Bio-organic fertilizer containing burkholderia gladioli and application thereof

Abstract

The invention relates to a bio-organic fertilizer containing burkholderia gladioli and application of the bio-organic fertilizer, and belongs to the technical field of biology. The bio-organic fertilizer provided by the invention takes the fungal polysaccharide, the turf, the seaweed extract and the oil cake as main raw materials, and the main raw materials are combined with the burkholderia gladioli, so that the bio-organic fertilizer has the advantages of improving the plant phosphorus absorption amount, the root soil enzyme activity and the plant root defensive enzyme activity, preventing and treating crop root rot and the like. The invention has the advantages of wide raw materials, low cost, simple preparation method and the like, and has high practicability for environmental safety and agricultural sustainable development.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly relates to a biological organic fertilizer containing Burkholderia gladioli and its application. Background Art

[0002] Fungal diseases are common diseases in plants, which can seriously affect the growth of plants, such as cell rot, leaf withering, inflorescence deformation, etc., and even death. For such diseases, the current prevention and control methods mainly include chemical agent control, biological pesticide control and environmental regulation. Chemical agent control is a method of controlling fungal diseases by using chemical pesticides. Although this method can quickly and effectively control diseases, it is not widely used due to its great harm to the environment and humans. Biological pesticide control uses microbial agents and plant agents to inhibit the growth of pathogens and has gradually become a hot research field. Microbial agents can promote microbial diversity in the soil, increase soil fertility and crop quality, and improve the immunity and resistance of plants. Plant agents control the growth of pathogens through secondary metabolites in plants. In terms of environmental regulation, people can control the spread of pathogens and reduce the occurrence of diseases by improving planting techniques, cultivation environments, irrigation water sources, etc. For example, during the process of planting plants, methods such as adhering to weeding of herbaceous plants, carefully pruning branches and leaves, strengthening ventilation, maintaining appropriate humidity and temperature can be used to control the growth of pathogens.

[0003] Microbial fertilizers contain live microorganisms and can promote the growth of crops. However, the currently used microbial fertilizers usually adopt strains that have been mutated or directionally modified, and these strains are often restricted by environmental factors in actual applications and are difficult to colonize, grow and play their due roles in the soil or plants. Therefore, the research on microbial fertilizers based on natural strains has gradually become a hot spot in this field, but currently there are few microbial agents prepared based on natural microorganisms that can be used in fields such as plant disease prevention.

[0004] In summary, for the prevention and control of fungal diseases in plants, it is necessary to comprehensively utilize means such as chemical agent control, biological pesticide control and environmental regulation. As a new type of fertilizer, microbial fertilizers need to be further studied and applied on the premise of natural strains to improve their preparation technology and application effects. Summary of the Invention

[0005] The object of the present invention is to provide a biological organic fertilizer containing Burkholderia gladioli and its application in Sclerotinia sclerotiorum of celery, root rot of okra, root rot of lettuce, and basal stem rot of ginger in view of the deficiencies of the prior art. The Burkholderia gladioli provided by the present invention is a natural plant rhizosphere bacterium. Compared with genetically engineered bacteria, this strain has better colonization ability in soil and plant rhizosphere. The biological organic fertilizer containing this bacterium has advantages such as preventing and controlling Sclerotinia sclerotiorum of celery, root rot of okra, root rot of lettuce, basal stem rot of ginger, and improving the defensive enzyme activity of plant plants after application.

[0006] On the one hand, the present invention provides a biological organic fertilizer containing Burkholderia gladioli, including fungal polysaccharide, peat, seaweed essence, oil cake, and Burkholderia gladioli bacterial agent in a weight ratio of (7-13):(21-36):(3.4-17):(93-207):(1.5-2). Among them, the effective viable bacteria count in the Burkholderia gladioli bacterial agent is not less than 2×10 10 cfu / g, and the preservation number of the Burkholderia gladioli is CCTCC NO: M 20242288.

[0007] On the second hand, the present invention provides the application of the biological organic fertilizer of the first aspect in preventing and controlling Sclerotinia sclerotiorum of celery, root rot of okra, root rot of lettuce, basal stem rot of ginger, increasing the phosphorus uptake of plants, rhizosphere soil enzyme activity, or increasing the defensive enzyme activity of plant roots.

[0008] Through the above technical solutions, the present invention can at least achieve the following beneficial effects: (1) The Burkholderia gladioli provided by the present invention ( Burkholderia gladioli ) is a natural strain with better colonization ability. Compared with genetically engineered strains or induced mutant strains, it is more conducive to exerting the biocontrol characteristics of the strain, so as to achieve excellent disease control effects.

[0009] (2) The biological organic fertilizer provided by the present invention can effectively regulate the metabolism of plant plants and increase the content of defensive enzymes in plant plants, thereby effectively solving problems such as serious disease occurrence or decreased plant resistance during plant growth. In addition, when the Burkholderia gladioli provided by the present invention is added to the biological organic fertilizer, the systemic resistance of plant plants can be further improved. Through the combined use of Burkholderia gladioli and auxiliary materials, the present invention provides a new technical solution for the prevention and control of Sclerotinia sclerotiorum of celery, root rot of okra, root rot of lettuce, and basal stem rot of ginger. This solution has high practicability and conforms to the current sustainable development direction of agricultural production.

[0010] (3) The bio-organic fertilizer provided by the present invention has the characteristics of wide raw material sources, low cost, and environmental friendliness. At the same time, the preparation method of this fertilizer is also very simple and has high storage stability. By selecting the types and dosages of raw materials in the fertilizer, the viable count reaches a relatively high level when Burkholderia gladioli is added.

[0011] (4) The methods for preventing and treating Sclerotinia sclerotiorum of celery, root rot of okra, root rot of lettuce, and basal stem rot of ginger provided by the present invention are simple and feasible, will not have an adverse impact on environmental safety, and can promote the sustainable development of agricultural production.

[0012] Biological preservation Burkholderia gladioli YNK-FB0053 was deposited at the China Center for Type Culture Collection on October 21, 2024 ( Burkholderia gladioli ), with the address being Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the deposit number being CCTCC NO: M 20242288. This strain has been disclosed in the invention patent with the application number CN2024118276363. Specific implementation manners

[0013] In the ranges disclosed herein, the endpoints and any values are not limited to the exact ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of each range, between the endpoint values of each range and individual point values, and between individual point values can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed herein.

[0014] In the present invention, Burkholderia gladioli YNK-FB0053 and Burkholderia gladioli CCTCC NO: M 20242288 are the same strain, and their meanings are the same, and their names (numbers) can be used interchangeably.

[0015] During the research process, the inventors of the present invention isolated a strain of Burkholderia gladioli ( Burkholderia gladioli ), named YNK-FB0053, which was deposited at the China Center for Type Culture Collection on October 21, 2024, with the deposit number being CCTCC NO: M 20242288.

[0016] The present invention provides a bio-organic fertilizer containing Burkholderia gladioli, including fungal polysaccharides, peat, seaweed essence, oil cake, and Burkholderia gladioli CCTCC NO: M 20242288 (or a bacterial agent prepared based on this strain).

[0017] When the inventors of the present invention studied and found that the biological organic fertilizer containing Burkholderia gladioli provided by the present invention was applied to the soil, it could effectively control Sclerotinia sclerotiorum of celery, root rot of okra, root rot of lettuce, and stem base rot of ginger, improve the phosphorus uptake of plant plants, the enzyme activity of rhizosphere soil or the activity of defensive enzymes, thereby promoting plant growth and improving the systemic resistance of plants, and reducing the use amount of chemical pesticides.

[0018] Among them, the biological organic fertilizer includes fungal polysaccharide, peat, seaweed essence, oil cake, and Burkholderia gladioli bacterium agent with a weight ratio of (7 - 13):(21 - 36):(3.4 - 17):(93 - 207):(1.5 - 2). Among them, the effective viable bacteria count in the Burkholderia gladioli bacterium agent is not less than 2×10 10 cfu / g, and the preservation number of the Burkholderia gladioli is CCTCC NO: M 20242288.

[0019] According to a preferred embodiment of the present invention, among them, in the fungal polysaccharide, the water content is 30 - 35% by weight, based on dry matter, the sugar content is 30 - 50% by weight, the soluble colloid content is 15 - 25% by weight, the mineral content is 5 - 15% by weight, and the crude protein content is 2 - 8% by weight; In the oil cake, the water content is 20 - 30% by weight, based on dry matter, the sugar content is 40 - 50% by weight, the crude protein content is 5 - 10% by weight, and the mineral content is 10 - 15% by weight; In the peat, the water content is 10 - 15% by weight, based on dry matter, the organic matter content is 50 - 60% by weight, the humic acid content is 35 - 40% by weight, the nitrogen content is 2 - 3% by weight, the phosphorus content is 0.1 - 1% by weight, and the potassium content is 0.1 - 1% by weight.

[0020] The present invention has no special restrictions on the specific components and sources of the selected auxiliary materials. It can be directly obtained through commercial purchase or can also be related products prepared according to the existing technology.

[0021] The inventors of the present invention found in the research that when using seaweed essence as a fertilizer synergist and applying it to the biological organic fertilizer provided by the present invention, not only can the control effect be further improved, but also the defensive protein activity of crops, especially plant plants, and the enzyme activity of rhizosphere soil can be improved. In addition, in the biological organic fertilizer containing Burkholderia gladioli, using fungal polysaccharide as a synergist can further increase the viable bacteria count in the organic fertilizer.

[0022] According to a preferred embodiment of the present invention, among them, the Burkholderia gladioli is the Burkholderia gladioli with the preservation number of CCTCC NO: M 20242288.

[0023] In the present invention, disease control refers to reducing the incidence of diseases and increasing the activity of defensive enzymes in plant plants (such as increasing the activities of superoxide dismutase, polyphenol oxidase, and catalase in crops, etc.).

[0024] In the present invention, soil nutrient improvement refers to increasing soil biological indexes (such as increasing the enzyme activity in the soil, etc.).

[0025] The fifth aspect of the present invention provides a method for controlling Sclerotinia sclerotiorum of celery, root rot of okra, root rot of lettuce, and stem base rot of ginger, and the method includes applying a bio-organic fertilizer containing Burkholderia gladioli to the soil of plant roots.

[0026] In the present invention, there is no particular limitation on the specific application method of the microbial agent or bio-organic fertilizer, and any commonly used fertilization method in the soil in the art can be applicable to the present invention. For example, the soil around the plant can be trenched first, and then the bio-organic fertilizer of the present invention can be used for root irrigation and then covered with soil, or the bio-organic fertilizer of the present invention can be directly poured on the rhizosphere of the plant.

[0027] In the present invention, there is no particular limitation on the specific dosage of the bio-organic fertilizer, as long as it can play the role of reducing the incidence of diseases and increasing the activity of defensive enzymes in plant plants.

[0028] According to a preferred embodiment of the present invention, wherein the application amount of the bio-organic fertilizer is based on the dosage of Burkholderia gladioli not less than 1×10 9 cfu / plant / time. Preferably 1×10 9 -1×10 13 cfu / plant / time. More preferably 3×10 9 -3×10 11 cfu / plant / time. For example, it can be 3×10 9 cfu / plant / time, 4×10 9 cfu / plant / time, 5×10 9 cfu / plant / time, 6×10 9 cfu / plant / time, 8×10 9 cfu / plant / time, 1×10 10 cfu / plant / time, 5×10 10 cfu / plant / time, 8×10 10 cfu / plant / time, 1×10 11 cfu / plant / time, 2×10 11 cfu / plant / time, 3×10 11 cfu / plant / time, or it can also be any intermediate value of any two of the above values.

[0029] When the fungal polysaccharide, peat, seaweed extract, oil cake and Burkholderia gladioli provided by the present invention are used together, they have a synergistic effect. In order to obtain better results, the dosage of Burkholderia gladioli can be appropriately increased.

[0030] According to a preferred embodiment of the present invention, the dosage of the bio-organic fertilizer applied to the soil can be 50 - 80 kg / mu / time; preferably 50 - 60 kg / mu / time.

[0031] Preferably, the application frequency of the bio-organic fertilizer is once for each crop of plants.

[0032] The present invention will be described in detail below through examples. It should be understood that the following examples are only used to further explain and illustrate the content of the present invention, rather than to limit the present invention.

[0033] Example 1 Preparation of Bio-organic Fertilizer This example is used to illustrate the preparation process of the bio-organic fertilizer provided by the present invention.

[0034] It includes the following steps: (1) Solid-culture the above-mentioned Burkholderia gladioli in a solid medium to obtain test-tube seeds; (2) Prepare a liquid seed medium, and inoculate the test-tube seeds into it for liquid culture to obtain liquid seeds; (3) Prepare a liquid fermentation medium, and inoculate the liquid seeds into it for fermentation.

[0035] In step (1), the Burkholderia gladioli is inoculated by the method of slant inoculation, and the solid culture is carried out at a temperature of 25 - 30°C for 40 - 50 h; the solid medium includes: glucose 10 - 12 g / L, agar 15 - 20 g / L, beef extract 3 - 5 g / L, yeast extract 1 - 3 g / L, peptone 10 - 15 g / L, pH = 6.5 - 7.5.

[0036] In step (2), the test-tube seeds are inoculated into the liquid seed medium, and the liquid culture is carried out at a temperature of 25 - 30°C and a rotation speed of 200 - 250 r / min for 45 - 50 h; the liquid seed medium includes: peptone 10 - 15 g / L, beef extract 3 - 5 g / L, sodium chloride 10 - 12 g / L, pH = 6.5 - 7.5.

[0037] In this step, the liquid seed medium is preferably sterilized at 120 - 125°C for 20 - 30 min. After cooling, 0.5 - 1.5 cm is inoculated into 100 mL of the liquid seed medium. 2Tube seeds, and cultivate them on a shaker at 220 - 250 r / min at 28 - 30 °C for 45 - 50 h to obtain liquid seeds.

[0038] In step (3), the liquid seeds are inoculated into the liquid fermentation medium at an inoculation amount of 0.05 - 0.1:1 by volume, and treated at a temperature of 25 - 30 °C and a rotation speed of 200 - 250 r / min for 45 - 50 h; the liquid fermentation medium includes: 20 - 23 g / L of sucrose, 10 - 15 g / L of peptone, 5 - 8 g / L of yeast extract, 3 - 5 g / L of potassium dihydrogen phosphate, 5 - 8 g / L of ammonium sulfate, 2 - 4 g / L of calcium carbonate, pH = 6.5 - 7.5.

[0039] In this step, the liquid fermentation medium is preferably sterilized at 120 - 125 °C for 20 - 30 min, cooled and then inoculated with liquid seeds, and preferably cultivated on a shaker at 220 - 250 r / min at 28 - 30 °C for 45 - 50 h to obtain the fermentation broth.

[0040] The above preparation steps further include: After the cultivation, dilute the obtained culture solution with an appropriate amount of fresh NB medium to obtain a Burkholderia gladioli liquid bactericide with a viable count of about 2×10 10 cfu / ml. Dry the liquid bactericide to obtain a dry powder preparation with a viable count of about 2×10 10 cfu / g.

[0041] The formula of the biological organic fertilizer is shown in Table 2 in detail. The detection results of the material components of fungal polysaccharide, oil cake and peat are shown in Table 1 (where the water content is calculated based on the total weight of the material, and the other components are calculated based on the dry matter in the material). The sugar content in the fungal polysaccharide is determined by the sulfuric acid - phenol method, the soluble colloid content is determined by the 3,5 - dimethylphenol colorimetric method, the mineral content is determined by atomic absorption spectrophotometry, the crude protein content is determined by the Kjeldahl method. The organic matter content is determined by ultraviolet spectrophotometry, the humic acid content is determined by the sodium pyrophosphate alkali extraction method, the nitrogen content (calculated as N) is determined by the Kjeldahl method, the phosphorus content (calculated as P2O5) is determined by the molybdenum antimony resistance colorimetric method, and the potassium content (calculated as K2O) is determined by flame photometry. The water content in the detection results is calculated based on the total weight of the material, and the other components are calculated based on the dry matter in the material.

[0042] The fungal polysaccharide is purchased from Xi'an Wanfang Biotechnology Co., Ltd., the peat is purchased from Guangzhou Guangyu Biotechnology Co., Ltd., the seaweed essence is purchased from Shanghai Fushi Biological Technology Co., Ltd., and the oil cake is purchased from Liuzhou Jinqianwan Molasses Co., Ltd.

[0043] Table 1 Material components of biological organic fertilizer

[0044] Table 2 Formula of Biological Organic Fertilizer

[0045] Preparation of Biological Organic Fertilizer Containing Burkholderia gladioli in Example 2 This example is used to illustrate the application effect of the biological organic fertilizer containing Burkholderia gladioli YNK-FB0053 provided by the present invention on plants.

[0046] (1) Take fungal polysaccharide, peat, seaweed essence, and oil cake according to the formula in Table 2, and then mix and stack the above materials. After stacking, seal it tightly with mud. During the composting period, control the moisture content of the composting materials to be 30±5 wt%, and the temperature to be 50±5 °C. Turn the pile once on the 15th and 30th days of composting to obtain the basic organic fertilizer.

[0047] (2) After the composting is completed, uniformly mix the basic organic fertilizer obtained in (1) with the Burkholderia gladioli bacterial agent to obtain the biological organic fertilizer containing Burkholderia gladioli.

[0048] Example 3 Application Effect of Biological Organic Fertilizer Containing Burkholderia gladioli on Plants Apply the biological organic fertilizer prepared in Example 2 to the soil of the plant roots, and then cultivate it simultaneously under the condition that other conditions are kept the same. Specific fertilization method: 15 - 20 days before crop planting, apply it as base fertilizer. The dosage is based on the amount of Burkholderia gladioli not less than 1×10 9 cfu / plant / time; The application frequency of the Burkholderia gladioli biological organic fertilizer is to apply it once as base fertilizer 15 - 20 days before planting.

[0049] The control group is without any treatment, and the chemical fertilizer group is conventional fertilization. Among them, urea, superphosphate, and potassium sulfate are prepared by themselves, and the weight ratio of N, P, and K is 14.8:9.6:23.5.

[0050] Investigate the disease incidence at the harvest stage and calculate the control effect.

[0051] Root rot investigation grading standard: Grade 0, the roots are healthy without disease symptoms; Grade 1, the roots are slightly damaged, and a small amount of disease spots can be seen (0 - 10%); Grade 2, there are a certain degree of disease spots on the roots (11% - 25%); Grade 3, medium degree of damage, the disease spots on the roots spread (26% - 50%); Grade 4, severe damage, most of the roots are infected, and only very little uninfected tissue remains (51% - 75%); Level 5, very severe, the roots are completely infected, and even the plants die (76% - 100%).

[0052] Investigation and grading criteria for Sclerotinia disease: Level 0, the roots are healthy and there are no disease symptoms.

[0053] Level 1, the lesion on the main stem does not exceed 3 cm.

[0054] Level 2, the lesion on the main stem exceeds 3 cm.

[0055] Level 3, the number of diseased branches is less than 2 / 3, and the lesion on the middle and lower parts of the main stem exceeds 3 cm.

[0056] The control effect is calculated using the following two formulas: Disease index = [(∑(number of diseased plants at each level × representative level)) / (total number of plants × highest representative level value)] × 100 Control effect (%) = [(disease index of the control group - disease index of the treatment group) / disease index of the control group] × 100%.

[0057] Disease identification: Samples of typical root and stem diseases caused by infection with Sclerotinia sclerotiorum ( Sclerotinia sclerotiorum ), Fusarium spp. ( Fusarium oxysporum ), Phytophthora spp. ( Phytophthora ), and Pythium myriotylum Drechsler ( Pythium myriotylum ) were collected respectively. Using the tissue isolation method, the pathogenic bacteria were isolated and purified to obtain pure cultures of the pathogenic bacteria; according to Koch's postulates, the pure cultures were inoculated in vivo to verify pathogenicity; the pathogenic bacteria were isolated again from the diseased tissues to obtain pure cultures identical to the original inoculum. The pathogenicity of the isolates to the crops was demonstrated through the above verification. On the basis of morphological identification of the isolates, ITS genes were further used for molecular identification to finally determine the taxonomic status of the pure cultures.

[0058] ITS gene sequence of Sclerotinia sclerotiorum ( Sclerotinia sclerotiorum ) (SEQ ID NO.1): GAAGTAGGGGGATTGCTGGTTCATAGGCGCAAAATTGAGGATGAAATTCACGATCTCGAACACCAACAATGTCATCTGGCTGTGGAGGAATAACACAACACGACGGATTACATAGATGCTAATTCGATGCTTTCCTGCAGTCCCAAAAGTCATTCCGCACCAAGCAGAAGCTTGCGAGAGCCCAAAAGCAAAACAGACCCATTCCACAATGGATCCGTTTGAGGACTGGTAACACCATCCGGTATGTTCACGATTTTACGATACCCCAATCAGTAGCACATATATCAAGTTCCTACCTCTTCGATTTCACCTTCGATCCTTGAAGTCGAAACGAGTCGTCTCGCAAATAGTATCAATTTCGATCGAGTTTTAACTAATAACATTAA Fusarium ( Fusarium oxysporum ) ITS gene sequence (SEQ ID NO.2): TTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCTCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTGACCTC Phytophthora (Phytophthora ITS gene sequence (SEQ ID NO.3): TCAATACTGATTATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCGGTTTGTCCTTCGGGTCGTCTGCGAGTCCTTTTAAATGTACTGAACTGTACTTCTCTTTGCTCGAAAAGCGTGGTGTTGCTGGTTGTGGAGGCTGCCTGCGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGCGTTTAATGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCGCTTATTGTATGCTTTTCCTGCTGTGGCGTGATGGGCTGGTGAACCGTAGC Pythium myriotylum Pythium myriotylum ITS gene sequence (SEQ ID NO.4): CTGCTGTTATGGCGGACTGCCGATGTATTTTTCAAACCCATTTACTTAATACTGAACTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGTTATGCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTCTTGTGTAGTCAAGATTAGAGATGGCAGAATGTGAGGTGTCTCGCTGGCTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTAAGATGAAGTGTGACTTTCGAACGCAGTGATCTGTTTGGATCGCTCTGCGCGAGTGGGCGACTTCGGTTAGGACATTAAAGGAAGCAACCTCTATTGGCGGTATGTTAGGCTTCGGCCCGACTTTGCAGCTGACGGGGTGT Collect the rhizosphere soil of plants and the plant plants during the harvesting period. Specifically, measure the cellulase (S-CL), catalase (CAT), urease (S-UE) and sucrase (S-SC) in the rhizosphere soil of each group of plants; and measure the superoxide dismutase (SOD), polyphenol oxidase (PPO), and catalase (CAT) in the leaves of the plant plants.

[0059] Method for determining the enzyme activity in the rhizosphere soil of plants: Cellulase (S-CL) activity: Measured using a soil cellulase (S-CL) kit purchased from Suzhou Grees Biotechnology Co., Ltd. The usage method refers to the instruction manual. The result is expressed as 1 mg of glucose produced per 72 h in every 10 g of soil sample. Unit: mg·10g -1 ·72h -1 ; Catalase (CAT) activity: Measured using a soil catalase (CAT) kit purchased from Suzhou Grees Biotechnology Co., Ltd. The usage method refers to the instruction manual. The result is expressed as 1 mg of hydrogen peroxide produced per 20 min in every 1 g of soil sample. Unit: mg·g -1 ·20min -1 ; Urease (S-UE) activity: Determined using a soil urease (S-UE) kit purchased from Suzhou Grees Biotechnology Co., Ltd. The usage method followed the instruction manual. The results were expressed as 1 mg NH3-N produced per 1 g of soil sample per day, unit: mg·g -1 ·d -1 ; Sucrase (S-SC) activity: Determined using a sucrase (S-SC) kit purchased from Suzhou Grees Biotechnology Co., Ltd. The usage method followed the instruction manual. The results were expressed as 1 mg of reducing sugar produced per gram of soil sample per day, unit: mg·g -1 ·d -1 。

[0060] Determination method for the defensive enzyme activity of plant roots: Superoxide dismutase (SOD) (U·g -1 ), polyphenol oxidase (PPO) (U·g -1 ), and catalase (CAT) (nmol·min -1 ·g -1 ) were all determined using kits purchased from Suzhou Grees Biotechnology Co., Ltd. The usage method followed the instruction manual.

[0061] Determination method for the phosphorus uptake of plants (kg / hm -2 ): The molybdenum blue method was adopted.

[0062] It can be seen from the data in Tables 3, 4, 5, and 6 that when applying the biological organic fertilizer provided by the present invention, the prevention and control effects on Sclerotinia sclerotiorum of celery, root rot of okra, root rot of lettuce, and basal stem rot of ginger, as well as the improvement effects on the phosphorus uptake of plant plants, the enzyme activity of rhizosphere soil, and the defensive enzyme activity of Huahuizhu are stronger than those of the control. When the biological organic fertilizer applied adopts the preferred components of the present invention and the content ratio of each component is within the preferred range of the present invention, the effects are further improved.

[0063] Table 3 Test conditions and results of the prevention and control of plant fungal diseases by Burkholderia gladioli and biological organic fertilizer

[0064] Table 4 Effects of the application of Burkholderia gladioli and biological organic fertilizer on the enzyme activity of rhizosphere soil of okra and lettuce

[0065] Table 5 Effects of the application of Burkholderia gladioli and biological organic fertilizer on the defensive enzyme activity of roots of celery and ginger

[0066] Table 6 Effects of Burkholderia gladioli and application of bio-organic fertilizer on phosphorus uptake by plants

[0067] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited thereto. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, including any other suitable combination of each technical feature. These simple modifications and combinations should also be regarded as the content disclosed by the present invention and fall within the protection scope of the present invention.

Claims

1. A biological organic fertilizer containing Burkholderia gladioli, characterized in that, Comprising fungal polysaccharide, peat, seaweed essence, oil cake, and Burkholderia gladioli bacterium agent with a weight ratio of (7 - 13) : (21 - 36) : (3.4 - 17) : (93 - 207) : (1.5 - 2), wherein, the effective viable bacteria count in the Burkholderia gladioli bacterium agent is not less than 2×10 Burkholderia gladioli cfu / g, and the preservation number of the Burkholderia gladioli is CCTCC NO: M 20242288. 10 ​ 2. The bio-organic fertilizer according to claim 1, wherein, In the fungal polysaccharide, the water content is 30-35% by weight, based on dry matter, the sugar content is 30-50% by weight, the soluble colloid content is 15-25% by weight, the mineral content is 5-15% by weight, and the crude protein content is 2-8% by weight; and / or, in the oil cake, the water content is 20-30% by weight, based on dry matter, the sugar content is 40-50% by weight, the crude protein content is 5-10% by weight, and the mineral content is 10-15% by weight; and / or, in the peat, the water content is 10-15% by weight, based on dry matter, the organic matter content is 50-60% by weight, the humic acid content is 35-40% by weight, the nitrogen content is 2-3% by weight, the phosphorus content is 0.1-1% by weight, and the potassium content is 0.1-1% by weight.

3. Use of the biological organic fertilizer containing Burkholderia gladioli according to any one of claims 1-2 in preventing and treating Sclerotinia sclerotiorum of celery, root rot of okra, root rot of lettuce, stem rot of ginger, and increasing the phosphorus uptake of plants, the enzyme activity of rhizosphere soil, or the defense enzyme activity of plant roots.

4. Use of the biological organic fertilizer containing Burkholderia gladioli as claimed in claim 3 in preventing and controlling crop root rot, improving the enzyme activity of rhizosphere soil of plants or improving the defensive enzyme activity of plant roots, characterized in that, The crop is one or more of celery, okra, lettuce, and ginger, and the pathogen causing the sclerotinia rot of celery is Sclerotinia sclerotiorum ( Sclerotinia sclerotiorum ), the pathogen causing the root rot of okra is Fusarium ( Fusarium oxysporum ), the pathogen causing the root rot of lettuce is Phytophthora ( Phytophthora ), and the pathogen causing the basal stem rot of ginger is Pythium myriotylum ( Pythium myriotylum ).

5. A method for preventing and controlling crop root rot, increasing the enzyme activity in the rhizosphere soil of plants or increasing the defensive enzyme activity of plant roots, characterized in that: The method is to apply the biological organic fertilizer according to claim 1 or 2 to the soil at a dosage of 50-60 kg / mu / time, and the application frequency is once per crop.

Images