Preparation and application of balsam pear ribosome inactivating protein

Abstract

The invention discloses preparation and application of bitter gourd ribosome inactivating protein, and belongs to the technical field of genetic engineering. A novel balsam pear ribosome inactivating protein named as balsam pear bryodin II-like RIP protein is successfully expressed by constructing an in-vitro prokaryotic expression system, a large amount of high-purity balsam pear ribosome inactivating protein is obtained by purification through nickel column affinity chromatography, and the target protein is good in solubility, high in expression level, biological in activity and simple and convenient in purification method. IPEC-J2 is used as a cell model, and the safe concentration range of the ribosome inactivating protein is determined. The ribosome inactivating protein is detected to be capable of inhibiting replication of the pseudorabies virus under the action of protein concentrations of 50 micrograms per milliliter and 100 micrograms per milliliter, so that the protein has a potential application prospect in drugs for preventing and treating the pseudorabies virus.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to the preparation and application of a Momordica charantia ribosome-inactivating protein. Background Art

[0002] Ribosome-inactivating proteins (RIPs) are a class of proteins mainly present in plants with RNA N-glycosidase activity. RIPs act on the 28S rRNA of the large subunit of eukaryotic ribosomes, disrupting the ribosome structure and thus inhibiting protein synthesis.

[0003] Pseudorabies virus (PRV) is an enveloped linear double-stranded DNA virus, similar in morphology to herpesviruses, and is classified as porcine herpesvirus type I. It can infect a variety of mammals, causing pseudorabies symptoms such as fever, severe itching (except in pigs), and encephalomyelitis. Mature PRV virions are round or oval under the electron microscope, with a diameter of about 150 - 180 nm, consisting of double-stranded linear genomic DNA, an icosahedral capsid, a protein tegument, and an envelope. The genome encodes 16 envelope proteins, 11 of which are glycosylated, such as gB, gC, gD, gE, etc.

[0004] Pigs are the natural hosts of PRV, and the symptoms after infection vary depending on the age. Piglets mainly show fever, neurological symptoms, and multiple organ failure, with a mortality rate of up to 100%; adult pigs show respiratory symptoms and can be latently infected for life; pregnant sows show abortion and stillbirth. PRV can also cross-species transmission, infecting humans and causing endophthalmitis and encephalitis, which has become an important threat in the fields of public health and healthy breeding. Developing anti-pseudorabies virus prevention and control drugs is crucial for preventing and controlling PRV. Currently, there is no application of RIPs in the prevention and control of PRV. Summary of the Invention

[0005] The purpose of the present invention is to provide the preparation and application of a Momordica charantia ribosome-inactivating protein to solve the problems existing in the above-mentioned prior art. The Momordica charantia ribosome-inactivating protein can effectively inhibit the replication of pseudorabies virus.

[0006] To achieve the above purpose, the present invention provides the following solutions:

[0007] The present invention provides the application of Momordica charantia ribosome-inactivating protein in any one of the following:

[0008] (1) Application in the preparation of anti-pseudorabies drugs;

[0009] (2) Application in the preparation of drugs for inhibiting the replication of pseudorabies virus in cells;

[0010] The amino acid sequence of the Momordica charantia ribosome-inactivating protein is shown in SEQ ID NO: 2.

[0011] The present invention also provides the application of the coding gene of the Momordica charantia ribosome-inactivating protein in any one of the following:

[0012] (1) Application in the preparation of anti-pseudorabies drugs;

[0013] (2) Application in the preparation of drugs for inhibiting the replication of pseudorabies virus in cells;

[0014] The nucleotide sequence of the coding gene is shown in SEQ ID NO: 1.

[0015] The present invention also provides the application of the recombinant vector containing the coding gene of the Momordica charantia ribosome-inactivating protein in any one of the following:

[0016] (1) Application in the preparation of anti-pseudorabies drugs;

[0017] (2) Application in the preparation of drugs for inhibiting the replication of pseudorabies virus in cells;

[0018] The amino acid sequence of the Momordica charantia ribosome-inactivating protein is shown in SEQ ID NO: 2, and the nucleotide sequence of the coding gene is shown in SEQ ID NO: 1.

[0019] The present invention also provides the application of the recombinant bacterium containing the coding gene of the Momordica charantia ribosome-inactivating protein in any one of the following:

[0020] (1) Application in the preparation of anti-pseudorabies drugs;

[0021] (2) Application in the preparation of drugs for inhibiting the replication of pseudorabies virus in cells;

[0022] The coding gene is ligated with an expression vector to construct a recombinant vector, and the coding gene is integrated into the genome of the host bacterium through the recombinant vector; the amino acid sequence of the Momordica charantia ribosome-inactivating protein is shown in SEQ ID NO: 2, and the nucleotide sequence of the coding gene is shown in SEQ ID NO: 1.

[0023] The present invention also provides a method for inhibiting pseudorabies virus for non-therapeutic purposes in vitro, including the step of mixing and culturing the Momordica charantia ribosome-inactivating protein with a sample containing pseudorabies virus to inhibit the replication of pseudorabies virus, and the Momordica charantia ribosome-inactivating protein ≤ 100 μg / mL.

[0024] The present invention also provides a preparation method of the Momordica charantia ribosome-inactivating protein, including the following steps:

[0025] Connect the coding gene of Momordica charantia ribosome-inactivating protein to an expression vector to construct a recombinant vector, and then transfer the recombinant vector into Escherichia coli to construct a recombinant bacterium; the amino acid sequence of the Momordica charantia ribosome-inactivating protein is shown in SEQ ID NO: 2;

[0026] Induce and culture the recombinant bacterium with IPTG, and collect the bacterial cells; ultrasonically disrupt and centrifuge the bacterial cells, and collect the supernatant;

[0027] Filter the supernatant and elute the protein with a nickel column, collect the eluate, and concentrate it using an ultrafiltration concentrator with a cut-off molecular weight of 10KDa to obtain the Momordica charantia ribosome-inactivating protein.

[0028] Optionally, the conditions for inducing and culturing the recombinant bacterium with IPTG are: 0.8 mM IPTG, inducing expression at 28 °C for 8 hours.

[0029] Optionally, before eluting the protein with a nickel column, first equilibrate the nickel column with a binding buffer, and the binding buffer is a solution containing 20 mM sodium phosphate, 0.5 M NaCl, and pH 7.41.

[0030] Optionally, the elution buffer is: 20 mM sodium phosphate, 0.5 M NaCl, 200 mM imidazole; 20 mM sodium phosphate, 0.5 M NaCl, 400 mM imidazole; 20 mM sodium phosphate, 0.5 M NaCl, 500 mM imidazole; the pH of the buffer is 7.49.

[0031] The present invention also provides an anti-pseudorabies drug, which includes the Momordica charantia ribosome-inactivating protein prepared by the above preparation method, and the molecular weight of the Momordica charantia ribosome-inactivating protein is 39KDa.

[0032] The present invention discloses the following technical effects:

[0033] By constructing an in vitro prokaryotic expression vector and using an Escherichia coli expression system, the present invention realizes the soluble expression of the target protein (Momordica charantia ribosome-inactivating protein). Through the optimization of the process conditions for preparing Momordica charantia ribosome-inactivating protein, not only the protein yield is improved, but also the biological activity of the protein is ensured, providing a sufficient material basis for subsequent experimental research and application development.

[0034] Using IPEC-J2 as a cell model, the present invention determines the safe use concentration range of Momordica charantia ribosome-inactivating protein through a cytotoxicity experiment, providing a scientific basis for the safe application of the protein. The experimental results show that when the protein concentration ≤ 100 μg / mL, the protein has no obvious effect on cell survival and has the activity of inhibiting pseudorabies virus from infecting cells.

[0035] The Momordica charantia ribosome-inactivating protein prepared by the present invention has broad application prospects in anti-pseudorabies virus. The inhibitory effect of this protein on pseudorabies virus was confirmed by RT-qPCR detection. The discovery and application of this protein are expected to provide a more effective and safer means for the prevention and control of pseudorabies virus, and have important social and economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0037] Figure 1 It is the amplification result diagram of the Momordica charantia gene high-fidelity enzyme (KOD) in Example 1 of the present invention; M: DL2000 DNA Marker; 1-2: Both are the target genes of this Momordica charantia.

[0038] Figure 2 It is the result diagram of double digestion products of the Momordica charantia gene and the empty vector pET-28a(+) in Example 1 of the present invention; M: DL5000 DNA Marker; 1: Enzyme digestion identification of the Momordica charantia target gene; 2: Enzyme digestion identification of the empty vector pET-28a(+).

[0039] Figure 3 It is the analysis diagram of the influence of different inducer (IPTG) concentrations on the expression of the target protein in Example 2 of the present invention; 1: Control of the empty vector pET-28a(+); M: Protein Marker; 2: Whole bacteria before induction; 3-6: Whole bacteria induced by adding IPTG with final concentrations of 0.1 mM, 0.5 mM, 0.8 mM, and 1 mM respectively.

[0040] Figure 4 It is the analysis diagram of the influence of different induction times on the expression of the target protein in Example 2 of the present invention; 1: Control of the empty vector pET-28a(+); M: Protein Marker; 2: Whole bacteria before induction; 3-6: Whole bacteria after induction at 28 °C with 0.8 mM IPTG for 2 h, 4 h, 6 h, and 8 h respectively.

[0041] Figure 5 It is the SDS-PAGE electrophoresis diagram of large-scale induced expression and solubility analysis in Example 2 of the present invention; M: Protein Marker; 1: Whole bacteria before induction; 2: Whole bacteria after induction at 28 °C with 0.8 mM IPTG for 8 h; 3: Supernatant after ultrasonic disruption; 4: Precipitate after ultrasonic disruption.

[0042] Figure 6This is the SDS-PAGE electrophoresis diagram of purifying protein by gradient imidazole concentration elution in Example 2 of the present invention; M: Protein Marker; 1: Protein flow-through solution; 2-7: Gradient imidazole eluted protein, 20 mM sodium phosphate, 0.5 M NaCl, containing 20 mM imidazole, 50 mM imidazole, 100 mM imidazole, 200 mM imidazole, 400 mM imidazole, 500 mM imidazole respectively;

[0043] Figure 7 This is the result diagram of the cytotoxicity test of detecting different concentrations of Momordica charantia bryodin II-like RIP protein by CCK-8 in Example 3 of the present invention;

[0044] Figure 8 This is the result diagram of verifying the effect of Momordica charantia bryodin II-like RIP protein on PRV replication by fluorescence quantitative PCR in Example 3 of the present invention; A: The effect on PRV replication under the action of Momordica charantia bryodin II-like RIP concentration of 50 μg / mL; B: The effect on PRV replication under the action of Momordica charantia bryodin II-like RIP concentration of 100 μg / mL;

[0045] Figure 9 This is the result diagram of purifying protein by the buffer used in the early stage of the present invention; M: Protein Marker; 1: Protein flow-through solution; 2-6: Gradient imidazole eluted protein, 20 mM Tris, 50 mM NaCl, containing 20 mM imidazole, 50 mM imidazole, 100 mM imidazole, 200 mM imidazole, 400 mM imidazole respectively. Detailed implementation manners

[0046] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics and implementation schemes of the present invention.

[0047] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. In addition, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0048] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although this invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with those documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0049] Without departing from the scope or spirit of the present invention, various modifications and variations to the specific embodiments of the specification of the present invention will be apparent to those skilled in the art. Other embodiments obtained from the specification of the present invention will be apparent to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0050] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0051] This invention uses bioinformatics methods to screen the RIP gene family in the Momordica charantia L database and obtains 25 Momordica charantia RIPs genes. One Momordica charantia RIP gene was selected. This gene encodes a Momordica charantia bryodinII-like RIP protein, as shown in SEQ ID NO: 2, which is a new Momordica charantia ribosome-inactivating protein. By performing a BLAST alignment of this protein through NCBI, it was found that its homology with the known Momordica charantia MAP30 is 51.02%. Specifically, the Escherichia coli expression system was used for protein expression, and the soluble target protein was purified by nickel column affinity chromatography, and its activity in inhibiting the replication of pseudorabies virus was tested.

[0052] Example 1

[0053] 1. Primer design and synthesis of Momordica charantia RIP gene

[0054] The present invention uses bioinformatics methods to screen the RIP gene family in the Momordica charantia L database, obtaining 25 Momordica charantia L RIPs genes, and selecting one Momordica charantia L gene to search in the CugenDB database, obtaining the complete CDS sequence of this gene in the Momordica charantia L (OHB3-1) v2 genome (see SEQ ID NO:1). According to the vector map of the prokaryotic expression vector pET-28a(+) and the CDS sequence of the target Momordica charantia L gene, through the primer design software (Primer Premier 5.0), the full-length CDS primers of the target gene are designed, and the restriction endonucleases of the gene sequence are screened. The enzymes finally used in the design are Sac I and Sal I (shown by the underlines in Table 1), and the upstream and downstream primers are synthesized by Sangon Biotech Co., Ltd.

[0055] Table 1 Primer Sequences

[0056]

[0057] 2. High-fidelity enzyme (KOD) amplification of the target gene

[0058] The high-fidelity enzyme is also a type of DNA polymerase. Its unique feature lies in its proofreading function, which enables self-correction and greatly reduces the mismatch rate. In the present invention, KOD high-fidelity enzyme is used to perform PCR amplification on the target gene, and the reaction system and reaction program are as shown in Table 2 and Table 3 below.

[0059] Table 2 PCR Reaction System

[0060]

[0061] Table 3 PCR Reaction Program

[0062]

[0063] After the PCR reaction is completed, 15 μL of 6× Loading Buffer is added to the system, and a 1% agarose gel electrophoresis experiment is carried out. The results are shown in Figure 1 , obtaining a specific target band with a size of approximately 942 bp, and the results are consistent with the expectations.

[0064] 3. Gel extraction of the PCR product of the target gene

[0065] a) Equilibrate the adsorption column: Place the adsorption column CA2 into the collection tube, add 500 μL of equilibration buffer BL, centrifuge at 12000 rpm for 1 min, pour out the waste liquid, and then put it back into the collection tube.

[0066] b) Cutting the gel and weighing: Using a gel illuminator, cut out the single DNA band containing the target gene from the agarose gel, try to remove the excess as much as possible, and then put it into a clean centrifuge tube and weigh it.

[0067] c) Dissolving the gel block: Add an equal volume of Solution PN to the gel block, place it in a 50 °C water bath, and gently invert the centrifuge tube up and down continuously during this period to ensure that the gel block is fully dissolved.

[0068] d) Adsorbing DNA: Add the solution obtained in the previous step to Adsorption Column CA2 (the adsorption column is placed in the collection tube), let it stand at room temperature for 2 min, centrifuge at 12000 rpm for 30 - 60 s, pour out the waste liquid in the collection tube, and put Adsorption Column CA2 back into the collection tube. If the sample volume is greater than 800 μL, it can be added in batches.

[0069] e) Rinsing the adsorption column: Add 600 μL of Wash Buffer PW to Adsorption Column CA2 (please check whether absolute ethanol has been added before use), centrifuge at 12000 rpm for 30 - 60 s, pour out the waste liquid in the collection tube, and put Adsorption Column CA2 back into the collection tube.

[0070] f) Removing the residual wash buffer: Put Adsorption Column CA2 back into the collection tube, centrifuge at 12000 rpm for 2 min to remove as much wash buffer as possible. Place Adsorption Column CA2 at room temperature for several minutes to dry thoroughly to prevent the residual wash buffer from affecting the next experiment.

[0071] g) Eluting DNA: Place Adsorption Column CA2 into a clean centrifuge tube, suspend and add an appropriate amount of Elution Buffer EB to the middle position of the adsorption membrane, let it stand at room temperature for 2 min, and centrifuge at 12000 rpm for 2 min to collect the DNA solution. The DNA product should be stored at -20 °C to prevent DNA degradation.

[0072] 4. Digestion of the target gene and ligation with the vector

[0073] According to the restriction endonucleases Sac I and Sal I determined when designing the primers, first digest the recovered PCR product and the empty vector pET-28a(+), and the digestion conditions are 37 °C for 3 - 4 hours. The digestion system is shown in Table 4 below.

[0074] Table 4 Digestion system

[0075]

[0076] After the reaction is completed, add 15 μL of 6×Loading Buffer to the reaction system. Detect the PCR product by 1% agarose gel electrophoresis, and the result is shown in Figure 2 , and at this time, the steps of cutting the gel and recovering the product of the target gene band and the vector band after electrophoresis also need to be repeated.

[0077] Vector ligation: The target gene product after gel extraction and the vector product were ligated with T4 ligase at room temperature for 1 h. The ligation system is shown in Table 5 below.

[0078] Table 5 Ligation system

[0079]

[0080] 5. Transformation of DH5α competent cells

[0081] The competent cells were thawed on ice. The target DNA to be transformed was added to the competent cell suspension, and the contents were gently mixed and placed on ice bath for 30 minutes. The centrifuge tube was placed in a 42 °C water bath for heat shock for 90 s, and then quickly transferred to an ice bath for 2 - 3 minutes, taking care not to shake the centrifuge tube. 900 μL of sterile and antibiotic-free LB medium was added to the centrifuge tube, and the mixture was incubated at 37 °C with shaking at 180 rpm for about 45 min. The purpose is to express the relevant resistance marker genes on the plasmid and to resuscitate the bacteria. 150 μL of the transformed competent cells were evenly spread on an LB agar plate containing kanamycin (Kan, 50 mg / mL), and the plate was inverted and placed in a 37 °C incubator for 12 - 16 hours. After the colonies grew out, positive single colonies were selected according to the morphology and size of the colonies for subsequent identification and culture.

[0082] 6. Single colony PCR and shaking culture

[0083] The LB agar plate cultured overnight was taken out, and the positive single colonies were selected and numbered. A new LB agar plate was prepared, and the numbered positions were marked. The selected positive single colonies were added to the PCR system (see Table 6).

[0084] Table 6 Colony PCR system

[0085]

[0086] The PCR reaction program is shown in Table 7 below.

[0087] Table 7 PCR reaction program

[0088]

[0089] After the reaction, 1% agarose gel was prepared for electrophoresis identification. 7 μL of the sample was loaded and 5 μL of DL2000 Marker was loaded. Electrophoresis was carried out at a constant voltage of 110 V for 25 min, and the gel was photographed and saved under an ultraviolet gel imager. According to the electrophoresis pattern, the correct band, i.e., the positive single colony, was found on the plate. The single colony was picked with a pipette tip and the tip was inserted into the prepared LB liquid medium, and then placed in a shaker at 37 °C and 180 rpm for overnight shaking culture.

[0090] 7. Plasmid extraction and submission for testing

[0091] Operate according to the instruction manual using the TransGen Biotech Plasmid Mini Kit: Take the overnight cultured bacterial solution, centrifuge at 10,000 g for 1 minute, and discard the supernatant. Add the colorless solution RB (containing RNase A), shake to suspend the bacterial pellet, and there should be no small bacterial clumps left. Then add the blue solution LB, gently invert the mixture up and down 4 - 6 times to fully lyse the bacteria and form a blue and transparent solution. Subsequently, add the yellow solution NB, gently mix 5 - 6 times until a firm yellow aggregate is formed. Let it stand at room temperature for 2 minutes, centrifuge the solution at 12,000 g for 1 minute, and discard the effluent. Finally, add 650 μL of solution WB, centrifuge at 12,000 g for 1 minute, discard the effluent, and then centrifuge at 12,000 g for 1 - 2 minutes to completely remove the residual WB. Place the centrifugation column in a clean centrifuge tube, add 31 μL of EB to the center of the column, let it stand at room temperature for 1 minute, and then centrifuge at 10,000 g for 1 minute to elute the DNA and store it at -20°C.

[0092] Example 2

[0093] 1. Transformation of the recombinant plasmid

[0094] Add the successfully constructed plasmid to a 1.5 mL EP tube containing 100 μL of BL21(DE3) competent cells, incubate on ice for 30 min, heat shock in a 42°C water bath for 90 s, and then place it on ice again for 3 min. Add 900 μL of LB liquid medium (without antibiotics) to the tube, mix well, and incubate with shaking at 37°C for 1 h to allow the bacteria to resume normal growth and express the antibiotic resistance gene encoded by the plasmid. Take out the EP tube, centrifuge at 2500 rpm for 5 min, remove the supernatant, and gently pipette to resuspend the bacteria. Spread the above bacterial solution on a screening plate containing kanamycin. After the bacterial solution is completely absorbed by the medium, invert the culture dish and incubate overnight in a 37°C incubator.

[0095] 2. Optimization of the IPTG small-scale induction expression conditions for the Momordica charantia bryodin II-like RIP protein

[0096] Set different induction conditions for the trial expression of the Momordica charantia bryodin II-like RIP protein. To determine the optimal induction concentration and time, first induce the expression at a unified temperature of 28°C on a small scale. Explore the effect of different inducer (IPTG) concentrations on the expression of the target protein. Take out the glycerol bacteria that have been transformed into BL21(DE3) and the pET-28a(+) empty vector and shake them overnight. The next day, inoculate the bacterial solution into a new LB medium containing antibiotics and shake it at 37°C and 200 rpm until the OD 600Around 0.6 - 0.8, 1 mL of the bacterial solution was taken for lysis as the pre - induction sample. Subsequently, IPTG with final concentrations of 0.1 mM, 0.5 mM, 0.8 mM, and 1 mM was added, and it was placed in a shaker at 28°C and 160 rpm. After 8 hours of induction, 1 mL of the bacterial solution was taken for lysis as the post - induction sample. SDS - PAGE detection was carried out using a 12% separating gel.

[0097] The results are shown in Figure 3 , a new protein band appeared at approximately 39 KDa, which was basically consistent with the theoretical predicted value. After the empty pET - 28a(+) was transformed into BL21, no protein band appeared at the same position. The results indicated that 0.8 mM could induce the expression of the target protein. As the concentration increased, the expression level of the target protein did not change significantly. Therefore, 0.8 mM was selected as the induction concentration for subsequent experiments.

[0098] To explore the effect of different induction times on the expression of the target protein, the glycerol bacteria transformed into BL21(DE3) and the empty pET - 28a(+) were taken for overnight shaking culture. The next day, the bacterial solution was inoculated into a new LB medium and shaken at 37°C and 200 rpm until the OD 600 Around 0.6 - 0.8, 1 mL of the bacterial solution was taken for lysis as the pre - induction sample. Subsequently, IPTG with a final concentration of 0.8 mM was added, and it was placed in a shaker at 28°C and 160 rpm. After induction for 2 h, 4 h, 6 h, and 8 h respectively, 1 mL of the bacterial solution was taken for lysis as the post - induction sample. SDS - PAGE detection was carried out using a 12% separating gel.

[0099] The results are shown in Figure 4 , indicating that as the induction time extended, the expression level of the target protein gradually increased, and the expression level was the highest at 39 KDa after 8 hours of induction. Therefore, the induction time was selected as 8 h.

[0100] Based on the above experiments, the optimal induction expression conditions for the bitter gourd bryodin II - like RIP protein were determined as 0.8 mM IPTG, induction expression at 28°C for 8 h, which could not only efficiently induce expression but also improve the expression level of the target protein and the solubility of the protein. Next, this condition was used to express the target protein in large quantities.

[0101] 3. Large - scale induction expression of the bitter gourd bryodin II - like RIP protein and purification of the protein by affinity chromatography

[0102] According to the inoculation amount of 1:500, the glycerol bacteria were added to the LB medium containing kanamycin and cultured overnight at 37°C and 200 rpm. The next day, all were inoculated into a 3 L large conical flask containing kanamycin - resistant LB and cultured at 200 rpm and 37°C until the OD 600It was 0.6 - 0.8. IPTG was added to a final concentration of 0.8 mM, and it was placed in a shaker at 28°C and 160 rpm for 8 h, then centrifuged to collect bacteria and extract proteins.

[0103] Collect bacteria (the following steps are all carried out at low temperature): Centrifuge at 4500 rpm for 15 min, remove the supernatant, resuspend the precipitate in PBS at a ratio of 10 mL / 1 g, collect it in a vial, and ultrasonically lyse it on ice (ultrasonic for 5 s, interval for 5 s, 80% power, total time of 5 min, until the solution becomes clear, which can effectively break cells without damaging the target protein). Centrifuge at 10000 rpm for 30 min, remove the precipitate, filter and sterilize the supernatant with 0.45 μm and 0.22 μm filters, and place it on ice for later use.

[0104] First, fill the silicone tube with water and fix it through a peristaltic pump, keep the connection always with liquid to avoid introducing air bubbles into the system, and then connect it to the HisTrap TM HP 5 mL nickel column. Remove the plug at the bottom of the column, wash the ethanol in the nickel column with 3 column volumes of deionized water, balance the column with at least 5 column volumes of 20 mM sodium phosphate, 0.5 M NaCl, pH 7.41 buffer at a flow rate of 2 mL / min, and then flow the treated supernatant into the nickel column through the peristaltic pump at a speed of 1 mL / min. After the supernatant is loaded onto the column, elute it with buffers containing different imidazole concentrations, namely 20 mM, 50 mM, 100 mM, 200 mM, 400 mM, 500 mM, and keep the flow rate at 2 mL / min. Before this, the binding buffer used by the inventor in the previous purification was 20 mM Tris, 50 mM NaCl, pH 7.5, and the elution buffer was 20 mM Tris 50 mM NaCl, 400 mM imidazole, pH 7.5. Dilute this elution buffer into different imidazole concentrations, namely 20 mM, 50 mM, 100 mM, 200 mM, 400 mM. The lower ionic strength (only 50 mM NaCl) leads to insufficiently tight binding of the target protein to the affinity medium, affecting the purification effect, as shown in Figure 9 shown.

[0105] After improvement, the proteins eluted at different gradients were detected by 12% SDS - PAGE, and the electrophoresis results are shown in Figure 5 and Figure 6 first Figure 5 indicated that after adding IPTG, successful induction of expression occurred, and the protein appeared in the supernatant in a soluble form. Figure 6It is shown that the target protein can be eluted at imidazole concentrations of 200 mM, 400 mM, and 500 mM. The collected solutions at these three concentrations were concentrated using an ultrafiltration tube with a molecular cut-off of 10 kDa. After concentrating to a certain volume, a buffer without imidazole was added, and the salt concentration was diluted by changing the solution. The protein after removing imidazole was aliquoted and glycerol with a final concentration of 10% was added, then quickly frozen with liquid nitrogen and stored at -80 °C.

[0106] The above results show that: the improved binding buffer uses 20 mM sodium phosphate, 0.5 M NaCl, pH 7.41. The higher NaCl concentration (0.5 M) makes the target protein more likely to bind to the affinity medium. The elution buffer is 20 mM sodium phosphate, 0.5 M NaCl, 500 mM imidazole, pH 7.49. The higher imidazole concentration (500 mM) can provide a stronger competitive binding ability and more effectively elute the target protein from the medium. At the same time, the sodium phosphate buffer system has better buffering capacity and chemical stability at high salt and high imidazole concentrations, and can maintain the pH stability of the solution during the elution process. By diluting the elution buffer into different imidazole concentrations (20 mM, 50 mM, 100 mM, 200 mM, 400 mM, 500 mM) for gradient elution, the target protein and impurity proteins can be more precisely separated according to the difference in the binding strength between the protein and the medium, significantly improving the elution efficiency and purity of the protein.

[0107] Example 3

[0108] 1. Detection of the cytotoxic effect of Momordica bryodin II-like RIP protein on cells by CCK-8

[0109] Take an IPEC-J2 cell culture flask with good condition and 80% confluence. After digesting the cells, transfer the suspension to a centrifuge tube and pipette evenly. Set up a cell control group, a cell-free blank group, and an experimental group. Take 10 μL of the suspension for counting, dilute as needed, and evenly inoculate it into a 96-well plate. 100 μL of cell suspension is added to each well of the experimental group and the cell control group, and 100 μL of complete medium is added to each well of the cell-free blank group. After culturing at 37 °C and 5% CO2 until 80% confluence, set up a protein concentration gradient from high to low: 200, 100, 50, 25, 12.5, 6.25 μg / mL, and dilute the protein with the medium. Six replicate wells are set for each concentration. Aspirate the original medium, add the medium containing the protein to the experimental group, and add the complete medium to the cell control group and the cell-free blank group, all 100 μL. Incubate at 37 °C and 5% CO2 for 24 h. Take out the 96-well plate, add 10 μL of CCK-8 solution to each well. During the addition of the reagent, add it slowly to avoid generating bubbles. Place it in a 37 °C and 5% CO2 incubator for 2 h until obvious orange-yellow appears, and then measure the absorbance at 450 nm using a multi-functional microplate reader.

[0110] Calculated according to the cell viability formula, the results are as Figure 7 shown. It was found that protein concentrations of 50, 25, 12.5, and 6.25 μg / mL had basically no effect on cell survival. The protein concentration of 100 μg / mL had a slight effect, but the effect was not significant. The cell viability values were all above 80% compared with the control group. The protein concentration of 200 μg / mL had a relatively significant effect on cell survival. Therefore, a protein concentration range of 6.25 - 100 μg / mL can be selected.

[0111] 2. Verification of the effect of Momordica charantia bryodin II-like RIP protein on PRV replication by fluorescence quantitative PCR

[0112] IPEC-J2 cells were inoculated into a 24-well cell culture plate and cultured in an incubator at 37 °C and 5% CO2. When the cells in the 24-well plate grew to 80% - 90% confluence, an IPEC-J2 cell group, a PRV group, and a PRV + protein experimental group were set up, and each group was set with 3 replicate wells.

[0113] ① In the IPEC-J2 cell group and the PRV group, DMEM medium containing 2% FBS was added. In the PRV + protein experimental group, Momordica charantia RIP proteins with concentrations of 100 μg / mL and 50 μg / mL (diluted with DMEM medium containing 2% FBS) were added respectively, and the volume of each well system was 500 μL. They were pretreated in an incubator at 37 °C and 5% CO2 for 1 h.

[0114] ② After treatment, the liquid was discarded and the cells were washed three times with PBS. Subsequently, the PRV group and the PRV + protein experimental group were respectively added with PRV virus solution diluted with serum-free medium (MOI = 0.1), and 100 μg / mL and 50 μg / mL of Momordica charantia RIP proteins diluted with serum-free medium were also added to the virus solution. The IPEC-J2 cell group was added with serum-free DMEM, and they were incubated in an incubator at 37 °C and 5% CO2 for 1.5 h.

[0115] ③ After virus challenge, wash three times with PBS. Replace the culture medium of the IPEC-J2 cell group and the PRV group with virus maintenance medium (DMEM containing 2% FBS), and replace the culture medium of the PRV virus and Momordica charantia protein experimental groups with 2% FBS DMEM containing 100 μg / mL and 50 μg / mL protein respectively, and continue culturing for 48 h. After 48 h, observe the CPE phenomenon of the cells under a microscope. It can be seen that PRV infection of cells causes a series of pathological changes including cell rounding, detachment and floating, etc. Store in a -80 °C refrigerator, freeze-thaw three times repeatedly, centrifuge at 12,000 rpm for 5 min to collect the supernatant. Transfer 200 μL of the virus stock solution to a 1.5 mL centrifuge tube, and use the SteadyPμre virus DNA / RNA extraction kit to extract virus DNA and perform SYBR Green qPCR. The primers are shown in Table 8 below.

[0116] Table 8 Primer Sequences

[0117]

[0118] The results showed that IPEC-J2 cells were pretreated with Momordica charantia bryodin II-like RIP protein at concentrations of 50 μg / mL and 100 μg / mL respectively, and then infected with PRV. After 48 h, relative quantification of PRV virus copy number was detected by RT-qPCR. The statistical results are shown in Figure 8 , and the results showed that after 48 h of PRV infection, the infection levels of PRV were reduced to varying degrees after pretreatment with both protein concentrations, and the virus amount decreased, indicating that it can effectively inhibit the replication of PRV.

[0119] SEQ ID NO: 1, which is the CDS sequence of Momordica charantia bryodin II-like RIP protein:

[0120] ATGGAGTGTGTGAGGTCATCTGAACCCTTCATTCAACCCCTTCCCTTCAATGATATTGGCATTCATGGTGTGCATGCTAATGGTGCTGTGAATGCTCCCAATTCTAATGTCAGTTTCTCTCTGTTGGGTGCTACTGGCAAAACTTACCAACAGTTCATACAGAATTTGCGTAACGCTCTCACAATCAACTCCAAAATAGTGTACAACATACCGGTGCTAGCGGCCACGGCCTTGAGTTCGGCGCGCTTCATACTAGTCCATCTCACCAACTACAAAAATGAGACCATCACTGTTGCAATTGACGTAGTTAACGTTTATATCGTCGCATATCAAGCTGGAAACAAAGCCTACTTTCTGAAAGATGCCTCAAAAGAAGCAAGAGATGTGCTATTCAAAGGCATCAAGCAAGAAATACTTCCTTACAAAGGCAATTACGACGGCCTCGAGACCGCTGCAGGAAAGATTTCAAGAGAGAAAATTGATCTTGGATTCTCTGAACTAGGCAGTGCTATCGGCAACATGTACCACTATAACGCTGGTACTTCTGTCCCTAGAGCATTCATTGTGATGATTCAGACGATTTCAGAAGCGGCAAGATTTAAGTACATCGAGACAAAAGTTTCACAGAATGTCGAGACTAAATTTAAGCCAGACCCAGGATTCTTAAGCTTAGAGAATCGTTGGTCTGATCTATCTGAACAAGTACAAATTGCACAGAATCGTAAAGGAGAATTTGCTCGTCCTATCGAAGTTCGAAGTGTTACCAACAAACCAATTCTTGTAACGAATGTGAAGTCCAAAGTTGTGGAAGGCATGGCACTGTTGCTTTACAGCAAGCCGAGGGGCAATGGAGATCTAATGGAACTGATGGAAGAGTTCAATAAAGAATGGGAAAATGGTCGAGGTGAATTTGGAATTGACTTCTGA。

[0121] SEQ ID NO: 2, which is the amino acid sequence of the protein ribosome-inactivating protein bryodin II-like [Momordica charantia] encoded by the gene shown in SEQ ID NO: 1:

[0122] MECVRSSEPFIQPLPFNDIGIHGVHANGAVNAPNSNVSFSLLGATGKTYQQFIQNLRNALTINSKIVYNIPVLAATALSSARFILVHLTNYKNETITVAIDVVNVYIVAYQAGNKAYFLKDASKEARDVLFKGIKQEILPYKGNYDGLETAAGKISREKIDLGFSELGSAIGNMYHYNAGTSVPRAFIVMIQTISEAARFKYIETKVSQNVETKFKPDPGFLSLENRWSDLSEQVQIAQNRKGEFARPIEVRSVTNKPILVTNVKSKVVEGMALLLYSKPRGNGDLMELMEEFNKEWENGRGEFGIDF。

[0123] The embodiments described above are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of Momordica charantia ribosome-inactivating protein in any of the following: (1) Application in the preparation of anti-pseudorabies drugs; (2) Application in the preparation of drugs for inhibiting the replication of pseudorabies virus in cells; The amino acid sequence of the Momordica charantia ribosome-inactivating protein is shown as SEQ ID NO:

2.

2. Application of the coding gene of Momordica charantia ribosome-inactivating protein in any of the following: (1) Application in the preparation of anti-pseudorabies drugs; (2) Application in the preparation of drugs for inhibiting the replication of pseudorabies virus in cells; The nucleotide sequence of the coding gene is shown as SEQ ID NO:

1.

3. Application of a recombinant vector containing the coding gene of Momordica charantia ribosome-inactivating protein in any of the following: (1) Application in the preparation of anti-pseudorabies drugs; (2) Application in the preparation of drugs for inhibiting the replication of pseudorabies virus in cells; The amino acid sequence of the Momordica charantia ribosome-inactivating protein is shown as SEQ ID NO: 2, and the nucleotide sequence of the coding gene is shown as SEQ ID NO:

1.

4. Application of a recombinant bacterium containing the coding gene of Momordica charantia ribosome-inactivating protein in any of the following: (1) Application in the preparation of anti-pseudorabies drugs; (2) Application in the preparation of drugs for inhibiting the replication of pseudorabies virus in cells; The coding gene is ligated to an expression vector to construct a recombinant vector, and the coding gene is integrated into the genome of the host bacterium through the recombinant vector; the amino acid sequence of the Momordica charantia ribosome-inactivating protein is shown as SEQ ID NO: 2, and the nucleotide sequence of the coding gene is shown as SEQ ID NO:

1.

5. A method for inhibiting pseudorabies virus for non-therapeutic purposes in vitro, characterized in that, It includes the step of co-culturing Momordica charantia ribosome-inactivating protein with a sample containing pseudorabies virus to inhibit the replication of pseudorabies virus, and the Momordica charantia ribosome-inactivating protein ≤ 100 μg / mL.

Images