore, the drawings and the description are considered to be exemplary in nature rather than restrictive.
[0069] The methods used in the following examples are all conventional methods unless otherwise specified. For specific steps, please refer to: "Molecular Cloning: A Laboratory Manual" (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).
[0070] The acquisition routes of various biological materials described in the examples are only provided as a way to obtain them for the purpose of specific disclosure, and should not be a limitation on the sources of the biological materials of the present invention. In fact, the sources of the biological materials used are extensive, and any biological materials that can be obtained without violating laws and moral ethics can be used as replacements according to the prompts in the examples.
[0071] In the following examples, the oncolytic adenovirus Ad5 used was a gift from Zhengzhou University. The PROTAC prodrug was a prodrug of the proteolysis-targeting chimera (mMZ1) targeting the degradation of BRD4, named pmMZ1. The NHS group (succinimidyl carbonate) on it could react with the abundant amino groups on the surface of Ad5, enabling pmMZ1 to be linked to the surface of Ad5. The pmMZ1 used in the following examples (whose molecular structure is shown in the above formula (I-1), where n = 3) was a gift from Shandong University.
[0072] In the following examples, the melanoma cell line B16F10-mCAR expressing murine coxsackievirus adenovirus receptor (mCAR, which is a key receptor for adenovirus infection) was constructed based on the wild-type melanoma cell line (B16F10, which expresses BRD4 protein) and was a gift from Zhengzhou University. Based on the B16F10-mCAR cell line, using the pLentiCRISPRv2 vector (purchased from Addgene, #196625), the melanoma cell line B16F10-mCAR-cGAS KO that knocked out the cGAS protein and expressed murine coxsackievirus adenovirus receptor (mCAR) and the melanoma cell line B16F10-mCAR-STING KO that knocked out the STING protein and expressed murine coxsackievirus adenovirus receptor (mCAR) were constructed. Among them, the cGAS sgRNA was GCUGGAUGCAGGUUGGAGUA (SEQ ID NO:1); the STING sgRNA was AGGACCAGAACACCUUGUAG (SEQ ID NO:2). Based on the wild-type B16F10 cell line, the melanoma (B16F10) cell line B16F10-GFP expressing green fluorescent protein (GFP) was constructed by transfecting the green fluorescent protein (GFP) gene using lentivirus (purchased from GeneChem).
[0073] In the following examples, male C57BL / 6 mice were purchased from Vital River (Beijing).
[0074] In the following examples, the HiTrap desalting column used was purchased from Cytiva (Sweden).
[0075] The primers used in the examples were purchased from Sangon Biotech, and the primer sequences are as follows:
[0076] Mouse genomic gActin-F: GTGACGTTGACATCCGTAAAGA (SEQ ID NO:3);
[0077] Mouse genomic gActin-R: GCCGGACTCATCGTACTCC (SEQ ID NO:4);
[0078] AD5-E1A-F: TGATCGATCCACCCAGTGAC (SEQ ID NO:5);
[0079] AD5-E1A-R: ATGACAAGACCTGCAACCGT (SEQ ID NO:6);
[0080] mGAPDH-F: CATCACTGCCACCCAGAAGACTG (SEQ ID NO:7);
[0081] mGAPDH-R: ATGCCAGTGAGCTTCCCGTTCAG (SEQ ID NO:8);
[0082] IFNα1-F: GGATGTGACCTTCCTCAGACTC (SEQ ID NO:9);
[0083] IFNα1-R: ACCTTCTCCTGCGGGAATCCAA (SEQ ID NO:10);
[0084] IFNβ1-F: AGCTCCAAGAAAGGACGAACA (SEQ ID NO:11);
[0085] IFNβ1-R: GCCCTGTAGGTGAGGTTGAT (SEQ ID NO:12).
[0086] In the following examples, the drug for combination therapy was the immune checkpoint inhibitor αPD-1, which was purchased from BioXcell, USA.
[0087] Example 1
[0088] The purpose of this example was to verify the conversion of pmMZ1 to mMZ1 (i.e., drug release).
[0089] (1) pmMZ1 (50 μM) was treated with 10 mM DTT (MeOH:H2O = 1:1, v / v) at 37 °C for 0, 20, 40, 60, 80, 100 minutes to convert pmMZ1 to mMZ1 (i.e., release mMZ1 from pmMZ1).
[0090] (2) The solution in (1) was detected for the concentration of released mMZ1 by HPLC (mobile phase: B: CH3CN, A: H2O, containing 0.1% TFA; flow rate: 0.6 mL / min; column temperature: 30 °C; UV: 254 nm; elution gradient: 0 - 20 minutes, from 10% B to 100% B). As Figure 1As shown (where mMZ1-SH is an intermediate product during the conversion from pmMZ1 to mMZ1), within 2 hours, mMZ1 was basically completely released (i.e., all pmMZ1 was converted to mMZ1).
[0091] Example 2
[0092] The purpose of this example is to verify the ability of mMZ1 to degrade BRD4 protein in vitro.
[0093] (1) Take B16F10-mCAR cells in the logarithmic growth phase in the incubator, add RPMI-1640 complete medium (Gibco, hereinafter also referred to as 1640 complete medium) to adjust the cell suspension concentration to about 3×10 6 cells / ml, and spread 100 μl of the cell suspension per well on a 6-well cell culture plate. At this time, the cell density in each test well of the 6-well plate is about 3×10 5 cells / well, supplement RPMI-1640 complete medium to 2 mL, and set up a total of 40 experimental wells.
[0094] (2) Add DMSO to the mMZ1 powder (gifted by Shandong University) to prepare a stock solution at a concentration of 1 mM. Take 10 μL of the stock solution and add it to 990 μL of PBS as a stock solution (10 μM). After sterilizing through a 0.22 μm filter membrane, store it in a -80 °C refrigerator for later use.
[0095] (3) Cultivate the cells conventionally for 14 - 16 h, that is, when the cells are completely adherent but have not started to proliferate, take out the culture plate.
[0096] (4) For the cells in the 6-well plate, divide the 40 experimental wells into 4 time gradients. After adding mMZ1, culture for 2, 4, 8, and 16 hours respectively. Set 5 concentration gradients within each gradient time, which are 0, 10, 20, 50, and 100 nM, and set 2 replicates.
[0097] (5) Before harvesting the cells, add protease inhibitors, phosphatase inhibitors, and PMSF (Wuhan, Boster) to the RIPA lysis buffer (Germany, Merck) at a ratio of 100:1 to prepare a cell lysis buffer.
[0098] (6) After administering the drug and culturing the cells for a specific time according to step (4), discard the culture medium, wash 3 times with PBS, add 100 μL of the cell lysis buffer prepared in step (5) to each well, use a cell scraper to harvest the cells and put them into a 1.5 mL EP tube, lyse on ice for 30 minutes, and then centrifuge at 10000 g for 30 minutes to collect the supernatant into a new 1.5 mL EP tube.
[0099] (7) Determine the protein concentration of the sample collected in (6) using a BCA protein assay kit (Wuhan, Boster).
[0100] (8) Mix the protein sample in (7) with 5×SDS sample buffer (Wuhan, Boster) and PBS, set the final concentration of the protein to 1 mg / mL, and denature it at 95 °C for 10 minutes.
[0101] (9) Subsequently, separate the protein sample in (8) using a 7.5% SDS-PAGE gel. Then transfer the gel onto a PVDF membrane (Germany, Merck), and block it with TBS buffer containing 5% BSA at room temperature for 2 hours.
[0102] (10) Subsequently, cut the PVDF membrane and incubate it overnight at 4 °C with the primary antibody against BRD4 (Boster, A00123-3) and the primary antibody against GAPDH (Boster, A00227-1) at corresponding positions. Then wash it three times with TBST, and then incubate it with an HRP-conjugated secondary antibody at room temperature for 1 hour. After washing three times with TBST, detect the signal using Clarity Western ECL (USA, USEverbrigh), and scan the blot using a Tanon imaging system. The results are as Figure 2 shown, indicating that mMZ1 can significantly degrade the BRD4 protein in tumor cells.
[0103] The results of the above Examples 1 and 2 show that the PROTAC prodrug pmMZ1 can be completely converted into mMZ1, that is, mMZ1 can be completely released from pmMZ1, and it is confirmed that mMZ1 can indeed significantly degrade the BRD4 protein in tumor cells.
[0104] Example 3
[0105] In this example, a conjugate preparation of oncolytic virus (Ad5) and PROTAC prodrug (pmMZ1), named BPAD, was constructed by the following method, and its particle size and zeta potential were detected. The specific operation of the method is as follows:
[0106] (1) Mix 400 μL of Ad5 (5×10 11 VP / mL) with 10 μL of pmMZ1 solution (20 μmol / mL), sonicate it in an ice bath (4 °C) at a power of 200 W for 30 min, and then use a HiTrap desalting column to remove the excess pmMZ1. The filtered liquid is the BPAD preparation, which is stored at 4 °C for later use.
[0107] (2) BPAD preparation is obtained by connecting pmMZ1 to the surface of Ad5 through the reaction of the NHS group on pmMZ1 with the abundant amino groups on the surface of Ad5. Ad5 and BPAD coupling preparation were characterized by transmission electron microscopy (Tecnai G2 20S-TWIN, 200 kV, FEI, USA) and laser particle size analyzer (Zetasizer Nano Pro, Malvern, UK). The results are as follows: Figure 3 and Figure 4 As shown, Figure 3 a is a transmission electron micrograph of naked Ad5, with an average particle size of about 103.42 nm (e.g. Figure 4 As shown in a, it is about 101nm-104nm), the dispersion index (PDI) is about 0.08, and the potential is about -23mV (as shown in Figure 4 As shown in b, it is approximately in the range of -22mV to -24mV); Figure 3 The prepared BPAD conjugate preparation is spherical, with blurred edges compared to Ad5, and a more uniform particle size with an average particle size of about 107.12 nm (e.g. Figure 4 As shown in a, it is about 106nm-108nm), the dispersion index (PDI) is about 0.12, and the potential is about -27mV (as shown in Figure 4 As shown in middle b, it is approximately in the range of -25 mV to -29 mV); compared with naked Ad5, the particle size increases by approximately 4 nm.
[0108] Example 4
[0109] The purpose of this example is to explore the optimal ratio of Ad5 and pmMZ1 when coupled.
[0110] (1) 300, 400, 500, and 600 μL of Ad5 (5×10 11 VP / mL) was mixed with 10 μL of pmMZ1 solution (20 μmol / mL), supplemented with PBS to 1 mL, and ultrasonicated on ice for 30 min at 4°C. The excess pmMZ1 was then removed using a HiTrap desalting column. The filtered liquid was the BPAD preparation, corresponding to pmMZ1:Ad5 ratios of 0.67, 0.80, 1.00, and 1.33 (1×10 -9 nmol / VP) and stored at 4°C for later use.
[0111] (2) Take B16F10-mCAR cells in the logarithmic growth phase in the incubator and add RPMI-1640 complete medium to adjust the cell suspension concentration to 3×10 6 cells / ml, 100 μl of cell suspension was plated in each well of a 6-well cell culture plate. At this time, the cell density in each well of the 6-well plate was 3×10 5Cells / well, supplement RPMI-1640 complete medium to 2 mL, and set up 10 experimental wells in total.
[0112] (3) Incubate the cells routinely for 14 - 16 h, then take out the culture plate when the cells are completely adherent but have not started to proliferate.
[0113] (4) For the cells in the 6-well plate, divide the 10 experimental wells into 5 groups: PBS, 0.67, 0.80, 1.00, 1.33 (1×10 -9 nmol / VP), with two replicate wells in each group. Except for the PBS group, add the conjugate preparation synthesized in different ratios at 500 VP / cell (calculated according to Ad5) to the other groups. After culturing the cells for 4 h, change the medium to fresh medium for all 5 groups and continue culturing for 4 h. Then, extract the cell proteins according to the method in Example 3 for WB detection. The results are as Figure 5 shown. It can be seen that BRD4 in the cells is basically completely degraded at a ratio of 0.8 - 1.33×10 - 9 nmol / VP. In the subsequent examples, a ratio of 1.0×10 -9 nmol / VP will be used for the synthesis of the conjugate preparation BPAD.
[0114] Example 5
[0115] The purpose of this example is to verify in vitro that the conjugate preparation BPAD can carry more small molecule drugs into cells and achieve more efficient degradation of BRD4 protein in cells.
[0116] (1) Take the B16F10-mCAR cells in the logarithmic growth phase in the incubator, add 1640 complete medium to adjust the cell suspension concentration to 3×10 6 cells / ml, and spread 100 μl of the cell suspension per well on a 6-well cell culture plate. At this time, the cell density in each well to be tested in the 6-well plate is 3×10 5 cells / well. Supplement 1640 complete medium to 2 mL, and set up 5 groups, namely PBS, Ad5, PROTACs (add mMZ1 alone, the same below), Ad5@BP (add Ad5 and mMZ1 in combination), and BPAD, with 7 wells in each group, for a total of 35 experimental wells.
[0117] (2) Incubate the cells routinely for 14 - 16 h, then take out the culture plate when the cells are completely adherent but have not started to proliferate.
[0118] (3) Add the corresponding drugs to the cells in each group of test wells. Add 500 VP / cell (counted by Ad5) for Ad5 and BPAD, the final concentration of PROTACs is 50 nM, and Ad5@BP is added according to the amounts of Ad5 and PROTACs respectively. After culturing the cells for 4 h, the medium of all 5 groups is replaced with fresh medium and cultured for another 4 h. Protein was extracted from 2 test wells in each group for WB detection according to the aforementioned method, and the content of BRD4 protein in cells was detected by flow cytometry using BRD4 antibody (Boster, A00123-3) in the remaining test wells of each group. The results are as Figure 6 in a, Figure 7 as shown in a and b in Figure 6 which, from the WB results shown in a in Figure 7 it can be seen that the content of BRD4 protein extracted from the cells added with BPAD is significantly lower, and from the flow cytometry detection results shown in a and b in
[0119] Example 6
[0120] The purpose of this example is to verify in vivo that the conjugate preparation BPAD can carry more small molecule drugs into cells to achieve more efficient degradation of BRD4 protein.
[0121] (1) On day 0, inject 2×10 6 B16F10-mCAR cells subcutaneously into the right flank of 30 male C57BL / 6 mice (6-8 weeks old), divided into 5 groups, namely PBS, Ad5, PROTACs, Ad5@BP, and BPAD, with 5 mice in each group.
[0122] (2) On day 8, when the tumor grows to a volume of about 100 mm 3 , inject different drugs intratumorally. The dosage of Ad5 and BPAD is 5×10 9 VP / mouse (counted by Ad5), the dosage of PROTACs is 5 nmol / mouse, and Ad5@BP is injected according to the amounts of Ad5 and PROTACs respectively. The formula for calculating the tumor volume (V) is: V = ab 2 / 2, where a and b are the major axis and minor axis of the tumor respectively.
[0123] (3) Sacrifice all mice after 8 h, and take the tumors for WB and flow cytometry detection. The results are as Figure 6 in b, Figure 7As shown in c and d, it can be seen that through two experiments of WB and flow cytometry, it is proved that in the tumor model, the preparation BPAD can carry more PROTAC small molecules into cells, thereby more efficiently degrading the BRD4 protein in cells.
[0124] Example 7
[0125] The purpose of this example is to detect the effect of the conjugation of Ad5 and pmMZ1 on the infectivity of the virus.
[0126] (1) Take B16F10-mCAR cells in the logarithmic growth phase in the incubator, add 1640 complete medium to adjust the cell suspension concentration to 1×10 6 cells / ml, spread 100 μl of cell suspension per well on a 12-well cell culture plate. At this time, the cell density in each well to be tested in the 12-well plate is 1×10 5 cells / well, supplement 1640 complete medium to 1 mL, and set up 2 groups in total, namely the Ad5 group and the BPAD group.
[0127] (2) Cultivate the cells routinely for 14 - 16 h, that is, when the cells are completely adherent but have not yet proliferated, take out the culture plate;
[0128] (3) Add the corresponding drugs to each test well. Add 500 VP / cell (counted by Ad5) for Ad5 and BPAD. Cultivate the cells for 4 h;
[0129] (4) Discard the medium, wash 3 times with PBS, then digest the cells with 100 μL of trypsin for 3 minutes, add 300 μL of 1640 complete medium to terminate the digestion, collect all the cells and put them into a 1.5 ml EP tube;
[0130] (5) Extract the genome in the sample according to the operation shown in the DNA extraction kit (Novizan, DC112 - 01);
[0131] (6) Perform qPCR (quantitative polymerase chain reaction) to detect the relative content of the Ad5 genome in the genome (where primers AD5 - E1A - F and AD5 - E1A - R are used to quantify the adenovirus genome; primers gActin - F and gActin - R are used to quantify the B16F10 - mCAR cell genome and serve as internal reference genes).
[0132] The results are as Figure 8 shown. It can be seen that compared with Ad5, the preparation BPAD conjugated with pmMZ1 can be taken up by cells more. This result indicates that after Ad5 is conjugated with pmMZ1, it not only does not affect the infectivity of Ad5 to the virus, but instead significantly improves the infectivity of Ad5 to the virus, which will enable the preparation BPAD to carry more PROTAC small molecules into cells, thereby more efficiently degrading the BRD4 protein in cells.
[0133] Example 8
[0134] The purpose of this example is to verify the targeted killing effect of the conjugate preparation BPAD on tumor cells in vitro.
[0135] (1) Take an equal amount of B16F10-mCAR cells and B16F10-GFP in the logarithmic growth phase from the incubator, add 1640 complete medium to adjust the cell suspension concentration to 3×10 6 cells / ml, and spread 100 μl of the cell suspension per well on a 6-well cell culture plate. At this time, the cell density in each well to be tested in each 6-well plate is 3×10 5 cells / well, supplement 1640 complete medium to 2 mL, and set up 5 groups in total, namely PBS, Ad5, PROTACs, Ad5@BP (a mixture of Ad5 and mMZ1 added), and BPAD. There are 9 wells in each group, for a total of 45 experimental wells.
[0136] (2) Cultivate the cells routinely for 14 - 16 h, that is, when the cells are completely adherent but have not started to proliferate, take out the culture plate;
[0137] (3) For the verification of the targeted killing ability of BPAD, add the corresponding drugs to each experimental well. Add 500 VP / cell for Ad5 and BPAD, the final concentration of PROTACs is 50 nM, and Ad5@BP is added according to the amounts of Ad5 and PROTACs respectively. After culturing the cells for 12 h, collect the cells and perform flow cytometry to detect the ratio of the two types of cells in each sample. The results are as shown in Figure 9 a and b in the figure. It can be seen that the proportion of B16F10-mCAR cells in the BPAD group is significantly reduced, indicating the targeted killing ability of BPAD on cells highly expressing the coxsackievirus adenovirus receptor mCAR.
[0138] (4) For the verification of the targeted degradation ability of BPAD, add the corresponding drugs to each experimental well. Add 500 VP / cell for Ad5 and BPAD, the final concentration of PROTACs is 50 nM, and Ad5@BP is added according to the amounts of Ad5 and PROTACs respectively. After culturing the cells for 4 h, replace them with fresh medium without drugs. After 4 h, collect the cells and use the BRD4 antibody (Boster, A00123 - 3) to perform flow cytometry to detect the content of BRD4 protein in the cells. The results are as shown in Figure 10 a, b, c, and d in the figure. The experiment proves that the preparation BPAD can carry more PROTAC small molecules to target and enter cells highly expressing mCAR, thereby reducing the off-target effect of free PROTAC small molecules.
[0139] Example 9
[0140] The purpose of this example is to verify the targeting of the conjugate preparation BPAD to tumor cells with high mCAR expression in vivo.
[0141] (1) On day 0, 2×10 6 B16F10-mCAR cells were injected subcutaneously into the right flanks of 30 male C57BL / 6 mice (6 - 8 weeks old), divided into 5 groups, namely PBS, Ad5, PROTACs, Ad5@BP (a mixture of Ad5 and mMZ1 added), and BPAD, with 6 mice in each group.
[0142] (2) On day 8, when the tumors grew to a volume of approximately 100 mm 3 , different drugs were injected into the tumors. The doses of Ad5 and BPAD were 5×10 9 VP / mouse, the dose of PROTACs was 5 nmol / mouse, and Ad5@BP was injected according to the amounts of Ad5 and PROTACs respectively. The formula for calculating the tumor volume (V) is: V = ab 2 / 2, where a and b are the major axis and minor axis of the tumor respectively.
[0143] (3) All mice were sacrificed 8 h later, and the tumors were taken for flow cytometry detection. The results are shown in Figure 10 e and f. In the tumor model, the conjugate preparation BPAD had no obvious effect on the expression of BRD4 in CD45 + immune cells in the tumor, demonstrating in vivo that the conjugate BPAD preparation avoided the off-target effect of free PROTACs small molecules.
[0144] Example 10
[0145] The purpose of this example is to explore the ability of the conjugate preparation BPAD to activate the cGAS-STING pathway of tumor cells in vitro.
[0146] (1) B16F10-mCAR cells in the logarithmic growth phase in the incubator were taken, and the cell suspension concentration was adjusted to 3×10 6 cells / ml by adding 1640 complete medium. 100 μl of the cell suspension was spread evenly in each well of a 6-well cell culture plate. At this time, the cell density in each well to be tested in each 6-well plate was 3×10 5 cells / well. 1640 complete medium was supplemented to 2 mL. A total of 6 groups were set up, namely PBS, Ad5, PROTACs, Ad5@BP (a mixture of Ad5 and mMZ1 added), BPAD, and BPnAD (defective replication Ad5 conjugated with pmMZ1 (using a ratio of 1.0×10 -9 nmol / VP)), with 9 wells in each group, for a total of 54 experimental wells.
[0147] (2) Incubate the cells conventionally for 14 - 16 h. Take out the culture plate when the cells are completely adherent but have not started to proliferate.
[0148] (3) Add the corresponding drugs to each group of experimental wells. Add 500 VP / cell (counted as Ad5) for Ad5, BPAD, and BPnAD, and the final concentration of PROTACs is 50 nM. Add Ad5@BP according to the amounts of Ad5 and PROTACs respectively. After culturing the cells for 4 h, replace them with fresh medium without drugs and then collect the cells after culturing for another 36 h.
[0149] (4) Perform RNA sequencing ( Figure 11 showing the GO enrichment analysis of the related gene pathways), detect the mRNA expression of IFNα and IFNβ by qPCR (the primer pairs used are: IFNα1 - F and IFNα1 - R, IFNβ1 - F and IFNβ1 - R, mGAPDH - F and mGAPDH - R, where the mGAPDH - F and mGAPDH - R primer pair is used to detect the reference gene) ( Figure 12 as shown in a and b), detect the expression of cGAS, p - STING, p - TBK1, and IFNα by WB ( Figure 13 as shown in a and b). Collect the cell supernatant at 36 h and detect the levels of IFNα and IFNβ secreted by the cells by ELISA ( Figure 14 as shown in a and b). The above results indicate that the conjugate BPAD can significantly activate the cGAS - STING pathway in tumor cells and secrete a large amount of type I interferons (such as IFN - α and IFN - β).
[0150] Example 11
[0151] The purpose of this example is to explore the ability of the conjugate BPAD to activate the tumor cGAS - STING pathway at the in - vivo level.
[0152] (1) On day 0, inject 2×10 6 B16F10 - mCAR cells subcutaneously into the right flanks of 30 male C57BL / 6 mice (6 - 8 weeks old). Divide them into 6 groups, namely PBS, Ad5, PROTACs, Ad5@BP (mixed addition of Ad5 and mMZ1), BPAD, and BPnAD, with 5 mice in each group.
[0153] (2) On days 8 and 10, inject different drugs intratumorally. The dosage of Ad5, BPAD, and BPnAD is 5×10 9 VP / mouse, the dosage of PROTACs is 5 nmol / mouse, and inject Ad5@BP according to the amounts of Ad5 and PROTACs respectively.
[0154] (3) On the 11th day, all mice were sacrificed, and tumors were taken for WB detection of pSTING and IFNα expression, and ELISA was used to detect the levels of IFNα and IFNβ in the tumors. The results are as Figure 14 shown in c and d, indicating that the conjugate preparation BPAD can activate the tumor cGAS-STING pathway, manifested as a significant increase in the levels of IFNα and IFNβ in the tumors.
[0155] Example 12
[0156] The purpose of this example is to explore the effect of activating the cGAS-STING pathway on the maturation of dendritic cells after the BPAD preparation infects tumor cells.
[0157] (1) Take B16F10-mCAR cells in the logarithmic growth phase in the incubator, add 1640 complete medium to adjust the cell suspension concentration to 1×10 6 cells / ml, and spread 100 μl of cell suspension per well on the lower layer of a Transwell 24-well cell culture plate. At this time, the cell density in each well to be tested in the 24-well plate is 1×10 5 cells / well, and supplement 1640 complete medium to 0.5 mL. A total of 6 groups are set, namely PBS, Ad5, PROTACs, Ad5@BP (Ad5 and mMZ1 are added in combination), BPAD, and BPnAD (replication-defective Ad5 is conjugated with pmMZ1). Each group has 3 wells, for a total of 18 experimental wells.
[0158] (2) Incubate the cells routinely for 14 - 16 h, that is, when the cells are completely adherent but have not yet proliferated, take out the culture plate;
[0159] (3) Add the corresponding drugs to each experimental well. Add 500 VP / cell (counted by Ad5) for Ad5, BPAD, and BPnAD, the final concentration of PROTACs is 50 nM, Ad5@BP is added according to the amounts of Ad5 and PROTACs respectively, and the final concentration of H151 (STING inhibitor) is 1 μM. After culturing the cells for 4 h, replace them with fresh medium without drugs.
[0160] (4) Subsequently, bone marrow-derived dendritic cells (BMDCs) were plated on the upper layer of the Transwell 24-well plate at a density of 1×10 5 cells / well ( Figure 15In a), after continuous culture for 36 h, the upper layer of BMDC cells was collected for flow cytometry. Anti-mouse CD80 antibody (104707, clone number: 16-10A1, dilution ratio: 1:40) and anti-mouse CD86 antibody (105014, clone number: GL-1, dilution ratio: 1:20) were used to evaluate the degree of cell maturation.
[0161] (5) As shown in Figure 15 b), the BPAD group significantly activated dendritic cells, while the activation of dendritic cells was significantly weakened after adding H151, indicating that BPAD can enhance dendritic cell function by activating the cGAS-STING pathway of tumor cells.
[0162] Example 13
[0163] The purpose of this example is to explore the effect of BPAD preparation in activating anti-tumor immunity in vivo.
[0164] (1) On day 0, 2×10 6 B16F10-mCAR cells were injected subcutaneously into the right flank of 30 male C57BL / 6 mice (6-8 weeks old), and they were divided into 6 groups, namely PBS, Ad5, PROTACs, Ad5@BP (a mixture of Ad5 and mMZ1 added), BPAD, and BPnAD, with 5 mice in each group.
[0165] (2) On days 8 and 10, different drugs were injected intratumorally. The doses of Ad5, BPAD, and BPnAD were 5×10 9 VP / mouse, and the dose of PROTACs was 5 nmol / mouse.
[0166] (3) On day 11, all mice were sacrificed, and tumors and tumor-draining lymph nodes were collected for flow cytometry.
[0167] (4) As shown in Figure 16 a, c, and d (where G1-G6 represent PBS, PROTACs, Ad5, Ad5@BP, BPnAD, and BPAD respectively), the proportions of DC cells with high expression of CD86, M1 macrophages, and cytotoxic T cells expressing IFN-γ in tumor cells were significantly increased. As shown in Figure 16 b (where G1-G6 represent PBS, PROTACs, Ad5, Ad5@BP, BPnAD, and BPAD respectively), the proportion of DC cells with high expression of CD86 in tumor-draining lymph nodes was also significantly increased.
[0168] Example 14
[0169] The purpose of this example is to verify the anti-tumor efficacy and its mechanism of the conjugate preparation BPAD in tumor-bearing mice.
[0170] (1) On day -5, 2×10 6 B16F10-mCAR cells, B16F10-mCAR-cGAS KO cells, or B16F10-mCAR-STING KO cells were subcutaneously injected into the right flanks of male C57BL / 6 mice (6 - 8 weeks old).
[0171] (2) On days 0, 2, 4, and 6, different formulations were intratumorally injected (Ad5, BPAD, and BPnAD at a dose of 5×10 9 VP / 25 μl / mouse, mMZ1 at a dose of 5 nmol / 25 μl / mouse (indicating that each mouse was injected with 25 μl of mMZ1 at a concentration of 5 nmol). For the treatment that required combination with H151 (MCE, HY-112693), H151 was intraperitoneally injected at 750 nmol / 100 μl / mouse daily from day 0 to day 6. For the treatment combined with αPD-1 (InVivoMAb, BE0273), it was intravenously injected at 2.5 μg / g / 100 μl / mouse on days 3 and 5 (indicating that each mouse was injected with 2.5 μg of αPD-1 per g of mouse, and the volume was 100 μL). The tumor volume and body weight were measured every two days. The formula for calculating the tumor volume (V) was: V = 1 / 2ab 2 , where a and b were the long axis and short axis of the tumor, respectively. The mice were sacrificed on day 8 to analyze the tumor weight and volume.
[0172] Compared with other groups, BPAD significantly inhibited tumor growth ( Figure 17 a and b in ), suggesting the potent antitumor effect of BPAD. After intraperitoneal injection of H151 inhibited the activation of the cGAS-STING pathway throughout the body of the mice, the antitumor effect of BPAD was inhibited ( Figure 18 a and b in ). For the B16F10 tumor model with cGAS or STING knocked out, the antitumor effect of BPAD was also weakened ( Figure 19 a, b, and c in ), suggesting that the antitumor effect of BPAD depends on the activation of the cGAS-STING pathway.
[0173] For the treatment combined with αPD-1, the tumor growth was further controlled after the combination treatment of BPAD and αPD-1 ( Figure 20 a and b in ).
[0174] Finally, it should be noted that the above are only preferred embodiments of the present invention and are not used to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or perform equivalent replacements for some of the technical features. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. A conjugate preparation, characterized in that, The conjugate preparation comprises an oncolytic virus and a proteolysis-targeting chimeric prodrug linked to the surface of the oncolytic virus.
2. The conjugate preparation according to claim 1, wherein The proteolysis-targeting chimeric prodrug is a prodrug of a proteolysis-targeting chimera that targets the degradation of BRD4; and / or The oncolytic virus is oncolytic adenovirus Ad5.
3. The conjugate preparation according to claim 2, wherein The structure of the prodrug of the proteolysis-targeting chimera that targets the degradation of BRD4 is shown in the following formula (I): In formula (I): R 1 -R 7 each independently selected from -H and C l-5 alkyl; R 8 selected from F, Cl, Br and I; L is selected from -(CH2CH2O) m CH2-, -CH2CH2OCH2CH2CH2OCH2- and -CH2(CH2OCH2) m CH2-, where m is an integer from 1 to 10; n is an integer from 1 to 10; Optionally, the structure of the prodrug of the proteolysis-targeting chimera that targets the degradation of BRD4 is shown in the following formula (I-1), (I-2), (I-3) or (I-4):
4. The conjugate preparation according to any one of claims 1-3, characterized in that, The conjugate preparation has a particle size of 106 - 108 nm, a polydispersity index PDI of 0.11 - 0.13, and a zeta potential of -25 mV to -29 mV.
5. A method for preparing the conjugate preparation according to any one of claims 1-4, characterized in that, The method comprises the following steps: 1) Mix the oncolytic virus with a solution of the proteolysis-targeting chimeric prodrug to obtain a first mixture; 2) Subject the first mixture to ultrasonic treatment in an ice bath to obtain a second mixture; 3) Remove the excess prodrug in the second mixture to obtain the conjugate preparation.
6. A composition comprising the conjugate preparation according to any one of claims 1 - 4 and an immune checkpoint inhibitor. Optionally, the immune checkpoint inhibitor is αPD-1.
7. Use of the conjugate preparation according to any one of claims 1 - 4 or the composition according to claim 6 in the preparation of a drug for targeted anti-tumor treatment.
8. Use of the conjugate preparation according to any one of claims 1 - 4 or the composition according to claim 6 in the preparation of a drug for activating the tumor cell cGAS-STING pathway in vitro and / or in vivo.
9. Use of the conjugate preparation according to any one of claims 1 - 4 or the composition according to claim 6 in the preparation of a drug for enhancing dendritic cell maturation.
10. Use of the conjugate preparation according to any one of claims 1 - 4 or the composition according to claim 6 in the preparation of a drug for activating anti-tumor immunity in vivo.
Citation Information
Patent Citations
PROTAC chimera for targeted degradation of GPX4 as well as preparation method and application of PROTAC chimera
CN115894439A
PROTAC compound for targeted degradation of ALK and application of PROTAC compound
CN119119002A
PROTACs compound for targeted degradation of PRMT5 and application of PROTACs compound
CN119504710A
BRCA2 protein targeting polypeptide, application thereof and medicine for treating prostatic cancer
CN119661657A