RNAi nano-material as well as preparation method and application thereof

By preparing RNAi nanomaterials containing mitochondrial autophagy inhibitors and sound-sensitizers, combined with ultrasonic irradiation, the problem of low accumulation rate of reactive oxygen species in acoustic dynamic therapy is solved, and the effect of efficient sonic immunotherapy on a variety of cancers is achieved.

CN120285203APending Publication Date: 2025-07-11SUN YAT SEN MEMORIAL HOSPITAL SUN YAT SEN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510381583.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-28
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

Existing acoustic dynamics therapy has the problem of low rate of reactive oxygen accumulation in cancer treatment. Cancer cells can eliminate reactive oxygen species to maintain redox homeostasis, resulting in poor treatment effects.

Method used

An RNAi nanomaterial was developed, containing the mitochondrial autophagy inhibitor siNrf2, a sonic sensitizer and Meo-PEG5k-S-S-PLGA11k copolymer, which was delivered to tumor cells by copolymer coating, inhibit mitochondrial autophagy and downregulate PD-L1 expression, and enhance the immune response in combination with ultrasonic irradiation.

Benefits of technology

Efficient acoustic immunotherapy has been achieved, which enhances the ability of dendritic cells to present tumor antigens to CD8+ T cells, and significantly inhibits the growth of a variety of cancers, including breast cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120285203A_ABST
    Figure CN120285203A_ABST
Patent Text Reader

Abstract

The invention relates to an RNAi nano material as well as a preparation method and application thereof, and belongs to the technical field of biological medicines. The invention provides an RNAi (Ribonucleic Acid Interference) nano material. The RNAi nano material is prepared from a mitochondrial autophagy inhibitor, siNrf2, a sound-sensitive agent and a Meo-PEG5k-S-S-PLGA11k copolymer. According to the invention, the mitochondrial autophagy inhibitor, the Nrf2 small interfering RNA and the sound-sensitive agent are coated with the copolymer to form the RNAi nano material, and the mitochondrial autophagy inhibitor, the Nrf2 small interfering RNA and the sound-sensitive agent can be systematically delivered into tumor cells, so that not only can mitochondrial autophagy with a protection effect be inhibited, but also the tumor cells can be protected; and the expression of programmed death ligand 1 (PD-L1) can be reduced through a nuclear factor-kappa B (NF-kappa B) dependent approach.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and in particular to an RNAi nanomaterial and its preparation method and application. Background Art

[0002] Sonodynamic therapy (SDT) has been regarded as a promising alternative for cancer treatment due to its non-invasive treatment and deep penetration capabilities. It is worth noting that the reactive oxygen species (ROS) mediated by sonodynamic therapy can induce strong immunogenic cell death (ICD), thereby triggering an anti-tumor immune response, and this process is called sonodynamic immunotherapy. However, sonodynamic therapy still has the problem of a relatively low rate of ROS accumulation because cancer cells can scavenge ROS to maintain redox homeostasis. Therefore, there is an urgent need to develop a nanomaterial that can inhibit cancer cell mitophagy and thus improve sonodynamic therapy. Summary of the Invention

[0003] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a reducible-responsive RNA interference (RNAi) nanomaterial that inhibits mitophagy, and its preparation method and application.

[0004] To achieve the above purpose, the technical solutions adopted by the present invention are as follows:

[0005] In a first aspect, the present invention provides an RNAi nanomaterial, including a mitophagy inhibitor, siNrf2, a sonosensitizer, and Meo-PEG 5k -S-S-PLGA 11k copolymer;

[0006] The molar ratio of the mitophagy inhibitor, siNrf2, and the sonosensitizer is mitophagy inhibitor: siNrf2: sonosensitizer = (160 - 960): 1: 180000;

[0007] The ratio of the siNrf2 to the Meo-PEG 5k -S-S-PLGA 11k copolymer is siNrf2: Meo-PEG 5k -S-S-PLGA 11k copolymer = 1 nmol: (3 - 5) mg.

[0008] The present invention encapsulates a mitophagy inhibitor, Nrf2 small interfering RNA, and a sonosensitizer into an RNAi nanomaterial using a copolymer, which can systematically deliver the mitophagy inhibitor, Nrf2 small interfering RNA, and the sonosensitizer to tumor cells, not only inhibiting protective mitophagy but also downregulating the expression of programmed death ligand 1 (PD-L1) through the nuclear factor-κB (NF-κB)-dependent pathway.

[0009] As a preferred embodiment of the RNAi nanomaterial of the present invention, the molar ratio of the mitophagy inhibitor, siNrf2 and the photosensitizer is mitophagy inhibitor: siNrf2: photosensitizer = (320 - 800): 1: 180,000;

[0010] The siNrf2 and the photosensitizer are combined with Meo-PEG 5k -S-S-PLGA 11k The ratio of the copolymer is siNrf2: Meo-PEG 5k -S-S-PLGA 11k copolymer = 1 nmol: 4 mg.

[0011] As a preferred embodiment of the RNAi nanomaterial of the present invention, the molar ratio of the mitophagy inhibitor, siNrf2 and the photosensitizer is mitophagy inhibitor: siNrf2: photosensitizer = (480 - 800): 1: 180,000.

[0012] As a preferred embodiment of the RNAi nanomaterial of the present invention, the molar ratio of the mitophagy inhibitor, siNrf2 and the photosensitizer is mitophagy inhibitor: siNrf2: photosensitizer = (640 - 800): 1: 180,000.

[0013] As a preferred embodiment of the RNAi nanomaterial of the present invention, the molar ratio of the mitophagy inhibitor, siNrf2 and the photosensitizer is mitophagy inhibitor: siNrf2: photosensitizer = 800: 1: 180,000.

[0014] As a preferred embodiment of the RNAi nanomaterial of the present invention, the mitophagy inhibitor includes at least one of 3-methyladenine, Mdivi-1 and bafilomycin A1.

[0015] As a preferred embodiment of the RNAi nanomaterial of the present invention, the siNrf2 is double-stranded RNA, and the nucleotide sequence of the siNrf2 is shown in SEQ ID NO.1 - 2.

[0016] As a preferred embodiment of the RNAi nanomaterial of the present invention, the photosensitizer includes at least one of purpurin-18, hematoporphyrin and titanium dioxide.

[0017] In a second aspect, the present invention provides a method for preparing the above RNAi nanomaterial, comprising the following steps:

[0018] (1) Mix the N,N-dimethylformamide solution of the mitophagy inhibitor with the aqueous solution of siNrf2 to obtain a mixed solution;

[0019] (2) Mix the mixed solution A obtained in step (1) with the N,N-dimethylformamide solution of the photosensitizer, and add Meo-PEG 5k -S-S-PLGA 11k copolymer, and add water at 800-1200 rpm to obtain a suspension;

[0020] (3) Ultrafilter the suspension obtained in step (2), and wash it to obtain the RNAi nanomaterial.

[0021] In a third aspect, the present invention provides the use of the above RNAi nanomaterial in the preparation of an anti-tumor drug and / or device.

[0022] As a preferred embodiment of the use described in the present invention, the anti-tumor drug is an anti-tumor drug based on sonodynamic therapy.

[0023] The present invention has experimentally confirmed that the combination of the RNAi nanomaterial and ultrasonic irradiation can inhibit mitochondrial autophagy and disrupt the antioxidant system, mediating efficient sonodynamic therapy. The strong immunogenic cell death induced by sonodynamic therapy enhances the ability of dendritic cells to present tumor antigens to CD8 + T cells, thereby triggering an adaptive immune tumor response. Combining with the down-regulation of PD-L1 mediated by the mitochondrial autophagy inhibitor, efficient sonodynamic immunotherapy for various cancers including breast cancer is achieved.

[0024] As a preferred embodiment of the use described in the present invention, the sonodynamic therapy is ultrasonic irradiation of the target site.

[0025] As a preferred embodiment of the use described in the present invention, the parameter conditions of the ultrasonic irradiation are 3-5 min, 0.5-1 W / cm 2 、1-3 MHz, 45-55% duty cycle.

[0026] As a preferred embodiment of the use described in the present invention, the parameter conditions of the ultrasonic irradiation are 3 min, 1 W / cm 2 、3 MHz, 50% duty cycle.

[0027] As a preferred embodiment of the use described in the present invention, the anti-tumor drug and / or device includes but is not limited to an anti-breast cancer drug and / or device.

[0028] In a fourth aspect, the present invention provides an anti-tumor drug, comprising the above RNAi nanomaterial and a pharmaceutically acceptable excipient.

[0029] As a preferred embodiment of the anti-tumor drug of the present invention, the dosage form of the anti-tumor drug includes at least one of solid dosage forms, semi-solid dosage forms, liquid dosage forms, gas dosage forms, injection dosage forms, and special dosage forms, and the special dosage forms include, but are not limited to, transdermal patches, implants, suppositories, etc.

[0030] In a fifth aspect, the present invention provides an anti-tumor device, which includes the above-mentioned RNAi nanomaterial and an ultrasonic device.

[0031] As a preferred embodiment of the anti-tumor device of the present invention, the device further includes a label, which records that during the anti-tumor process of administering the above-mentioned RNAi nanomaterial or anti-tumor drug to the required tumor object, the tumor site is ultrasonically stimulated with an ultrasonic device.

[0032] As a preferred embodiment of the anti-tumor device of the present invention, the adjustable parameters of the ultrasonic device include, but are not limited to: 3 - 5 min, 0.5 - 1 W / cm 2 , 1 - 3 MHz, and a duty cycle of 45 - 55%.

[0033] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0034] (1) In the present invention, a mitochondrial autophagy inhibitor, Nrf2 small interfering RNA, and a photosensitizer are coated with a copolymer to form an RNAi nanomaterial, which can systematically deliver the mitochondrial autophagy inhibitor, Nrf2 small interfering RNA, and the photosensitizer to tumor cells, not only inhibiting protective mitochondrial autophagy, but also downregulating the expression of programmed death ligand 1 (PD-L1) through the nuclear factor-κB (NF-κB)-dependent pathway.

[0035] (2) The present invention experimentally confirms that the combination of the RNAi nanomaterial and ultrasonic irradiation can inhibit mitochondrial autophagy and disrupt the antioxidant system, mediating highly efficient sonodynamic therapy. The strong immunogenic cell death induced by sonodynamic therapy enhances the ability of dendritic cells to present tumor antigens to CD8 + T cells, thereby triggering an adaptive immune tumor response. Combined with the downregulation of PD-L1 mediated by the mitochondrial autophagy inhibitor, highly efficient sonodynamic immunotherapy for various cancers including breast cancer is achieved. Description of the Drawings

[0036] Figure 1 It is the particle size distribution diagram of the RNAi nanomaterial obtained in Example 5 of Effect Example 1 of the present invention;

[0037] Figure 2 It is the transmission electron microscope image of the RNAi nanomaterial obtained in Example 5 of Effect Example 1 of the present invention;

[0038] Figure 3 UV-visible absorption spectrum (A) and fluorescence emission spectrum (B) of NPs (3-MA / siNrf2 / P-18) in Effect Example 1 of the present invention;

[0039] Figure 4 Incubation quantity of NPs (3-MA / siNrf2 / P-18) at different times in GSH solution (A) and particle size in normal environment (B) in Effect Example 1 of the present invention;

[0040] Figure 5 Release profiles of siRNA (A), 3-MA (B) and P-18 (C) in NPs (3-MA / siNrf2 / P-18) in GSH solution within 24 h in Effect Example 1 of the present invention;

[0041] Figure 6 UV absorption of NPs (3-MA / siNrf2 / P-18) incubated with SOSG at different ultrasonic irradiation times in Effect Example 1 of the present invention;

[0042] Figure 7 Effects of different RNAi nanomaterials on the expression level of Nrf2 in human MDA-MB-231 cells (A) and 4T1 cells (B) in Effect Example 2 of the present invention;

[0043] Figure 8 Effects of different RNAi nanomaterials on the expression level of Nrf2 in human MDA-MB-231 cells (A) and 4T1 cells (B) in Effect Example 2 of the present invention;

[0044] Figure 9 Effects of different treatments on the proliferation rate of human MDA-MB-231 cells (A) and 4T1 cells (B) in Effect Example 2 of the present invention;

[0045] Figure 10 Effects of different treatments on the growth of human MDA-MB-231 cells (A) and 4T1 cells (B) in Effect Example 2 of the present invention;

[0046] Figure 11 Effects of different treatments on the clone number of human MDA-MB-231 cells (A) and 4T1 cells (B) in Effect Example 2 of the present invention;

[0047] Figure 12 Effects of different treatments on the apoptosis rate of human MDA-MB-231 cells (A) and 4T1 cells (B) in Effect Example 2 of the present invention;

[0048] Figure 13Flow cytometry diagrams of the apoptosis rates of human MDA-MB-231 cells (A) and 4T1 cells (B) under different treatments in Example 2 of the effects of the present invention;

[0049] Figure 14 Effects of different treatments on the expression levels of p62 and LC3 proteins in human MDA-MB-231 cells (A) and 4T1 cells (B) in Example 3 of the effects of the present invention;

[0050] Figure 15 Effects of different treatments on mitochondria and lysosomes in human MDA-MB-231 cells (A) and 4T1 cells (B) in Example 3 of the effects of the present invention;

[0051] Figure 16 Effects of different treatments on the mRNA expression levels of various antioxidant factors in human MDA-MB-231 cells (A) and 4T1 cells (B) in Example 3 of the effects of the present invention;

[0052] Figure 17 Effects of different treatments on the protein levels of various antioxidant factors in human MDA-MB-231 cells (A) and 4T1 cells (B) in Example 3 of the effects of the present invention;

[0053] Figure 18 Confocal fluorescence imaging diagrams of the ROS levels in human MDA-MB-231 cells (A) and 4T1 cells (B) under different treatments in Example 3 of the effects of the present invention;

[0054] Figure 19 Effects of different treatments on the ROS levels in human MDA-MB-231 cells (A) and 4T1 cells (B) in Example 3 of the effects of the present invention;

[0055] Figure 20 Concentrations of siNrf2 in the blood of tumor-bearing mice under different treatments in Example 4 of the effects of the present invention;

[0056] Figure 21 Cy5-labeled fluorescence diagrams of various parts of tumor-bearing mice under different treatments in Example 4 of the effects of the present invention;

[0057] Figure 22 Cy5-labeled statistical diagrams (A) and biodistribution diagrams (B) of tumor-bearing mice under different treatments in Example 4 of the effects of the present invention;

[0058] Figure 23 Effects of different treatments on the expression levels of PD-L1 and Nrf2 proteins in tumor-bearing mice in Example 4 of the effects of the present invention;

[0059] Figure 24 Flow cytometry diagrams of CD8 + cells in the tumor tissues of tumor-bearing mice under different treatments in Example 4 of the effects of the present invention;

[0060] Figure 25 For CD8 + cells (A), GzmB + CD8 cells (B), and IFN-γ + CD8 + cell statistical results in the tumor tissues of tumor-bearing mice with different treatments in Example 4 of the present invention;

[0061] Figure 26 Time axis of treating tumor-bearing mice in Example 5 of the present invention;

[0062] Figure 27 Schematic diagram of tumors (A) and statistical results of tumor weights (B) of tumor-bearing mice with different treatments in Example 5 of the present invention;

[0063] Figure 28 Statistical results of tumor volume changes (A) and body weight changes (B) of tumor-bearing mice with different treatments in Example 5 of the present invention;

[0064] Figure 29 Immunohistochemical analysis results of Ki67 and TUNEL expressions in tumor tissues of tumor-bearing mice with different treatments in Example 5 of the present invention;

[0065] Figure 30 Biochemical index detection results of tumor-bearing mice with different treatments in Example 6 of the present invention;

[0066] Figure 31 HE staining results of each organ in tumor-bearing mice with different treatments in Example 6 of the present invention;

[0067] In the above figures, those marked with "*" indicate significant differences between the two groups (p < 0.05), those marked with "**" indicate significant differences between the two groups (p < 0.01), those marked with "***" indicate significant differences between the two groups (p < 0.001), and those marked with "****" indicate significant differences between the two groups (p < 0.0001);

[0068] G1 is treated with PBS injection, G2 is treated with NPs (3-MA / siCTL / P-18) injection, G3 is treated with NPs (G0-C14 / siNrf2 / P-18) injection, G4 is treated with NPs (3-MA / siCTL / P-18) + US (ultrasonic irradiation) injection, G5 is treated with NPs (G0-C14 / siNrf2 / P-18) + US injection, and G6 is treated with NPs (3-MA / siNrf2 / P-18) + US injection. Detailed implementation manners

[0069] To better illustrate the objectives, technical solutions, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0070] For other materials, reagents, etc. used in the examples, comparative examples, and effect examples, unless otherwise specified, they can all be obtained from commercial sources.

[0071] 3-Methyladenine (hereinafter referred to as 3-MA) was purchased from MedChemExpress, with the product number HY-19312. Before preparing the RNAi nanomaterial, it was formulated into a 5 mg / mL 3-MA solution (the solvent was N,N-dimethylformamide).

[0072] Purpurin-18 (hereinafter referred to as P-18) was purchased from MedChemExpress, with the product number HY-128972. Before preparing the RNAi nanomaterial, it was formulated into a 20 mg / mL P-18 solution (the solvent was N,N-dimethylformamide solution).

[0073] The cationic lipid compound alkyl-modified polyamidoamine dendrimer (hereinafter referred to as G0-C14) was purchased from Suzhou Juling High Polymer Technology Co., Ltd.

[0074] Methoxypolyethylene glycol disulfide poly(lactic-co-glycolic acid) copolymer (hereinafter referred to as Meo-PEG 5k -S-S-PLGA 11k copolymer) was purchased from Suzhou Juling High Polymer Technology Co., Ltd. The molecular weight of polyethylene glycol (PEG) in this copolymer was 5000, and the molecular weight of poly(lactic-co-glycolic acid) copolymer (PLGA) was 11000.

[0075] siNrf2 is a small interfering RNA targeting the Nrf2 gene. Both the siNrf2 and Cy5-labeled siNrf2 of the present invention were prepared by a biological company. The nucleotide sequence of siNrf2 is shown in SEQ ID NO.1-2. Before preparing the RNAi nanomaterial, it was formulated into a 0.1 nmol / μL siNrf2 solution (the solvent was enzyme-free ultrapure water).

[0076] siCTL is a control small interfering RNA of siNrf2. The siCTL of the present invention was prepared by a biological company. The nucleotide sequence of siCTL is shown in SEQ ID NO.3-4. Before preparing the RNAi nanomaterial, it was formulated into a 0.1 nmol / μL siCTL solution (the solvent was enzyme-free ultrapure water).

[0077] The "dT" at the 3' end of the nucleotide sequence of the above siRNA all represents deoxyadenosine (T).

[0078] The MDA-MB-231 cell line is a human-derived breast cancer cell line, and the 4T1 cell line is a mouse-derived breast cancer cell line. The cell culture conditions are 37°C and 5% CO2.

[0079] 4T1 orthotopic tumor-bearing mice can be constructed according to the conventional methods in the art. The following examples of effects were constructed using the following method: 4T1 tumor cells were inoculated into male mice aged 4 - 6 weeks, and 1×10 6 cells were inoculated into each mouse.

[0080] The primer sequences used in qRT-PCR in the following examples of effects are as follows (5’-3’):

[0081] Nrf2-H-F: CACATCCAGTCAGAAACCAGTGG;

[0082] Nrf2-H-R: GGAATGTCTGCGCCAAAAGCTG;

[0083] Nrf2-M-F: CAGCATAGAGCAGGACATGGAG;

[0084] Nrf2-M-R: GAACAGCGGTAGTATCAGCCAG;

[0085] HO-1-H-F: CCAGGCAGAGAATGCTGAGTTC;

[0086] HO-1-H-R: AAGACTGGGCTCTCCTTGTTGC;

[0087] HO-1-M-F: CACTCTGGAGATGACACCTGAG

[0088] HO-1-M-R: GTGTTCCTCTGTCAGCATCACC;

[0089] GR-H-F: TATGTGAGCCGCCTGAATGCCA;

[0090] GR-H-R: CACTGACCTCTATTGTGGGCTTG;

[0091] GR-M-F: GTTTACCGCTCCACACATCCTG;

[0092] GR-M-R: GCTGAAAGAAGCCATCACTGGTG;

[0093] NQO1-H-F: CCTGCCATTCTGAAAGGCTGGT;

[0094] NQO1-H-R: GTGGTGATGGAAAGCACTGCCT;

[0095] NQO1-M-F: GCCGAACACAAGAAGCTGGAAG;

[0096] NQO1-M-R: GGCAAATCCTGCTACGAGCACT;

[0097] SOD-H-F: ACGCTGGCGAGGACGACCTG;

[0098] SOD-H-R: GCTTCTTGCGCTCTGAGTGCTC;

[0099] SOD-M-F: GACCTGGTTGAGAAGATAGGCG;

[0100] SOD-M-R: TGGCTGATGGTTGTACCCTGCA;

[0101] GPX4-H-F: ACAAGAACGGCTGCGTGGTGAA;

[0102] GPX4-H-R: GCCACACACTTGTGGAGCTAGA;

[0103] GPX4-M-F: CCTCTGCTGCAAGAGCCTCCC;

[0104] GPX4-M-R: CTTATCCAGGCAGACCATGTGC;

[0105] Among the above primers, those with "H" represent suitability for qRT-PCR detection in human cells or tissues, and those with "M" represent suitability for qRT-PCR detection in mouse cells or tissues.

[0106] Examples 1 - 6

[0107] Examples 1 - 6 respectively provide an RNAi nanomaterial and its preparation method. The components and dosages of the RNAi nanomaterial are shown in Table 1. The preparation method includes the following steps:

[0108] (1) Mix the mitophagy inhibitor and siNrf2 in N,N-dimethylformamide to obtain a mixed solution A;

[0109] (2) Mix the mixed solution A obtained in step (1) with the photosensitizer, and add Meo-PEG 5k -S-S-PLGA 11kCopolymer, add 5 mL of deionized water at 800 - 1200 rpm to obtain a suspension;

[0110] (3) Ultrafilter the suspension obtained in step (2) (the molecular weight cut-off of the ultrafiltration membrane is 100K), and after washing, obtain the RNAi nanomaterial. Resuspend the RNAi nanomaterial in deionized water and adjust the concentration to 1 nmol / mL.

[0111] Table 1 Components and Dosages of Different RNAi Nanomaterials

[0112]

[0113]

[0114] Comparative Example 1

[0115] Comparative Example 1 provides an RNAi nanomaterial and its preparation method. The components and dosages of the RNAi nanomaterial are similar to those in Example 5, except that 3-MA is replaced by G0-C14, and the other components and dosages remain unchanged. The preparation method is the same as that in Example 5, and this material is named NPs(G0-C14 / siNrf2 / P-18).

[0116] Comparative Example 2

[0117] Comparative Example 2 provides an RNAi nanomaterial and its preparation method. The components and dosages of the RNAi nanomaterial are similar to those in Example 5, except that siNrf2 is replaced by siCTL, and the other components and dosages remain unchanged. The preparation method is the same as that in Example 5, and this material is named NPs(3-MA / siCTL / P-18).

[0118] Comparative Example 3

[0119] Comparative Example 3 provides an RNAi nanomaterial and its preparation method. The components and dosages of the RNAi nanomaterial are similar to those in Example 5, except that siNrf2 is replaced by siCTL and no photosensitizer is added, and the other components and dosages remain unchanged. The preparation method is the same as that in Example 5, and this material is named NPs(3-MA / siCTL).

[0120] Effect Example 1

[0121] Characterize the RNAi nanomaterials obtained in Examples 1 - 6. The specific scheme is as follows:

[0122] 1. Use dynamic light scattering to measure the average particle size, Zeta potential, and polydispersity index (PdI) of the RNAi nanomaterials obtained in Examples 1 - 6. The results are shown in Table 2 and Figure 1 .

[0123] The encapsulation efficiency of the RNAi nanomaterials obtained in Examples 1-6 was determined by dialysis: the RNAi nanomaterials obtained in Examples 1-6 were respectively dispersed in 1 mL of PBS, transferred to a dialysis device containing a molecular weight cutoff of 100 kDa, and added to PBS containing 10 Mm glutathione (hereinafter referred to as GSH) at 37°C. At predetermined time intervals, 5 μL of the solution was extracted and mixed with 100 μL of DMSO. The encapsulation efficiency of siNrf2, 3-MA and P-18 was detected. The results are shown in Table 2.

[0124] Table 2 Average particle size, Zeta potential and PdI values ​​of different RNAi nanomaterials

[0125]

[0126] As shown in Table 2, the method of the present invention can successfully prepare RNAi nanomaterials with an average particle size of 69-82 nm. Based on parameters such as the amount of reagents, the size of the RNAi nanomaterials and the encapsulation rate, the RNAi nanomaterial of Example 5 is selected as the optimal product, and the RNAi nanomaterial of Example 5 is named NPs (3-MA / siNrf2 / P-18).

[0127] 2. Drop 10 μL of NPs (3-MA / siNrf2 / P-18) onto the copper grid and let it stand for 5 min. Then remove the excess sample with filter paper, and then drop 10 μL of 2% v / v uranyl acetate for negative staining for 5 min. Remove the excess sample with filter paper and dry it overnight in the dark. Observe it using a transmission electron microscope. Figure 2 As shown, NPs (3-MA / siNrf2 / P-18) exhibited a uniform spherical shape.

[0128] 3. The UV-visible absorption spectrum of NPs (3-MA / siNrf2 / P-18) was analyzed by UV-visible instrument. Figure 3 The characteristic absorbance peaks of P-18 (413 nm, 548 nm and 700 nm) and 3-MA (279 nm) were observed, which proved the effective self-assembly and encapsulation of P-18 and 3-MA ( Figure 3 A). In addition, the fluorescence (FL) absorbance peak of NPs (3-MA / siNrf2 / P-18) at 720 nm corresponds to the absorbance peak of free P-18 ( Figure 3 B), further confirming the successful loading of the P-18.

[0129] 4. To confirm the status of NPs (3-MA / siNrf2 / P-18) in different environments, a 10 mM GSH aqueous solution was used to simulate the reducing environment in the tumor microenvironment, and PBS, DMEM, or DMEM + 10% v / v FBS was used to simulate the normal physiological environment. The incubation number of NPs (3-MA / siNrf2 / P-18) at different times in 10 mM GSH was measured, as well as the change in the diameter size of NPs (3-MA / siNrf2 / P-18) at different times in the normal physiological environment. The release profiles of siNrf2, 3-MA, and P-18 within 24 h in PBS and PBS solution containing 10 mM GSH were also compared. The results are shown in Figures 4 - 5 .

[0130] As Figures 4 - 5 shown, NPs (3-MA / siNrf2 / P-18) will be destroyed in the reducing environment close to the tumor microenvironment ( Figure 4 A), but are very stable under normal conditions ( Figure 4 B), and siNrf2, 3-MA, and P-18 can be rapidly released in the reducing environment ( Figure 5 ). This indicates that NPs (3-MA / siNrf2 / P-18) are feasible as an effective tool for cancer treatment.

[0131] 5. To evaluate whether singlet oxygen (ROS) can be generated by P-18 after encapsulation under ultrasonic irradiation, a singlet oxygen probe, green singlet oxygen sensor (SOSG), was used to detect the level of ROS in NPs (3-MA / siNrf2 / P-18) after ultrasonic irradiation. The parameter conditions of ultrasonic irradiation were 0 - 5 min, 1 W / cm 2 , 3 MHz, and 50% duty cycle. The results are shown in Figure 6 .

[0132] SOSG can react with the singlet oxygen generated by NPs (3-MA / siNrf2 / P-18). Therefore, as Figure 6 shown, the characteristic absorption peak of the SOSG probe increases sharply with the increase of irradiation time, indicating that NPs (3-MA / siNrf2 / P-18) can generate a large amount of ROS under ultrasonic irradiation and have good sonodynamic effects.

[0133] The above results show that the present invention can successfully prepare spherical RNAi nanomaterials with an average particle size of 69 - 82 nm, coated with 3-MA, siNrf2, and P-18, and this material has good sonodynamic effects and can generate a large amount of ROS under ultrasonic irradiation.

[0134] In the following effect examples, unless otherwise specified, the parameter conditions of the ultrasonic irradiation are all 3 min, 1 W / cm2 、3 MHz, 50% duty cycle.

[0135] Effect Example 2

[0136] To evaluate the in vitro Nrf2 silencing and cellular functions of NPs (3-MA / siNrf2 / P-18), NPs (3-MA / siNrf2 / P-18) were co-cultured with cells, and the specific protocol is as follows:

[0137] 1. To evaluate the effect of NPs (3-MA / siNrf2 / P-18) on the expression level of Nrf2 protein in breast cancer cells, MDA-MB-231 or 4T1 cells were seeded in 6-well plates (50,000 cells per well) and incubated in 2 mL of DMEM containing 10% v / v fetal bovine serum for 24 h. Subsequently, NPs (3-MA / siNrf2 / P-18) were added to the cells at a dose of 0 / 10 / 30 / 50 nM siRNA (i.e., the final concentration of siNrf2 or siCTL in each well was 0 / 10 / 30 / 50 nM). After culturing for 24 h, the medium was refreshed, and the cells were incubated for another 48 h. Then, total RNA and proteins were collected, and the mRNA levels and protein levels of Nrf2 and GAPDH were detected by qRT-PCR and western blot, respectively. The RNAi nanomaterial NPs (3-MA / siCTL / P-18) obtained in Comparative Example 2 was used as a control group, and at least 3 parallels were set for each treatment. The above results are shown in Figures 7 - 8 .

[0138] As Figure 7 shown, NPs (3-MA / siNrf2 / P-18) can effectively reduce the Nrf2 mRNA levels in MDA-MB-231 ( Figure 7 A) and 4T1 ( Figure 7 B), showing a dose-dependence of the silencing effect on siRNA dose. As Figure 8 shown, similar results of Nrf2 protein levels in MDA-MB-231 ( Figure 8 A) and 4T1 ( Figure 8 B) can also be observed after treatment with NPs (3-MA / siNrf2 / P-18). These results indicate that the RNAi nanomaterial prepared in the present invention can release siNrf2 in tumor cells and perform RNA interference well after endocytosis by tumor cells.

[0139] 2. To evaluate the effects of NPs (3-MA / siNrf2 / P-18) on tumor cell viability, proliferation, and apoptosis, MDA-MB-231 or 4T1 cells were seeded in 6-well plates (20,000 cells per well) and incubated in 2 mL of DMEM containing 10% v / v fetal bovine serum for 24 hours. Subsequently, NPs (G0-C14 / siNrf2 / P-18), NPs (3-MA / siCTL / P-18), or NPs (3-MA / siNrf2 / P-18) with a final concentration of 30 nM siRNA were added and subjected to ultrasound irradiation (US). The control group was not irradiated with ultrasound. After 24 hours of culture, the cells were washed with PBS, and the cell proliferation rate was detected using the AlamarBlue method. The results are shown in Figure 9 .

[0140] MDA-MB-231 or 4T1 cells were co-cultured with NPs (G0-C14 / siNrf2 / P-18), NPs (3-MA / siCTL / P-18), or NPs (3-MA / siNrf2 / P-18) according to the above method and subjected to ultrasound irradiation (US). After incubation for 1 week, at least 3 parallels of each treatment were added with crystal violet, and the cell growth was observed under an MVX10 MacroView dissecting microscope equipped with an Olympus DP80 camera. The results are shown in Figures 10 - 11 . Meanwhile, the apoptosis of cells without added crystal violet was analyzed by flow cytometry. The results are shown in Figures 12 - 13 and Table 3.

[0141] Table 3 Statistical results of the number of cell clones in different treatments

[0142] Group Number of clones BLANK 901±65.34 NPs (3 - MA / siNrf2 / P - 18) 880±61.24 NPs (3 - MA / siCTL / P - 18) + US 610±81.65 NPs (G0 - C14 / siNrf2 / P - 18) + US 570±84.10 NPs (3 - MA / siNrf2 / P - 18) + US 190±24.49

[0143] As Figures 9 - 13 and shown in Table 2, in MDA-MB-231 ( Figure 9 A) and 4T1 ( Figure 9 B), the NPs (3-MA / siNrf2 / P-18) + US treatment reduced the cell proliferation rate to approximately 5-fold that of the blank control; the NPs (3-MA / siNrf2 / P-18) + US treatment could significantly inhibit the growth of MDA-MB-231 ( Figure 10 , Figure 11 A) and 4T1 ( Figure 10 , Figure 11 B); the dual inhibition of mitophagy / Nrf2 mediated by NPs (3-MA / siNrf2 / P-18) could enhance SDT-induced apoptosis in MDA-MB-231 ( Figure 12 A, Figure 13 A) and 4T1 ( Figure 12 B,Figure 13 The apoptosis rate of (B).

[0144] In summary, NPs (3-MA / siNrf2 / P-18) can silence the expression of Nrf2 in cells. Combining the SDT efficacy mediated by P-18 and the inhibition of mitophagy by 3-MA can effectively inhibit the proliferation of breast cancer (BCa) cells and enhance their apoptosis.

[0145] Effect Example 3

[0146] Mitophagy is an important mitochondrial quality control mechanism for eliminating damaged mitochondria and ROS. Mitophagy may play a more extensive role in limiting the harmful effects of ROS on cell function. Studies have shown that the accumulation of ROS can be increased by inhibiting mitophagy. Therefore, this effect example evaluated whether this RNAi nanomaterial that inhibits mitophagy can block mitophagy and the Nrf2-related antioxidant system in BCa cells to enhance SDT-mediated ROS accumulation. The specific protocol is as follows:

[0147] p62 is an autophagy substrate that has been widely studied. During the formation of autophagosomes, the expression of p62 protein is negatively correlated with autophagic activity. When autophagy occurs, a small segment of the cytoplasmic LC3-I enzyme is cleaved, and then it binds to phosphatidylethanolamine and is converted into membrane LC3-II. Therefore, the level of autophagy can be estimated from the magnitude of the LC3-II / I ratio.

[0148] 1. Seed MDA-MB-231 or 4T1 cells in 6-well plates (50,000 cells per well) and incubate them in 2 mL of DMEM containing 10% v / v fetal bovine serum for 24 hours. Subsequently, add the RNAi nanomaterial to the cells at a siRNA dose of 30 nM. After culturing for 24 h, update the medium, and incubate the cells for another 48 h. Collect the proteins to detect the LC3 protein level. The results are shown in Figure 14 , and the RNAi nanomaterials used include NPs (3-MA / siCTL / P-18), NPs (G0-C14 / siCTL / P-18), and NPs (3-MA / siCTL).

[0149] As Figure 14 shown, the treatment with NPs loaded with 3-MA can increase the p62 level and decrease the LC3-II / LC3-I ratio in MDA-MB-231 cells and 4T1 cells, indicating a downregulation of the autophagy level.

[0150] 2. Seed MDA-MB-231 or 4T1 cells in 6-well plates (50,000 cells per well) and co-culture them with the RNAi nanomaterial according to the above operation. Locate the mitochondria and lysosomes in the cells using a kit. The results are shown inFigure 15 , the RNAi nanomaterials used include NPs (3-MA / siCTL / P-18) and NPs (G0-C14 / siCTL / P-18).

[0151] As Figure 15 shown, NPs (3-MA / siCTL / P-18) inhibited the localization of mitochondria and lysosomes in MDA-MB-231 and 4T1, indicating that 3-MA-loaded NPs successfully inhibited mitophagy.

[0152] 3-MA is an inhibitor of PI3K and is widely used as an autophagy inhibitor by inhibiting class I PI3K. The above results indicate that the mitophagy-inhibiting RNAi nanomaterials synthesized in the present invention can well exert the autophagy-inhibiting ability of the naked drug 3-MA.

[0153] 3. Inoculate MDA-MB-231 or 4T1 cells into a 6-well plate (50,000 cells per well) according to the above operation, co-culture with RNAi nanomaterials, and perform ultrasonic irradiation. Collect total RNA and protein, and detect the mRNA levels and protein levels of Nrf2, heme oxygenase-1 (HO-1), quinone oxidoreductase (NOQ1), glutathione reductase (GR), superoxide dismutase (SOD), glutathione peroxidase 4 (GPX4), and GAPDH by qRT-PCR and western blot respectively. Measure the intracellular ROS level by fluorescence staining and flow cytometry. The results are shown in Figures 16 - 19 . The experiment was divided into 6 treatment groups, namely G1: PBS; G2: NPs (3-MA / siCTL / P-18); G3: NPs (G0-C14 / siNrf2 / P-18); G4: NPs (3-MA / siCTL / P-18)+US; G5: NPs (G0-C14 / siNrf2 / P-18)+US; G6: NPs (3-MA / siNrf2 / P-18)+US.

[0154] As Figures 16 - 17 shown, after Nrf2 silencing, the mRNA levels ( Figure 16 ) and protein levels ( Figure 17 ) of these antioxidant genes were both down-regulated, and the expression of PD-L1 was affected. As shown by confocal fluorescence imaging ( Figure 18 ) and flow cytometry analysis ( Figure 19 ), it was shown that after treatment with NPs (siNrf2 / 3-MA / P-18), more ROS accumulated in MDA-MB-231 and 4T1 cells.

[0155] In summary, the mitochondria autophagy-inhibiting RNAi nanomaterial constructed in the present invention can indeed cascade the amplification and accumulation of ROS in tumor cells through SDT-mediated Nrf2 silencing and mitochondria autophagy inhibition.

[0156] Effect Example 5

[0157] To evaluate whether the RNAi nanomaterial also has good anti-tumor efficacy in vivo, a tumor-bearing mouse model was constructed and the RNAi nanomaterial was injected for experiments. The specific protocol is as follows:

[0158] 1. The 4T1 orthotopic tumor-bearing mice were randomly divided into three groups and were intravenously injected with naked Cy5-labeled siNrf2 or NPs (3-MA / Cy5-siNrf2 / P-18). The injection dose was NPs (3-MA / Cy5-siNrf2 / P-18) containing 5 mg / kg P-18, 6 mg / kg 3-MA and / or 1 nmol siNrf2, and the dose of naked Cy5-siNrf2 was 1 nmol. Blood samples were collected every 4 h after injection to monitor the siNrf2 concentration in the blood. The tumors and major organs were collected 24 h after injection, imaged using the IVIS LuminaIII imaging system, and quantified by Image-J. The results are shown in Figures 20 - 22 .

[0159] Meanwhile, the 4T1 orthotopic tumor-bearing mice were treated according to the grouping of G1-G6, and the PD-L1 and Nrf2 protein expression levels in the tumor tissues of the mice in each treatment group were detected. The results are shown in Figure 23 , and the grouping of G1-G6 is as follows: G1, PBS; G2, NPs (3-MA / siCTL / P-18); G3, NPs (G0-C14 / siNrf2 / P-18); G4, NPs (3-MA / siCTL / P-18) + US; G5: NPs (G0-C14 / siNrf2 / P-18) + US; G6, NPs (3-MA / siNrf2 / P-18) + US. The injection dose of siRNA was 1 nmol for all groups, and G1 was an equal volume of PBS.

[0160] As Figures 20 - 23 shown, NPs (3-MA / siNrf2 / P-18) showed long-term blood circulation ( Figure 20 ) and good accumulation in tumor tissues ( Figures 21 - 22 ), and significantly inhibited the expression of Nrf2 in tumor tissues and down-regulated the expression of PD-L1 ( Figure 23 ).

[0161] 2. The tumor tissues in the above experiments were analyzed by flow cytometry to analyze the changes in CD8 + cells. AsFigures 24 - 25 As shown, after the combined treatment of NPs (3-MA / siNrf2 / P-18) and ultrasound, significantly more tumor-infiltrating CD8 + T cells and granzyme B + CD8 + T cells and IFN-γ + CD8 + T cells were observed in tumor tissues, suggesting that the adaptive tumor immune response was significantly activated. Since NPs loaded with 3-MA can downregulate PD-L1 in tumor cells to block immune checkpoints, T cell exhaustion was alleviated, resulting in a higher proportion of CD8 + granzyme B + T cells and CD8+ IFN-γ + T cells.

[0162] 3. As Figure 26 shown, 4T1 orthotopic tumor-bearing mice were injected according to the following groups: G1: PBS; G2: NPs (3-MA / siCTL / P-18); G3: NPs (G0-C14 / siNrf2 / P-18); G4: NPs (3-MA / siCTL / P-18) + US; G5 (G0-C14 / siNrf2 / P-18) + US; G6: NPs (3-MA / siNrf2 / P-18) + US. According to Figure 26 the time axis, the tumor tissues of the mice were collected, and the tumor volume, the body weight of the mice, and the immunohistochemical analysis of the expression of Ki67 and TUNEL in the tumor tissues were statistically analyzed. The results are shown in Figures 27 - 29 and Table 4.

[0163] Table 4 Statistical results of tumor volume and weight of mice with different treatments (14 days after treatment, )

[0164] Group Tumor weight (g) <![CDATA[Tumor volume (mm 3 )]]> G1 1.388±0.082 1391.8±81.628 G2 0.968±0.071 966.6±70.819 G3 1.204±0.098 1200.0±88.170 G4 0.498±0.051 486.4±58.024 G5 0.360±0.038 353.8±49.464 G6 0.162±0.060 154.2±49.927

[0165] As Figures 27 - 28 and Table 4 show, NPs (3-Ma / siNrf2 / P-18) and US irradiation can significantly inhibit the development of tumors, but have no significant effect on body weight. Since NPs (3-MA / siCTL / P-18) and NPs (G0-C14 / siNrf2 / P-18) can respectively inhibit protective mitophagy and the Nrf2-related antioxidant system, ultrasound irradiation also induces ROS accumulation within 14 days and inhibits tumor growth within 14 days, suggesting the necessity of the combined treatment of 3-MA and siNrf2. As Figure 29As shown, in the tumor tissues of mice treated with NPs (3-MA / siNrf2 / P-18), more apoptosis (TUNEL staining) and less cell proliferation (Ki67 staining) further confirmed this result.

[0166] In summary, the RNAi nanomaterials of the present invention also have excellent anti-tumor efficacy in vivo, and the combined use of RNAi nanomaterials and ultrasound irradiation can further enhance their anti-tumor efficacy.

[0167] Effect Example 6

[0168] To evaluate the biosafety of the RNAi nanomaterials of the present invention, 4T1 orthotopic tumor-bearing mice were injected according to the operation in Part 3 of Effect Example 5, and peripheral blood was collected according to the Figure 26 time axis for biochemical index detection. After dissecting the mice, the internal organs were taken out for HE staining. The results are shown in Figures 30 - 31 . The biochemical indexes include liver function indexes alanine aminotransferase (ALT), aspartate aminotransferase (AST), serum alkaline phosphatase (ALP) and total protein (TP), and renal function indexes urea (UREA) and creatinine (CREA).

[0169] As Figures 30 - 31 shown, all biochemical indexes are within the normal range; histological analysis of the main organs of the mice shows that there is no obvious difference in HE staining among groups. Preclinical translational application shows that it is feasible and safe to use NPs (3-MA / siNrf2 / P-18) combined with sonodynamic therapy to inhibit tumor progression.

[0170] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. An RNAi nanomaterial, characterized in that, Including a mitophagy inhibitor, siNrf2, a sonosensitizer, and Meo-PEG 5k -S-S-PLGA 11k Copolymer; The molar ratio of the mitochondrial autophagy inhibitor, siNrf2, and the photosensitizer is mitochondrial autophagy inhibitor: siNrf2: photosensitizer = (160 - 960):1:180000; The siNrf2 and Meo-PEG 5k -S-S-PLGA 11k The ratio of the copolymer is siNrf2: Meo-PEG 5k -S-S-PLGA 11k copolymer = 1 nmol : (3 - 5) mg.

2. The RNAi nanomaterial according to claim 1, wherein The molar ratio of the mitochondrial autophagy inhibitor, siNrf2, and the photosensitizer is mitochondrial autophagy inhibitor: siNrf2: photosensitizer = (320 - 800):1:180000; The siNrf2 and the sonosensitizer are combined with Meo-PEG 5k -S-S-PLGA 11k The ratio of the copolymer is siNrf2: Meo-PEG 5k -S-S-PLGA 11k copolymer = 1 nmol: 4 mg.

3. The RNAi nanomaterial according to claim 1, wherein The mitochondrial autophagy inhibitor includes at least one of 3-methyladenine, Mdivi-1, and bafilomycin A1.

4. The RNAi nanomaterial according to claim 1, wherein The siNrf2 is double-stranded RNA, and the nucleotide sequence of the siNrf2 is as shown in SEQ ID NO.1-2.

5. The RNAi nanomaterial according to claim 1, wherein The photosensitizer includes at least one of purpurin-18, hematoporphyrin, and titanium dioxide.

6. The preparation method of the RNAi nanomaterial according to any one of claims 1-5, characterized in that, It includes the following steps: (1) Mix the N,N-dimethylformamide solution of the mitochondrial autophagy inhibitor with the aqueous solution of siNrf2 to obtain a mixed solution; (2) Mix the resulting mixture A in step (1) with the N,N-dimethylformamide solution of the photosensitizer, and add Meo-PEG 5k -S-S-PLGA 11k copolymer, and add water at 800 - 1200 rpm to obtain a suspension; (3) Ultrafilter the suspension obtained in step (2), and wash it to obtain the RNAi nanomaterial.

7. Use of the RNAi nanomaterial according to any one of claims 1-5 in the preparation of an anti-tumor drug and / or device.

8. The application according to claim 7, characterized in that, The anti-tumor drug is an anti-tumor drug based on sonodynamic therapy.

9. An anti-tumor drug, characterized in that, It includes the RNAi nanomaterial according to any one of claims 1-5 and a pharmaceutically acceptable excipient.

10. An anti-tumor device, characterized in that, The anti-tumor device includes the RNAi nanomaterial according to any one of claims 1-5 or the anti-tumor drug according to claim 9, and an ultrasound device.