Application of FBXO45 inhibitor in preparation of medicine for treating psoriasis

Abstract

The invention discloses application of an FBXO45 inhibitor in preparation of a medicine for treating psoriasis, and belongs to the technical field of biological medicine. According to the application disclosed by the invention, the specific high expression of the FBXO45 in skin lesion tissues of psoriasis patients and imiquimod-induced mouse model skin lesion is found for the first time, and the phenotypes (such as epidermal thickening, inflammatory factor expression and immune cell infiltration) of the psoriasis can be obviously relieved by specifically knocking out the FBXO45 from the skin, so that the FBXO45 is proved to be a potential therapeutic target of the psoriasis. Through virtual screening and molecular docking based on an FBXO45 protein structure, it is found that CD437 can be specifically combined with FBXO45, and the substrate recognition function of the FBXO45 is inhibited. In-vitro experiments show that the CD437 can inhibit the expression level of FBXO45 protein in HaCaT cells, reduce the expression of inflammatory factors such as TNF-alpha and the like, and induce cell apoptosis; in an imiquimod-induced mouse model, the skin lesion symptom (such as reduction of PASI score and reduction of epidermal thickness) is remarkably relieved through local external application of CD437. Therefore, the invention provides a novel FBXO45-targeted small molecule treatment strategy for the psoriasis.

Description

Technical Field

[0001] The present invention belongs to the field of pharmaceutical technology, and particularly relates to the use of FBXO45 inhibitors in the preparation of drugs for treating psoriasis. Background Art

[0002] Psoriasis is a chronic inflammatory disease mediated by the immune system, with a prevalence rate of 2% - 3%. It is a complex disease involving genetic, environmental, and immune factors. On the one hand, psoriasis damages the health of patients. The probability of psoriasis patients combining with other autoimmune diseases, mental diseases, and metabolic syndrome is clearly increased. It destroys the image and appearance of patients, seriously affects the normal social activities of patients, and causes heavy psychological and mental burdens on patients. On the other hand, psoriasis is extremely prone to recurrence and is considered a stubborn skin disease that endangers human health.

[0003] The pathological features of psoriasis mainly include abnormal proliferation of keratinocytes, reduced differentiation and apoptosis, and chronic inflammatory infiltration. Its core pathological mechanism involves the over-activation of the interleukin-23 (IL-23) / T helper 17 (Th17) axis, resulting in the release of pro-inflammatory factors such as IL-17 and tumor necrosis factor-alpha (TNF-α), leading to epidermal thickening, angiogenesis, and immune microenvironment disorder. Although existing treatment methods (such as glucocorticoids and biological agents) can relieve symptoms, many challenges still remain: local treatment has side effects such as skin atrophy, traditional systemic drugs have the risk of hepatotoxicity and nephrotoxicity, and the high cost, drug resistance, and potential infection risk of biological agents limit their long-term application. In addition, existing therapies are insufficiently effective for some refractory patients, and the individualized treatment strategy is not yet perfect. Therefore, the development of new targeted drugs that are safer, more efficient, and economically accessible is still an unmet clinical need.

[0004] FBXO45 is a member of the FBXO family, a highly conserved F-box protein, which is characterized by an F-box domain of about 40 amino acids and is also a component of the E3 ubiquitin ligase. Its classical function is to ubiquitinate substrate proteins for degradation by the proteasome. In addition, FBXO45 may also function as a scaffold protein independent of the E3 ubiquitin ligase. It has been found that the high expression of FBXO45 may be related to the poor prognosis of certain tumors, such as liver cancer, pancreatic cancer, esophageal cancer, and non-small cell lung cancer, etc., but there has been no report on any direct association between FBXO45 and psoriasis.

[0005] CD437 was initially identified as a selective retinoic acid receptor gamma (RARγ) agonist and belongs to the retinoid compounds. Its structure is shown in Formula I. Early studies mainly focused on its ability to regulate cell differentiation and proliferation through the RARγ-dependent pathway, especially its potential therapeutic role in tumors. There is currently no report on the relationship between CD437 and psoriasis.

[0006] Summary of the Invention

[0007] In order to overcome the above-mentioned disadvantages of the prior art, the object of the present invention is to provide the use of FBXO45 inhibitors in the preparation of drugs for the treatment of psoriasis, so as to solve the technical problems of high cost, large side effects and easy drug resistance existing in the current treatment methods of psoriasis.

[0008] In order to achieve the above object, the present invention adopts the following technical solutions:

[0009] In the first aspect of the present invention, the use of FBXO45 inhibitors in the preparation of drugs for the prevention and treatment of psoriasis is disclosed.

[0010] Preferably, the FBXO45 inhibitor is a small molecule chemical inhibitor or siRNA targeting FBXO45.

[0011] More preferably, the small molecule chemical inhibitor is a pharmaceutical composition of CD437 or its pharmaceutically acceptable salt.

[0012] More preferably, the administration dose of CD437 is 10 mg / kg.

[0013] Preferably, the siRNA is siRNA-1 or siRNA-2; the nucleotide sequences of siRNA-1 are shown in SEQ ID NO.38 and SEQ ID NO.39, and the nucleotide sequences of siRNA-2 are shown in SEQ ID NO.40 and SEQ ID NO.41.

[0014] More preferably, the administration dose of siRNA is 2.5 nmol / 25 g.

[0015] Preferably, the drug is a drug that reduces the expression of psoriasis-related inflammatory factors.

[0016] More preferably, the psoriasis-related inflammatory factor is TNF-α.

[0017] Preferably, the drug is a drug that promotes apoptosis.

[0018] Preferably, the drug is a drug that can reduce the proportion of S-phase cells.

[0019] In a second aspect of the present invention, a medicament for preventing and treating psoriasis is disclosed, comprising CD437 and a pharmaceutical excipient, and the dosage form of the medicament is a cream or a gel.

[0020] Preferably, the pharmaceutical excipient is selected from any one or more of fructose, lactose, ribose, arabinose, glucose, mannitol, xylitol, sorbitol, small molecule dextran, calcium gluconate, potassium phosphate, amino acids, and sodium chloride.

[0021] In a third aspect of the present invention, a composition for preventing and treating psoriasis is disclosed, comprising CD437 and other medicaments for treating psoriasis.

[0022] Preferably, the dosage form of the medicament is a cream or a gel.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The application of the FBXO45 inhibitor provided by the present invention in the preparation of a medicament for treating psoriasis firstly reveals that FBXO45 can be used as a key target for treating psoriasis, and verifies that after gene knockout or targeted inhibition, it has a relieving effect on the psoriasis phenotype. Specifically: it is confirmed by clinical samples and an imiquimod (IMQ)-induced animal model that FBXO45 is highly expressed in psoriatic lesions; by using skin conditional Fbxo45 knockout mice, it is demonstrated that the deletion of FBXO45 can relieve the psoriasis phenotype (such as reducing epidermal thickness, decreasing the Psoriasis Area and Severity Index (PASI) score, and reducing the expression levels of inflammatory factors such as IL-17, IL-23, TNF-α, etc.); by using a HaCaT cell model, it is demonstrated that FBXO45 knockdown can inhibit cell proliferation, inhibit the activities of the NF-κb and JAK / STAT3 signaling pathways, and reduce the expression of inflammatory factors (TNF-α, IL1B, CXCL8, and IL23A, etc.). Therefore, the FBXO45 inhibitor has the potential for treating psoriasis.

[0025] Furthermore, through molecular docking and virtual screening, a new target of CD437, FBXO45 (independent of its traditional target RARγ), was discovered; CD437 can relieve the pathological phenotype of psoriasis by inhibiting the FBXO45 protein. The alleviating effect of CD437 on the psoriasis phenotype was verified through experiments, specifically: using the HaCaT cell model, it was demonstrated that CD437 can reduce the FBXO45 protein level; using the HaCaT cell model, it was demonstrated that CD437 can inhibit the expression of the psoriasis inflammatory factor TNF-α (TNF-α decreased by ≥50%), promote cell apoptosis, and inhibit the cell cycle; using the IMQ-induced mouse psoriasis model, it was demonstrated that CD437 can relieve the psoriasis phenotype. Through in vivo experiments on the IMQ psoriasis model, it was proven that topical application of CD437 at a concentration of 0.1-10 mg / mL once or twice a day (a pharmaceutical composition containing CD437 or its pharmaceutically acceptable salt) can improve the psoriasis phenotype, decrease the PASI score, and have no significant skin irritation side effects. Therefore, CD437 can be used as an FBXO45 inhibitor for the treatment of psoriasis, broadening the clinical application scenarios of this molecule and its derivatives. Description of the Drawings

[0026] Figure 1 : Results diagram of bioinformatics analysis of the correlation between FBXO45 expression level and psoriasis; among them, A: Comparison of the transcriptional expression levels of FBXO45 in lesional and non-lesional skin sites of patients not receiving active psoriasis treatment (NN: normal skin tissue; PN: non-lesional skin tissue adjacent to the lesion; PP: lesional tissue), B: Comparison of the FBXO45 expression levels in lesional and non-lesional skin sites of psoriasis patients before and after treatment (PN: non-lesional skin tissue adjacent to the lesion; PP: lesional tissue);

[0027] Figure 2 : Results diagram of immunohistochemical staining analysis of FBXO45 in normal skin (Vehicle) and psoriasis lesions (IMQ) of normal people (Normal), psoriasis patients (Psoriatic), and psoriasis mouse animal models (IMQ-induced Psoriatic Model); among them, A: Human tissue, B: Mouse tissue;

[0028] Figure 3 : Results diagram of the effect of epidermal-specific knockout of FBXO45 on the phenotype of the IMQ-induced mouse psoriasis model; A: Experimental flow chart; B: Appearance phenotype of the mouse back skin before and after IMQ modeling; C: PASI score; D: Epidermal thickness statistics; E: Hematoxylin and eosin (H&E) staining, immunohistochemical staining of Fbxo45 and ki67 in the back lesional tissue; F: Expression levels of inflammatory factors in the back lesional tissue;

[0029] Figure 4 : Results of the effects of FBXO45 knockdown on the in vitro proliferation ability, inflammatory signaling pathways, and expression levels of psoriasis-related inflammatory factors in HaCaT cells; A: In vitro proliferation experiments of HaCaT cells after FBXO45 knockdown (upper panel) and knockout (lower panel). KO#1 is the knockout by #1FBXO45 sgRNA, and KO#2 is the knockout by #2FBXO45 sgRNA; B: After FBXO45 knockdown, western blot was used to detect the expression of proteins in the JAK / STAT signaling pathway, NF-κB signaling pathway, and cell cycle-related proteins; C: qRT-PCR experiments were used to detect the expression changes of psoriasis-related factors after FBXO45 knockdown or knockout.

[0030] Figure 5 : Results of the molecular docking of FBXO45 and the small molecule drug CD437; among them, blue is the SPRY domain of the FBXO45 protein, and yellow is the CD437 molecule.

[0031] Figure 6 : After treating HaCaT cells with CD437, western blot was used to detect the expression level of FBXO45; among them, β-Tublin was used as an internal reference.

[0032] Figure 7 : Results of the detection of TNF-α expression level after treating HaCaT cells with CD437.

[0033] Figure 8 : Results of the apoptosis detection after treating HaCaT cells with CD437; A: Control group, B: Treated with 10 μM CD437, C: Treated with 20 μM CD437, D: Result statistics.

[0034] Figure 9 : Results of the cell cycle detection after treating HaCaT cells with CD437; A: Control group, B: Treated with 10 μM CD437, C: Treated with 20 μM CD437, D: Result statistics.

[0035] Figure 10 : Results of the alleviating effect of CD437 on the psoriasis phenotype induced by IMQ in mice.

[0036] Figure 11 : H&E staining diagram of the skin lesions on the back of mice after CD437 treatment. Specific implementation methods

[0037] To enable those skilled in the art to understand the features and effects of the present invention, the following provides a general description and definition of the terms and phrases mentioned in the specification and claims. Unless otherwise specified, all technical and scientific terms used herein shall have the ordinary meanings understood by those skilled in the art with respect to the present invention. In case of conflicts, the definitions in this specification shall prevail.

[0038] In this article, the open-source GEO database (https: / / www.ncbi.nlm.nih.gov / geo / ) is used for bioinformatics analysis.

[0039] The following further elaborates the present invention in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. In addition, it should be understood that after reading the content described in the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of this application.

[0040] Conventional instrument and equipment in the art are used in the following embodiments. For the experimental methods without specific conditions noted in the following embodiments, they are generally carried out under conventional conditions or according to the conditions recommended by the manufacturer. Various raw materials are used in the following embodiments. Unless otherwise stated, commercially available products are used, and their specifications are the conventional specifications in the art.

[0041] Example 1 Exploring the Correlation between FBXO45 and Psoriasis

[0042] I. Bioinformatics Analysis

[0043] Datasets related to psoriasis were downloaded from the Gene Expression Omnibus (GEO) database. GSE13355 is a microarray analysis of biopsy samples collected from 58 psoriasis patients and 64 normal healthy control subjects. GSE30999 is a microarray analysis of skin biopsy samples (n = 170) collected from 85 moderate to severe psoriasis patients.

[0044] The analysis results are as Figure 1 shown in A below. The expression level of FBXO45 in lesional skin sites without active psoriasis treatment is higher compared to the matched non-lesional sites (P < 0.0001).

[0045] GSE201827 contains gene expression profile data of psoriasis lesions and normal skin adjacent to lesions in 29 psoriasis patients before and after treatment with the IL17 antibody Secukinumab, and the RNA-seq of FBXO45 expression was analyzed.

[0046] The analysis results are as Figure 1As shown in B, before psoriasis patients received IL17 antibody secukinumab treatment, the expression of FBXO45 in the lesional skin was higher than that in the non-lesional skin. After treatment, the expression of FBXO45 in the lesional skin was downregulated compared with that before treatment (P < 0.0001).

[0047] The above bioinformatics analysis showed that FBXO45 was highly expressed in the lesions of psoriasis patients, and after treatment, the expression of FBXO45 in the lesions was downregulated compared with that before treatment. FBXO45 is highly correlated with psoriasis.

[0048] 2. Immunohistochemical Staining

[0049] Skin wax blocks from patients with psoriasis who were clinically and histopathologically confirmed and normal skin tissue wax blocks were collected from the Second Affiliated Hospital of Xi'an Jiaotong University as specimens for FBXO45 immunohistochemical staining.

[0050] 1. Dewaxing of paraffin sections: sequentially place the sections in xylene I for 20 min, xylene II for 20 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, and 75% alcohol for 5 min, then wash with water;

[0051] 2. Antigen repair: Place the tissue sections in a pressure cooker filled with citric acid (pH 6.0) antigen repair solution for antigen repair. Set the jet timer to 2.5 minutes. After natural cooling, place the slides in PBS (pH 7.4) and wash them on a decolorizing shaker for 3 times, 5 minutes each time.

[0052] 3. Block endogenous peroxidase: Place the sections in 0.3% methanol hydrogen peroxide solution, incubate at room temperature in the dark for 20 minutes, place the slides in PBS (pH 7.4) and wash on a decolorizing shaker three times, 5 minutes each time;

[0053] 4. BSA or serum blocking: After the slices are slightly dried, use a histochemical pen to draw a circle around the tissue (to prevent the antibody from flowing away), add 5% BSA in the circle, and block at room temperature for 1 hour.

[0054] 5. Add primary antibody: Gently shake off the blocking solution, add the primary antibody prepared in a certain proportion on the slice, and incubate the slice flat in a humidified box at 4°C overnight (add a small amount of water in the humidified box to prevent the antibody from evaporating);

[0055] 6. Add secondary antibody: Place the slides in PBS (pH 7.4) and wash them on a shaker for 3 times, 8 minutes each time; after gently shaking off the excess liquid from the sections, add biotin-conjugated secondary antibody dropwise within the circle, covering the tissue, and incubate at room temperature for 50 minutes; then place the slides in PBS (pH 7.4) and wash them on a shaker for 3 times, 8 minutes each time; after gently shaking off the excess liquid from the sections, add streptavidin-HRP conjugated tertiary antibody dropwise within the circle, covering the tissue, and incubate at room temperature for 50 minutes; then place the slides in PBS (pH 7.4) and wash them on a shaker for 3 times, 8 minutes each time;

[0056] 7. DAB chromogenic reaction: Place the slides in PBS (pH 7.4) and wash them on a shaker for 3 times, 5 minutes each time; after gently shaking off the excess liquid from the sections, add freshly prepared DAB chromogenic solution dropwise within the circle, control the chromogenic time under the microscope, the positive reaction shows brown-yellow color, and then rinse the sections with tap water to terminate the chromogenic reaction;

[0057] 8. Counterstain the cell nuclei: Counterstain with Harris hematoxylin for about 3 minutes, wash with tap water, differentiate with 1% hydrochloric acid alcohol for several seconds, rinse with tap water, and blue with running water;

[0058] 9. Dehydration and mounting: Immerse the sections successively in 75% alcohol for 6 minutes, 85% alcohol for 6 minutes, absolute ethanol I for 6 minutes, absolute ethanol II for 6 minutes, xylene I for 7 minutes, and xylene II for 7 minutes for dehydration and clearing. Take out the sections from xylene, let them dry slightly, and mount with neutral balsam;

[0059] 10. Examine under the microscope and collect and analyze the images.

[0060] The staining results are as Figure 2 shown in A. The results indicate that in normal human skin tissues, FBXO45 is only slightly expressed in the basal cells of the epidermis and dermal immune cells, while in psoriatic skin lesions, FBXO45 is highly expressed in the entire epidermal layer and infiltrating immune cells.

[0061] From the IMQ-induced psoriatic mice (8-week-old C57 female mice, 5 mice in each of the control group and the IMQ group, depilate 2 cm × 3 cm on the back, apply blank matrix to the control group, and apply 62.5 mg / mouse of IMQ to the IMQ group, evenly apply it on the back and gently massage for absorption), normal skin and psoriatic skin lesions were taken respectively for FBXO45 immunohistochemical staining.

[0062] The immunohistochemical staining results are as Figure 2 shown in B. The results indicate that the expression level of FBXO45 in the skin lesions of the IMQ-induced psoriatic mouse model is also significantly higher than that in normal tissues, and it is mainly expressed in the epidermal layer.

[0063] These results indicate that the high expression level of FBXO45 in the skin epidermis may be closely related to the occurrence of psoriasis.

[0064] Example 2 explores the relationship between specific knockout of FBXO45 in mice and psoriasis

[0065] I. Construction of a skin-specific FBXO45 knockout animal model

[0066] C57BL / 6J-Fbxo45 em1(flox)Cya Mice were purchased from Cyagen Biosciences (Suzhou) Inc., and the mouse genotype identification kit Mouse Direct PCR Kit (for Genotyping) was purchased from Tsingke, with the product number TSE014.

[0067] 1. Breed a sufficient number of FBXO45 fl / fl,K14-Cre mice and FBXO45 fl / fl mice. Step 1: Interbreed (flox / +) heterozygous mice to obtain (flox / flox) homozygous mice. Step 2: Mate a whole-body or tissue-specific Cre transgenic mouse with (flox / +) heterozygous mice or (flox / flox) homozygous mice to obtain [flox / +, Cre(+ / -)] mice. Step 3: Mate [flox / +, Cre(+ / -)] mice with (flox / +) or (flox / flox) to obtain [flox / flox, Cre(+ / -)] mice.

[0068] 2. Identify the mice bred in Step 1. The steps are as follows: ① Obtain the genomic DNA of the mice. Cut the tails or toes of the mice and place them in a sterile 1.5 mL Ep tube. Add the tissue lysate shown in Table 1 to each Ep tube containing the sample, incubate at 55 °C for 30 min, and then heat-treat at 98 °C for 3 min. After thoroughly mixing the lysate, centrifuge it in a refrigerated centrifuge at 4 °C and 12,000 rpm for 5 min, and take the supernatant as the template directly for PCR amplification. ② Identify the genotypes of the mice. (flox / flox) homozygous mice: (flox / +) heterozygous mice are mated with each other to obtain (flox / flox) homozygous mice, and then PCR amplification is performed. The primers are shown as SEQ ID NO.1 and SEQ ID NO.2 in Table 2. The PCR amplification system and procedure are shown in Table 3 and Table 4 respectively. Run the amplified PCR product on a 1% DNA agarose gel and electrophorese at 130 V for 20 min. Observe the band size under ultraviolet light. The PCR result interpretation is shown in Table 5. [flox / +, Cre(+ / -)] mice: Tissue-specific K14Cre tool mice are mated with (flox / flox) homozygous mice to obtain [flox / +, Cre(+ / -)] mice, and then PCR amplification is performed. The primers are shown as SEQ ID NO.3 and SEQ ID NO.4 in Table 2. The PCR amplification system and procedure are shown in Table 6 and Table 7 respectively. Run the amplified PCR product on a 1% DNA agarose gel and electrophorese at 130 V for 20 min. Observe the band size under ultraviolet light. The PCR result interpretation is shown in Table 8. [flox / flox, Cre(+ / -)] mice: [flox / +, Cre(+ / -)] mice are mated with (flox / flox) to obtain [flox / flox, Cre(+ / -)] mice. After obtaining DNA from the mouse tails, use the F1 / R1 and K14-Cre specific primers to determine the (flox / flox, cre) genotype, then induce Cre to enter the nucleus with Tamoxifen, and then take skin tissue to judge the deletion effect through F1 / R2. At the same time, do a good job in mouse propagation. The primers are shown as SEQ ID NO.1 and SEQ ID NO.5 in Table 2. The PCR amplification system and procedure are shown in Table 4. Run the amplified PCR product on a 1% DNA agarose gel and electrophorese at 130 V for 20 min. Observe the band size under ultraviolet light. The PCR result interpretation is shown in Table 9.

[0069] Table 1 Tissue Lysate

[0070] Component Required for a single sample DNA release 4 μL Lysis Buffer 200 μL

[0071] Table 2 Sequence Listing

[0072] Primer name Primer sequence 5’-3’ Serial number F1 CCCTTGTTCATTGTAACCTGGCTT SEQ ID NO.1 R1 TATTTGGCAACTAAACCCCATCTCT SEQ ID NO.2 K14Cre-F CGATGGGAAAGTGTAGCCTGCA SEQ ID NO.3 K14Cre-R TCCAGGTATGCTCAGAAAACGCC SEQ ID NO.4 R2 TGCATTTGTTGTGATAAGGTGAGC SEQ ID NO.5 TNF-α (human)-F TCCTTCAGACACCCTCAACC SEQ ID NO.6 TNF-α (human)-R AGGCCCCAGTTTGAATTCTT SEQ ID NO.7 GAPDH (human)-F CTCCTCCACCTTTGACGCTG SEQ ID NO.8 GAPDH (human)-R TCCTCTTGTGCTCTTGCTGG SEQ ID NO.9

[0073] Table 3 PCR Amplification System (50 μL)

[0074] Reagent components Sample loading volume (μL) GoldMix (green) 25 F1 (10 μM) 0.75 R1 (10 μM) 0.75 Mouse DNA 1.0

[0075] Table 4 Gene PCR Amplification Program

[0076]

[0077]

[0078] Table 5 PCR Result Interpretation

[0079] Genotype Band size flox / flox 337 bp flox / + 337 bp and 267 bp WT 267 bp

[0080] Table 6 PCR Amplification System (50 μL)

[0081] Reagent components Sample loading volume (μL) GoldMix (green) 25 K14Cre-F (10 μM) 0.75 K14Cre-R (10 μM) 0.75 Mouse DNA 1.0

[0082] Table 7 Gene PCR Amplification Program

[0083]

[0084] Table 8 PCR Result Interpretation

[0085] Genotype Band size K14-Cre 449 bp - No band

[0086] Table 9 PCR Result Interpretation

[0087] Genotype Band size FBXO45 skin-specific deletion 255 bp

[0088] II. Psoriasis Modeling

[0089] 1. Dissolve tamoxifen in corn oil to obtain a tamoxifen solution with a concentration of 12.5 mg / mL.

[0090] 2. After grouping FBXO45 floxfl / fl，K14-Cre and FBXO45 fl / fl weigh the mice and calculate the dosage. Inject tamoxifen continuously into each group of mice for 9 days at the same time period every day. The dosage of tamoxifen is 50 mg / kg.

[0091] 3. After the mice in each group rest for one week, carefully shave the hair on the central area of the mouse back with a pet electric hair clipper to form an exposed area of 2 cm × 3 cm, and then use a mild hair removal cream to remove the surface fine hair. Continuously apply 5% IMQ cream (62.5 mg per application for 2 cm × 3 cm skin) to the mouse back skin for 7 days. Apply vaseline to the back of the control group mice. The experimental flow chart is as shown in Figure 3 A below.

[0092] 4. On the eighth day, the mice were sacrificed by cervical dislocation. The skin tissues on the backs of the mice in each group were taken and photographed.

[0093] The results of psoriasis modeling in FBXO45 epidermal-specific knockout mice and non-knockout mice are as Figure 3 shown in B below. The results indicate that epidermal-specific knockout of FBXO45 alleviates the psoriasis phenotype in IMQ mice.

[0094] 5. The mice in each group were scored for psoriasis PASI every day. The PASI scores are as Figure 3 shown in C below. The results indicate that compared with non-knockout mice, the PASI scores of FBXO45 epidermal-specific knockout mice were significantly lower after psoriasis modeling.

[0095] 6. The back skin of the mice in each group was taken and fixed in paraformaldehyde. After paraffin embedding, sections were prepared for immunohistochemistry and H&E staining. The thickness of the back skin of the mice was measured, and RNA was extracted from the back of the mice to detect the expression of inflammatory factors in the back skin.

[0096] III. Paraffin Embedding and Sectioning

[0097] 1. Specimen collection: Fresh mouse skin tissue was fixed in 4% paraformaldehyde for more than 24 h. The tissue was taken out of the fixative and trimmed flat at the target site with a scalpel in the fume hood. The trimmed tissue and the corresponding label were placed in a dehydration box;

[0098] 2. Dehydration: The dehydration box was placed in a hanging basket and dehydrated successively with gradient ethanol in a dehydrator: treated with 75% ethanol for 1 h, 85% ethanol for 1 h, 95% ethanol for 1 h, 95% ethanol for 1 h, absolute ethanol I for 1 h, absolute ethanol II for 1 h, xylene I for 1 h, xylene II for 1 h - wax I for 1 h, wax II for 1 h;

[0099] 3. Embedding: The tissue impregnated with paraffin was embedded in an embedding machine. First, the melted wax was put into an embedding frame. Before the wax solidified, the tissue was taken out of the dehydration box and placed in the embedding frame according to the requirements of the embedding surface, and cooled on a -20°C freezing table. After the wax solidified, the wax block was taken out of the embedding frame and trimmed.

[0100] 4. Sectioning: Sections with a thickness of 4 μm were cut with a paraffin slicer, and the sections were flattened on warm water.

[0101] 5. The tissue sections were picked up with glass slides, dried in an oven after baking the water and wax, and then taken out for storage.

[0102] IV. H&E Staining

[0103] 1. Dewax the paraffin sections to water: sequentially place the sections in xylene I for 8 min, xylene II for 8 min, absolute ethanol I for 6 min, absolute ethanol II for 6 min, 95% alcohol for 6 min, 85% alcohol for 6 min, 75% alcohol for 5 min, and then rinse with running water.

[0104] 2. Stain the cell nuclei with hematoxylin: place the sections in Harris hematoxylin for 3 - 8 min, wash with tap water, then differentiate with 1% hydrochloric acid alcohol for several seconds, rinse with tap water, and blue with running water.

[0105] 3. Stain the cytoplasm with eosin: place the sections in eosin staining solution for 1 - 3 min.

[0106] 4. Dehydrate and mount the sections: sequentially place the sections in 75% alcohol for 30 s, 85% alcohol for 30 s, 95% alcohol for 1 min, 95% alcohol II for 2 min, absolute ethanol I for 5 min, absolute ethanol II for 5 min, xylene I for 5 min, and xylene II for 7 min for dehydration and clearing. Take the sections out of the xylene, let them dry slightly, and mount them with neutral balsam.

[0107] 5. Examine under a microscope and collect and analyze images.

[0108] The thickness of the back skin of mice was measured with software after H&E staining. The results are as Figure 3 shown in D below: The skin of FBXO45 epidermal - specific knockout mice was significantly thinner. After psoriasis modeling, the back skin of FBXO45 epidermal - specific knockout mice was also significantly thinner compared to the non - knockout group.

[0109] H&E staining and immunohistochemical staining are as Figure 3 shown in E below. Compared with wild - type mice, the epidermal thickness of FBXO45 knockout mice decreased. After IMQ psoriasis modeling, the pathological phenotype of psoriasis in FBXO45 knockout mice was significantly alleviated compared with control mice, with a reduced PASI score, less scale, thinner skin thickness, weakened epidermal cell proliferation (decreased Ki67 signal), and reduced inflammatory cell infiltration.

[0110] V. Extract total RNA from tissues

[0111] Throughout the experiment, RNase-free centrifuge tubes and pipette tips were used. Mouse back skin was taken and placed in a 1.5 mL Ep tube. 1 mL of Trizol was added to the centrifuge tube, and after adding grinding beads, the tissue was ground in a tissue grinder until evenly ground. 200 μL of pre-cooled chloroform was added to each tube, vortexed for 15 s, and left to stand at room temperature for 3 min to make the layering obvious. The centrifuge tube was placed in a refrigerated centrifuge and centrifuged at 4°C and 12,000 rpm for 15 min. 400 μL of the supernatant was slowly aspirated into a new Ep tube, 500 μL of pre-cooled isopropanol was added, and the tube was inverted up and down 60 times to mix well. It was left at room temperature for 20 min, then placed in a refrigerated centrifuge and centrifuged at 4°C and 12,000 rpm for 10 min. Then the supernatant was discarded, and a white RNA precipitate could be seen at the bottom of the tube. 800 μL of pre-cooled 75% ethanol was added and the tube was inverted up and down 60 times to make the white precipitate float. It was placed in a refrigerated centrifuge and centrifuged at 4°C and 12,000 rpm for 10 min. Finally, the supernatant was discarded again, and the white RNA precipitate was left to air-dry until semi-transparent. 30 μL of DEPC water was added to dissolve the RNA on ice, and the concentration of the RNA was measured using a NanoDrop micro-spectrophotometer. The extracted RNA samples were stored in an -80°C refrigerator.

[0112] VI. Reverse transcription of cDNA

[0113] Refer to Table 10. 1 μg of the extracted RNA sample was used for reverse transcription to synthesize cDNA according to the cDNA synthesis kit. After mixing the reaction solution, it was centrifuged briefly. The PCR tube was placed in a PCR instrument and reacted according to Table 11. After the reaction was completed, the cDNA samples were stored at -20°C for later use.

[0114] Table 10 Reverse transcription synthesis of cDNA (20 μL reaction system)

[0115] Reagent components Volume / total volume RNA 1 μg 5×iScript RT Supermix 4 μL Nuclease-free water <![CDATA[16μL-V RNA >

[0116] Table 11 Reverse transcription reaction program

[0117] Reaction temperature Duration 37℃ 15 min 85℃ 5s 4℃ Keep

[0118] VII. RT-qPCR

[0119] Specific qPCR primers were designed (sequences are shown in Table 12) and synthesized by Tsingke. According to Table 13, the RT-qPCR reaction components were added. After the reaction solution was thoroughly mixed, it was centrifuged briefly and placed in a real-time fluorescence quantitative PCR instrument for reaction, and the 2 - ΔΔCt method was used to process the data.

[0120] Table 12 qPCR primer sequences

[0121]

[0122] Table 13 RT-qPCR reaction system (10 μL / well)

[0123]

[0124]

[0125] The results of qRT-PCR are as Figure 3 shown in Figure F below. The results show that the transcriptional expression levels of psoriasis-related inflammatory factors (such as TNF-α, IL-17, IL-1β, IL-6, IL-23, IL-22, etc.) in the skin lesion tissues of FBXO45 knockout mice are significantly lower than those of the control. The above results suggest that FBXO45 plays an important role in the occurrence and development of psoriasis.

[0126] Example 3 Effects of FBXO45 knockdown / knockout on the in vitro proliferation ability of keratinocytes, inflammatory signaling pathways, and the expression of psoriasis-related inflammatory factors.

[0127] I. Cell resuscitation

[0128] First, turn on the ultraviolet irradiation of the laminar flow hood for 30 min, and preheat the prepared 1640 complete culture medium in a 37°C water bath. Then, quickly warm the HaCaT cells (the immortalized human keratinocyte cell line HaCaT, which has been stored in the liquid nitrogen tank of our laboratory for a long time) taken out from the liquid nitrogen tank in a 37°C water bath. Then, use a pipette to aspirate the HaCaT cells into a 15 mL centrifuge tube, add 4 mL of 1640 complete culture medium, and pipette and mix well. After that, centrifuge at 2000 rpm at room temperature for 4 min in a centrifuge, discard the supernatant, and resuspend the HaCaT cell pellet thoroughly with 10 mL of 1640 complete culture medium. Transfer the suspension into a 10 cm sterile culture dish and shake well. Finally, place the culture dish in a cell culture incubator containing 5% CO2 at 37°C for continuous culture, and change the cell culture medium every other day.

[0129] II. Cell passage

[0130] When the density of HaCaT cells reaches 80% - 90%, cell passage is carried out. Discard the old culture medium, wash once with sterile PBS, then add 3 mL of trypsin and place it in the cell culture incubator for about 6 minutes. After observing that the cells become round and their adhesion ability weakens under the microscope, terminate the digestion with 2 mL of complete 1640 medium. Use a pipette to blow down the HaCaT cells and transfer them into a sterile 15 mL centrifuge tube. After balancing, centrifuge at 2000 rpm at room temperature for 4 minutes in a centrifuge. Discard the supernatant, and resuspend and mix the cell pellet thoroughly with 5 mL of complete 1640 medium. Aspirate a certain volume of the suspension into a new 10 cm dish, and add complete 1640 medium to 10 mL in the dish. Shake the culture dish by the cross method to evenly distribute the HaCaT cells, and then place it in the cell culture incubator for culture.

[0131] III. Cell Seeding

[0132] Count the digested HaCaT cells, and inoculate each well in the six-well plate according to the cells required for the experiment, adding 2 mL of complete medium to each well. Shake the six-well plate by the cross method, mix well, and then place it in the cell culture incubator for culture.

[0133] IV. Cell Cryopreservation

[0134] When the cell density in the 10 cm dish is observed to be 80% - 90% under the microscope, cell cryopreservation is carried out. Discard the old culture medium, add PBS for washing once. Add 3 mL of trypsin and place it in the cell culture incubator for about 6 minutes. After observing that the cells become round and their adhesion ability weakens under the microscope, terminate the digestion with 2 mL of complete 1640 medium. Use a pipette to blow down the cells and transfer them into a sterile 15 mL centrifuge tube. After balancing, centrifuge at 2000 rpm at room temperature for 4 minutes in a centrifuge. Discard the supernatant, and resuspend and mix the cell pellet thoroughly with 4 mL of complete 1640 medium. Add 900 μL of the suspension and 100 μL of DMSO to each cryotube, then place the cryotubes in a cryobox in an -80 °C refrigerator. After cryopreserving overnight, transfer them to a liquid nitrogen tank for storage the next day.

[0135] V. Knockdown / knockout of FBXO45

[0136] (1) Knockdown of endogenous FBXO45 by siRNA

[0137] Order three siRNAs from GenePharma (including siRNA-1 and siRNA-2 in Table 14, the sequences are shown as SEQ ID NO.38 - SEQ ID NO.41, and the Negative control siRNA as a control, the sequences are shown as SEQ ID NO.42 and SEQ ID NO.43), and store the siRNAs in dry powder state at -80 °C.

[0138] Centrifuge each group of siRNA at room temperature and 12,000 rpm for 5 min, add 62.5 μL of DEPC water to each tube to prepare a solution with a concentration of 20 μM, aliquot it into 1.5 mL Ep tubes, and store at -80 °C.

[0139] Table 14 List of siRNAs for knocking down FBXO45

[0140]

[0141] Culture HaCaT cells in a six-well plate, with 1.5×10 5 cells per well, a total of 6 wells. After the cells adhere, perform transfection. Set up a Ctrl group transfected with Negative control siRNA and an experimental group transfected with the above two siRNAs, with three wells in each group, which are used to extract protein samples and RNA samples respectively. In a 1.5 mL Ep tube for each group, mix 13 μL of Opti-MEM medium and 2 μL of RNAiMAX Transfection Reagent (the amount for one well in the six-well plate), incubate at room temperature for 5 min. In another 1.5 mL EP tube, mix 184 μL of Opti-MEM medium and 1.25 μL of siRNA (20 μM). Then mix the contents of the two 1.5 mL Ep tubes, incubate at room temperature for 20 min, change the medium in the six-well plate to 200 μL per well, evenly drop it into the corresponding wells, and put the cells in the six-well plate into the cell culture incubator and continue to culture for 72 h. Extract protein samples and detect the expression level of FBXO45 by western blot; collect RNA samples and detect the expression level of FBXO45 by qRT-PCR to detect the knockout efficiency.

[0142] The detection results are as Figure 4 shown in B in Figure 4 and C in, after knocking down FBXO45 in HaCaT with specific FBXO45 siRNA, the levels of FBXO45 both at the mRNA level and the protein level decreased, and it was statistically significant.

[0143] (2) Knock out endogenous FBXO45 with sgRNA

[0144] 1) Design sgRNAs for FBXO45 according to Table 15.

[0145] Table 15 List of sgRNAs for knocking out FBXO45

[0146]

[0147] 2) The lentiCRISPRV2 plasmid was digested with BsmBI enzyme alone at 55 °C overnight.

[0148] 3) The digested product was recovered using a DNA purification and recovery kit.

[0149] 4) sgRNA annealing. 95 °C for 2 min, 75 °C for 2 min, 55 °C for 2 min, 25 °C for 2 min.

[0150] 5) The annealed sgRNA was ligated to the digested lentiCRISPRV2.

[0151] 6) The ligation product was transformed into Stbl3 competent cells. 10 μL of the ligation product was added to 100 μL of Stbl3 competent cells and incubated on ice for 30 min, heat-shocked at 42 °C for 45 s, incubated on ice for 2 min, added with 1 mL of antibiotic-free LB, shaken at 37 °C and 750 rpm for 1 h, and plated on an LB plate with Amp, and then incubated upside down in a 37 °C constant temperature incubator overnight.

[0152] 7) Single colonies were picked for sequencing to confirm successful ligation.

[0153] 8) 3 μg of LentiCRISPR-FBXO45, 3 μg of plpVSVG, and psPAX2 plasmids were transfected into 293FT cells. The medium was changed 24 h after transfection, and the supernatant virus was collected 48 h after changing the medium.

[0154] 9) HaCaT cells were infected with the virus and then screened with Amp to obtain HaCaT cells with stable knockout of FBXO45.

[0155] VI. Detection of cell proliferation by CCK8 assay

[0156] 1) Cell preparation

[0157] In a 96-well plate, 2000 cells / 100 μL were seeded in each well, and 200 μL of PBS was added to each peripheral well of the cells to prevent evaporation of the medium. Then the 96-well plate was returned to the incubator for continued culture.

[0158] 2) Detection: After 24 h when the cells adhered, absorbance detection was started, and detection was performed at a fixed time every day for a total of 5 - 6 days until the detection was stopped when all the cells in the 96-well plate were confluent.

[0159] (1) The medium in the wells to be detected was aspirated, and 90 μL of cell culture medium and 10 μL of CCK8 solution were added to each well.

[0160] (2) Incubated in a cell incubator for 2 h.

[0161] (3) Using 650 nm as the reference wavelength, the absorbance value at 450 nm in the wells was detected using a microplate reader.

[0162] (4) Data processing.

[0163] The detection results are as Figure 4 shown in A: After knocking down / knocking out FBXO45 in HaCaT cells, the proliferation of the cells slows down.

[0164] VII. Extraction of cellular RNA

[0165] First, culture HaCaT cells in a six-well plate. After the cells reach 90% confluence, discard the culture medium, add 1 mL of PBS to wash once, and add 1 mL of Trizol lysis solution to each well. Place the six-well plate on a shaker and gently shake for 5 min. Use a pipette to repeatedly pipette the lysis solution to fully lyse the HaCaT cells and collect them into a 1.5 mL RNase-free Ep tube. The remaining steps for cellular RNA extraction are the same as those for tissue RNA extraction.

[0166] VIII. Western blot

[0167] 1. Preparation of protein samples

[0168] Method 1: Culture the required cells in a six-well plate. After the required treatment in the experiment, discard the old culture medium, wash twice with 1 mL of pre-cooled PBS buffer, and aspirate the PBS. Add 100 - 200 μL of Western and IP cell lysis solution (1% PMSF protease inhibitor needs to be added before use to prevent protein degradation) to each well, place on ice for 10 min, scrape the cells with a cell scraper on ice, collect them into a 1.5 mL Ep tube, and place on ice for 10 min to fully lyse the protein. Place the centrifuge tube in a refrigerated centrifuge, centrifuge at 4°C and 12,000 rpm for 15 min, and collect the supernatant into a new Ep tube. Use a BCA protein quantification kit to quantify the extracted protein and adjust different samples to the same concentration. Add 1 / 4 volume of 5× loading buffer (as shown in Table 16) to each tube, mix well, and boil the samples in a metal bath at 100°C for 10 min to denature the protein. The samples can be used immediately or stored in a -20°C refrigerator.

[0169] Table 16 Preparation of 5× loading buffer (100 mL system)

[0170] Reagent components Final concentration Content 1M Tris-HCl (pH6.8) 250 mM 25 mL Glycerol 30％ 30 mL Bromophenol blue 0.05％ 0.05g Sodium dodecyl sulfate 10％ 10g β-mercaptoethanol 5％ 5 μL Sterilized ultrapure water / Quantitatively make up the volume

[0171] Method 2: Cultivate the required cells in a six-well plate. After the treatments required by the experiment, discard the old culture medium, rinse twice with 1 mL of pre-chilled PBS buffer, and aspirate the PBS. Add 1× Laemmli Sample Buffer (as shown in Table 17) to lyse the cells according to the proportion of cells in the six-well plate. Place the six-well plate on a shaker and gently shake for 5 min. After sufficient lysis, collect the sample into a 1.5 mL centrifuge tube. Place the centrifuge tube in a metal bath at 100 °C for 10 min to denature the protein. The sample can be used immediately or stored in a -20 °C refrigerator.

[0172] Table 17 1× Laemmli Sample Buffer (10 mL)

[0173] Reagent components Volume 2×Laemmli Sample buffer 5 mL β-mercaptoethanol 0.5 mL Deionized water 4.5 mL

[0174] 2. Prepare the SDS-polyacrylamide gel. Prepare clean 1.0 mm or 1.5 mm glass plates according to the experimental needs and fix them with clamps on the gel preparation rack. First, prepare the separating gel according to Table 18. After thorough mixing, add it along the gap of the glass plate, and then add anhydrous ethanol to cover the separating gel to flatten it. Let it stand at room temperature for 10 min - 30 min until the separating gel solidifies. Discard the anhydrous ethanol on the separating gel, slightly rinse the glass plate with running water to wash away the excess anhydrous ethanol, blot the excess water with a piece of absorbent paper, and prepare the stacking gel according to Table 19. After adding all the components, mix thoroughly, add it along the gap of the glass plate, quickly insert the sample comb, and let it stand at room temperature for 10 - 30 min until the stacking gel solidifies.

[0175] Table 18 SDS-PAGE Separating Gel Preparation

[0176] Reagent components 8% separating gel (10 m system) 10% separating gel (10 m system) Deionized water 4.6 mL 4 mL 30% Acrylamide 2.7 mL 3.3 mL 1.5M Tris-HCl (pH value 8.8) 2.5 mL 2.5 mL 1.0M Tris-HCl (pH value 6.8) / / 10% SDS 0.1 mL 0.1 mL 10% Ammonium Persulfate 0.1mL 0.1mL TEMED 4μL 4μL

[0177] Table 19 SDS-PAGE Stacking Gel Preparation

[0178] Reagent Components Stacking Gel (3mL System) Deionized Water 2.1mL 30% Acrylamide 0.5mL 1.5M Tris-HCl (pH 8.8) / 1.0M Tris-HCl (pH 6.8) 0.38mL 10% SDS 0.03mL 10% Ammonium Persulfate 0.03mL TEMED 3.0μL

[0179] 3. Electrophoresis. Add sufficient 1× Running Buffer (as shown in Table 20) to both the inner and outer parts of the electrophoresis tank. Add the prepared protein samples into the sample wells one by one according to the experimental needs. Add an appropriate volume (5 μL - 20 μL) of protein sample to each well, with a protein amount of 10 - 30 μg. Add 2.5 μL of protein marker to indicate the protein molecular weight. Electrophorese at a constant voltage of 150 V for 1 h (adjust according to the gel concentration and protein molecular weight). Turn off the power supply to stop electrophoresis when the bromophenol blue indicator band reaches the lower edge of the gel.

[0180] Table 20 1× Running Buffer (1 L system)

[0181] Reagent Components Content / Volume Tris-base 3.03g Glycine 14.4g SDS 1g Deionized Water Make up to 1L

[0182] 4. Membrane transfer. Activate a PVDF membrane of appropriate size (5.2 cm × 8.5 cm) in methanol for more than 15 s in advance, and then place it in 1×Transfer Buffer (as shown in Table 21) for standby. Soak the filter paper in the Transfer buffer for standby. After electrophoresis, open the glass plate, discard the stacking gel, carefully place the separating gel on the filter paper and the PVDF membrane (the membrane on the filter paper), and then place a wet filter paper on the gel. Place them in the order of filter paper - PVDF membrane - gel - filter paper. During the operation, use a roller to remove the air bubbles between the gel and the filter paper. The operation should be fast to avoid the PVDF membrane from drying out. Transfer at 15 V for 1 h (set according to the gel concentration and the molecular weight of the protein).

[0183] Table 21 1×Transfer Buffer (1 L system)

[0184] Reagent Components Content / Volume Tris-base 3.03g Glycine 14.4g Methanol 200mL Deionized Water Make up to 1L

[0185] 5. Blocking. After membrane transfer, take out the PVDF membrane and place it in a blocking solution of 1% BSA / TBST (BSA dissolved in 1×TBST buffer as shown in Table 22), and slowly shake it at room temperature on a shaker for 1 h.

[0186] Table 22 1×TBST buffer (1 L system)

[0187] Reagent Components Content Sodium Chloride 8.00g Tris-base 2.24g Tween-20 1.00mL Sterile Ultra-pure Water Adjust pH to 7.5 - 8.0 and make up the volume

[0188] 6. Primary antibody incubation. After blocking, cut the membrane according to the molecular weight indicated by the marker and the molecular weight of the target protein into the required strips. Dilute the primary antibody with 1% BSA / TBST (BSA dissolved in 1×TBST buffer), and then add it to the antibody incubation tank corresponding to the strip, and incubate it slowly on a shaker at 4°C overnight.

[0189] 7. Secondary antibody incubation. The next day, recover the primary antibody into a 15 mL centrifuge tube, add 1×TBST buffer to each antibody incubation tank, place it on a shaker and shake it quickly for 10 min, and repeat three times. Prepare the corresponding secondary antibody according to the source of the primary antibody. The secondary antibody is 5% skim milk (dissolved in 1×TBST buffer). Add the corresponding secondary antibody to each antibody incubation tank and incubate it slowly at room temperature for 1 h. After the secondary antibody incubation, discard the secondary antibody, add 1×TBST buffer to each antibody incubation tank, place it on a shaker and shake it quickly for 10 min, and repeat three times.

[0190] 8. Detection of protein expression level. Turn on the ECL chemiluminescence instrument in advance, adjust the parameters, mix Solution A and Solution B of the ECL Western Blot luminescent solution at a ratio of 1:1, then soak the strip completely in it for several seconds, and place it in the chemiluminescence instrument for image acquisition. Save the picture and perform gray-scale analysis on the protein strip using software to analyze protein expression.

[0191] The results of Westren blot and qRT-PCR are shown in B and C respectively. After knocking down FBXO45 in HaCaT cells, the expression of the NF-κB signaling pathway-related protein p-65 (Ser536) decreased, the NF-κB signaling pathway was inhibited, the expression of the JAK / STAT signaling pathway-related protein p-stat3 (Tyr705) decreased, and the JAK / STAT signaling pathway was inhibited. The expressions of the cell cycle-related proteins cyclin D1, CDK2, and CDK4 decreased. The mRNA levels of the psoriasis-related inflammatory factors TNF-α, IL-1B, CXCL8, IL-23A, and CCL20 decreased after FBXO45 knockdown. Figure 4

[0192] Example 4 Use of the FBXO45 small molecule inhibitor CD437 for the prevention and treatment of psoriasis

[0193] I. Screening of the FBXO45 small molecule inhibitor CD437

[0194] Based on the prediction of the SPRY domain (residues 152 - 284) of FBXO45 by AlphaFold3 and using PyMOL for visual analysis, the binding interface of FBXO45 (residues 209 - 211, 245 - 248) was determined as the potential drug target, and a docking box with a radius was constructed (central coordinates: X / Y / Z = -3.4 / 2.88 / 41.15). The Topscience Database core library (covering 18,078 compounds) was selected and standardized using OpenBabel 3.1.1, including desalting (retaining neutral molecules), kekulization (eliminating charge differences), and energy minimization. Finally, 17,022 candidate molecules were retained to construct a virtual screening library. AutoDock Vina 1.2.3 (GPU-accelerated mode) was used for high-throughput docking. The molecules were sorted according to the binding energy, and the molecules with higher affinity were selected for subsequent experimental verification.

[0195] It was found that CD437 had a strong affinity for FBXO45, and the molecular docking results are shown in Figure 5 .

[0196] II. Effect of the small molecule inhibitor CD437 on the expression of FBXO45. ​

[0197] HaCaT cells were treated with 10 μM CD437, and protein samples were collected for western blot analysis to detect the expression of FBXO45.

[0198] The results are as Figure 6 shown: CD437 can inhibit the expression of FBXO45 protein.

[0199] III. Effects of the FBXO45 small molecule inhibitor CD437 on the expression of inflammatory factors in HaCaT cells

[0200] HaCaT cells were treated with CD437 (purchased from TargetMol, catalog number T4371, Cas number 125316 - 60 - 1) at a concentration of 10 μM / mL. Meanwhile, untreated HaCaT cells were used as the control group. Total cellular RNA was extracted from each group, reverse transcribed, and then qRT - PCR was performed.

[0201] The detection results are as Figure 7 shown. The expression of the psoriasis - related inflammatory factor TNF - α mRNA decreased in the experimental group. This indicates that CD437 can directly inhibit the expression of the inflammatory factor TNF - α in HaCaT cells, suggesting that CD437 has a certain anti - inflammatory effect.

[0202] IV. Effects of the FBXO45 small molecule inhibitor CD437 on apoptosis of HaCaT cells

[0203] HaCaT cells were treated with different concentrations of CD437 (10 μM and 20 μM), and untreated HaCaT cells were used as the control. Cell culture supernatants from each group were collected into 15 - mL centrifuge tubes. Each well was washed with 1 mL PBS and the PBS was collected into the 15 - mL centrifuge tube. Then, each well was digested with 1 mL trypsin, and the digestion reaction was terminated by adding 2 mL cell culture medium. All cells were detached by pipetting and collected into the centrifuge tube, and centrifuged at 1000×g for 5 min (it is best to use a centrifuge with model 305). The supernatant was removed, and the cells were resuspended in 4 mL pre - cooled PBS and centrifuged again at 1000×g for 5 min. The supernatant was removed, and the cells were resuspended in 50 μL buffer and transferred into 1.5 - mL Ep tubes. 2.5 μL APC and 5 μL PI were added, and after incubation in the dark for 15 min, the staining was terminated by adding 200 μL buffer. Finally, flow cytometry was performed.

[0204] The detection results are as Figure 8 shown. The results indicate that CD437 can promote apoptosis of HaCaT cells.

[0205] V. Effects of the FBXO45 small molecule inhibitor CD437 on the cell cycle of HaCaT cells

[0206] 1. After treating HaCaT cells with CD437, collect the cells for cell cycle detection.

[0207] Collect the cell culture medium into a 15 mL centrifuge tube. Add 1 mL of PBS to each well of the 6-well plate for washing, and collect the PBS into the 15 mL centrifuge tube. Add 1 mL of trypsin to each well for digestion. After digestion, add 2 mL of cell culture medium to terminate the digestion reaction. Pipette to resuspend all the cells and collect them into the centrifuge tube. Centrifuge at 1000×g for 5 min (it is best to use a centrifuge with model 305). Discard the supernatant, add 1 mL of pre-cooled PBS to resuspend the cells, and centrifuge again at 1000×g for 5 min (using a centrifuge with model 305). Discard the supernatant, and leave about 500 μL of PBS to resuspend the cells.

[0208] Cell fixation: Add 4.5 mL of 70% ethanol pre-cooled in a -20°C refrigerator dropwise to the centrifuge tube, vortex while adding, and fix at -20°C for 24 h. Centrifuge at 1000 - 1500×g for 5 min, and aspirate the supernatant. Add 500 μL of pre-cooled PBS to resuspend the cells, centrifuge at 1000 - 1500×g for 5 min, and aspirate the supernatant again.

[0209] 2. Prepare propidium iodide staining solution (add 0.5 mL of staining buffer, 25 μL of propidium iodide staining solution, and 10 μL of RNase for one sample). Add 500 μL of the staining solution to each centrifuge tube, fully resuspend the cell pellet, transfer to a 1.5 mL centrifuge tube, incubate at 37°C in the dark for 30 min, and then perform flow cytometry detection.

[0210] The results of flow cytometry detection are as Figure 9 shown. The results indicate that CD437 can arrest the cell cycle at G1 / S.

[0211] VI. Therapeutic effect of the FBXO45 small molecule inhibitor CD437 on a psoriasis mouse model

[0212] Group wild-type C57 mice at 6 - 8 weeks old, with 5 mice in each group. One group is the blank control (Vehicle). One group is the IMQ group, and one group is the CD437 treatment group (IMQ + CD437 10 mg / kg). Apply a matrix cream to the blank group, apply IMQ 60 mg / kg to the IMQ group, and for the CD437 treatment group, after applying IMQ for three days, continue to model psoriasis by applying IMQ in the morning and apply CD437 for treatment in the afternoon. After continuously applying for four days, sacrifice the mice by cervical dislocation, take the dorsal skin for H&E staining, and evaluate the severity of the skin lesions on the backs of the mice.

[0213] After modeling, the dorsal phenotypes of the mice and the results of H&E staining are as Figure 10 and Figure 11As shown, the results indicate that after treating psoriasis mice with CD437, the skin becomes significantly thinner, hyperkeratosis and parakeratosis are also improved, inflammatory factor infiltration decreases, and the number of blood vessels decreases.

[0214] In summary, FBXO45 is highly expressed in psoriatic lesions. After specifically knocking out FBXO45 in the skin, compared with the non-knockout mice, the psoriatic phenotype of the knockout mice is significantly alleviated. H&E staining shows that the epidermis of the mice becomes thinner, inflammatory factor infiltration decreases, and the number of blood vessels decreases. Through the screening of small molecule drugs for FBXO45, it is found that CD437 has the strongest affinity. Using CD437 in HaCaT cells can inhibit the expression of inflammatory factor TNF-α, promote cell apoptosis, arrest the cell cycle at the G1 / S phase, and decrease the proportion of S-phase cells. After treating psoriasis mice with CD437, the psoriatic phenotype of the mice is significantly improved. H&E staining shows that the skin becomes significantly thinner, inflammatory factor infiltration decreases, and the number of blood vessels decreases. Therefore, the small molecule drug CD437 targeting FBXO45 can be used for the prevention and treatment of psoriasis. Targeting FBXO45 is of great significance in preventing and treating the onset of psoriasis.

[0215] The above content is only to illustrate the technical idea of the present invention and cannot be used to limit the protection scope of the present invention. Any modification made on the basis of the technical solution according to the technical idea proposed by the present invention falls within the protection scope of the claims of the present invention.

Claims

1. Use of FBXO45 inhibitor in the preparation of drugs for preventing and treating psoriasis.

2. The application according to claim 1, wherein The FBXO45 inhibitor is a small molecule chemical inhibitor or siRNA targeting FBXO45.

3. The application according to claim 2, wherein The small molecule chemical inhibitor is a pharmaceutical composition of CD437 or its pharmaceutically acceptable salt.

4. The application according to claim 3, characterized in that The administration dose of CD437 is 10 mg / kg.

5. The application according to claim 2, characterized in that, The siRNA is siRNA-1 or siRNA-2; the nucleotide sequence of siRNA-1 is shown in SEQ ID NO.38 and SEQ ID NO.39, and the nucleotide sequence of siRNA-2 is shown in SEQ ID NO.40 and SEQ ID NO.

41.

6. The application according to claim 5, wherein The administration dose of siRNA is 2.5 nmol / 25 g.

7. The application according to any one of claims 1 to 5, characterized in that, The drug is a drug that reduces the expression of psoriasis-related inflammatory factors, promotes apoptosis, and reduces the proportion of S-phase cells.

8. A drug for preventing and treating psoriasis, characterized in that, It includes CD437 and pharmaceutical excipients, and the dosage form of the drug is cream or gel.

9. A psoriasis prevention and treatment composition, characterized in that, It includes CD437 and other drugs for treating psoriasis.

10. A psoriasis prevention and treatment composition according to claim 9, wherein The dosage form of the drug is cream or gel.

Images