Locusta migratoria retinoic acid induced protein 1 as well as coding gene and application thereof

By isolating the retinoic acid-induced protein 1 gene Rai1 from the periartum and designing dsRNA to interfere with its expression, regulating the growth and development of periartum, the problems of environmental pollution and pest resistance in the periartum prevention and control were solved, and efficient and environmentally friendly pest control effects were achieved.

CN120289607APending Publication Date: 2025-07-11INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510764271.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-10
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

In the prior art, the prevention and control of perpetual locusts mainly relies on chemical pesticides, resulting in increased environmental pollution and pest resistance, and lack of effective RNAi target genes, making it difficult to achieve efficient and environmentally friendly pest control.

Method used

The retinoic acid-induced protein 1 gene rai1 and its encoding protein RAI1 were isolated from the periartum, and dsRNA was designed to interfere with its expression. The growth and development of periartum was regulated through RNA interference technology, especially reducing the diapause rate of eggs, and the injection method under long and short sunlight conditions was used to interfere.

Benefits of technology

It significantly reduces the diapause rate of the larvae eggs, allowing the larvae to hatch early and die in winter, realizes ecological prevention and control of the leopards, and solves the environmental problems and pest resistance caused by chemical pesticides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120289607A_ABST
    Figure CN120289607A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological prevention and control of agricultural pests, and particularly relates to migratory locust retinoic acid induced protein 1 as well as a coding gene and application thereof. The migratory locust retinoic acid induced protein 1 gene is cloned from migratory locust bodies, primers are designed for the migratory locust retinoic acid induced protein 1 gene, and dsRNA for interfering migratory locust retinoic acid induced protein 1 gene expression is synthesized. An application test result of the migratory locust retinoic acid induced protein 1 gene rai1 in prevention and treatment of migratory locust pests shows that after dsRNA is injected into migratory locust, the egg diapause rate of the migratory locust is remarkably reduced, which indicates that the migratory locust retinoic acid induced protein 1 or the coding gene thereof provided by the invention has the function of regulating and controlling the growth and development of the migratory locust; the dsRNA of the migratory locust retinoic acid-induced protein 1 gene rai1 can reduce the diapause rate of migratory locust eggs, so that migratory locust larvae are hatched in winter in advance, and because the larvae cannot survive in cold weather in winter, the purposes of preventing and controlling migratory locust in generations and realizing biological prevention and control of migratory locust are achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biological control of agricultural pests, and specifically relates to locust retinoic acid-induced protein 1, its coding gene and application. Background Art

[0002] The locust (Locusta migratoria) is one of the most destructive agricultural pests, and its explosive migration can lead to large-scale crop failure. At present, the control of locusts still mainly relies on chemical pesticides, but the long-term use has brought serious problems such as environmental pollution, disruption of ecological balance and enhanced pest resistance. Therefore, it is urgent to develop a new type of pest control technology with high efficiency and environmental friendliness.

[0003] The pest control technology based on RNA interference (RNAi) has become a research hotspot due to its high targeting and environmental friendliness. This technology silences key genes of pests by delivering specific double-stranded RNA (dsRNA), thereby interfering with their growth and development. However, at present, the highly efficient RNAi target genes available for locust control are still very limited, and it is urgent to explore new functional genes to support the practical application of this technology.

[0004] Retinoic acid-induced protein 1 (RAI1) is a key regulator of the retinoic acid signaling pathway. Its promoter region contains retinoic acid response elements (RAREs), which can cooperate with retinoic acid receptors to regulate the expression of downstream genes. Research shows that RAI1 plays an important role in animal growth, development and behavior regulation: in the mouse model, RAI1 can directly bind to the promoter region of the rhythm gene period2 and regulate its expression. In insects, the structure and function of RAI1 are relatively conserved, and it can participate in gene expression regulation as a transcription factor.

[0005] However, so far, the isolation and identification of locust genes rai1 and the research on their functions in growth and development have not been reported, and there is no relevant research on using this gene as an RNAi target for locust control. Obtaining locust genes rai1 and their proteins, and exploring their application in the biological control of locusts have important research significance. Summary of the Invention

[0006] One object of the present invention is to provide a retinoic acid-induced protein 1 gene isolated from locusts rai1 ; Another object of the present invention is to provide the protein RAI1 encoded by the locust retinoic acid-induced protein 1 gene; A third object of the present invention is to provide dsRNA that inhibits or reduces the expression of the locust retinoic acid-induced protein 1 gene; A fourth object of the present invention is to provide an expression cassette, an expression vector or a recombinant host cell containing the locust retinoic acid-induced protein 1 gene rai1 ; A fifth object of the present invention is to apply the locust retinoic acid-induced protein 1 gene or its dsRNA to regulate the growth and development of locusts.

[0007] To achieve the above objects, the main technical solutions adopted by the present invention include: On the one hand, the present invention provides the locust retinoic acid-induced protein 1 gene rai1 , and the nucleotide sequence of its CDS is shown in (a), (b) or (c): (a) The nucleotide sequence shown in SEQ ID NO:1; Or (b) a nucleotide sequence capable of hybridizing with the complementary sequence of SEQ ID NO:1 under stringent hybridization conditions, and the protein encoded by this nucleotide still has the function or activity of regulating the growth and development of locusts; Or (c) a nucleotide sequence having at least 80% homology with the nucleotide sequence of SEQ ID NO:1, and the protein encoded by this nucleotide still has the function or activity of regulating the growth and development of locusts; preferably, a nucleotide sequence having at least 85% homology with the nucleotide sequence of SEQ ID NO:1, and the protein encoded by this nucleotide still has the function or activity of regulating the growth and development of locusts; more preferably, a nucleotide sequence having at least 95% homology with the nucleotide sequence of SEQ ID NO:1, and the protein encoded by this nucleotide still has the function or activity of regulating the growth and development of locusts.

[0008] On the second hand, the present invention provides retinoic acid-induced protein 1 encoded by the locust retinoic acid-induced protein 1 gene rai1 , and its amino acid sequence is shown in SEQ ID No:2.

[0009] A preferred specific embodiment of the present invention can connect tags to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID No:2; these tags are used for the expression, detection, tracing and purification of recombinant proteins, etc., and can be various common tags in the art, such as 6xHIS, Flag, GST, MBP or Strep, etc.

[0010] On the third hand, the present invention provides dsRNA for interfering with or inhibiting the expression of the locust retinoic acid-induced protein 1 gene. Or design dsRNA for interfering with or inhibiting the expression of the locust retinoic acid-induced protein 1 gene rai1 using the locust retinoic acid-induced protein 1 gene rai1 as the target gene.

[0011] As a preferred specific embodiment, the dsRNA that interferes with or inhibits the expression of the locust retinoic acid-induced protein 1 gene consists of a sense strand and an antisense strand. Among them, the nucleotide sequence of the sense strand is as shown in SEQ ID NO: 3, and the nucleotide sequence of its antisense strand is as shown in SEQ ID NO: 4.

[0012] Fourthly, the present invention also discloses an expression cassette and an expression vector containing the locust retinoic acid-induced protein 1 gene. Those skilled in the art can use conventional technical means in the art to obtain the locust retinoic acid-induced protein 1 gene rai1 by a conventional method to construct an expression cassette and an expression vector containing the locust retinoic acid-induced protein 1 gene rai1 ; Fifthly, the present invention also discloses an interference vector containing the dsRNA for interfering with or inhibiting the function or activity of the locust retinoic acid-induced protein 1.

[0013] The present invention further provides a recombinant host cell containing the expression cassette, the expression vector or the interference vector.

[0014] Sixthly, the present invention also provides the application of the retinoic acid-induced protein 1 gene isolated from locusts, its encoded protein, and the dsRNA designed with the locust retinoic acid-induced protein 1 gene as the target gene to interfere with or inhibit the expression of the locust retinoic acid-induced protein 1 gene in regulating the growth and development of locusts; As a preferred specific embodiment of the present invention, the regulation of the growth and development of locusts is to relieve the diapause of locust eggs or reduce the diapause rate of locust eggs; correspondingly, when controlling locusts, by relieving the diapause of locust eggs or reducing the diapause rate of locust eggs during the overwintering period, the locust eggs that should be in the soil are hatched into larvae before the coming spring, and the newly hatched larvae cannot survive in the cold climate, achieving the purpose of intergenerational prevention and control of locusts.

[0015] Seventhly, a method for relieving the diapause of locust eggs or reducing the diapause rate of locust eggs is also provided, including: designing and obtaining dsRNA that inhibits the expression of the locust cyclin gene with the gene of the present invention as the target gene; injecting the dsRNA into the locust body to reduce or inhibit the expression level of the retinoic acid-induced protein 1 gene or inhibit the function or activity of the locust retinoic acid-induced protein 1.

[0016] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages: The present invention clones the retinoic acid-induced protein 1 gene from Locusta migratoria, designs primers for the retinoic acid-induced protein 1 gene of Locusta migratoria, synthesizes dsRNA for interfering with the expression of the retinoic acid-induced protein 1 gene of Locusta migratoria, and uses the injection method to introduce dsRNA into Locusta migratoria under long and short day conditions to inhibit or interfere with the expression of the retinoic acid-induced protein 1 gene of Locusta migratoria. The results show that after injecting dsRNA into Locusta migratoria, the diapause rate of the eggs of Locusta migratoria is significantly reduced, indicating that the retinoic acid-induced protein 1 of Locusta migratoria provided by the present invention or its coding gene has the function of regulating the growth and development of Locusta migratoria; it indicates that the retinoic acid-induced protein 1 gene rai1 of dsRNA can block the next generation's reproduction and achieve the ecological control of Locusta migratoria by reducing the diapause rate of Locusta migratoria eggs, so that the larvae that should have hatched in the coming spring hatch in winter in advance, and the hatched larvae die because they cannot tolerate the low temperature in winter. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 is for the interference efficiency of the retinoic acid-induced protein 1 gene of Locusta migratoria rai1 .

[0018] Figure 2 is a result diagram of the influence of RNAi of the retinoic acid-induced protein 1 gene of Locusta migratoria rai1 on the diapause rate of locust eggs under long and short day conditions.

[0019] Figure 3 is a result diagram of the influence of the expression of the retinoic acid-induced protein 1 gene of Locusta migratoria rai1 by RNAi in the field on the diapause rate of locust eggs. DETAILED DESCRIPTION OF THE INVENTION

[0020] Next, the technical solution of the present invention will be described in conjunction with the embodiments. However, the present invention is not limited to the following embodiments.

[0021] In order to enable those skilled in the art to better understand and implement the technical solution of the present invention, the present invention will be further described below in conjunction with specific embodiments and drawings, but the described embodiments shall not be construed as limiting the present invention.

[0022] In the following embodiments, the experimental methods and detection methods are all conventional methods unless otherwise specified; the reagents and materials can all be purchased on the market unless otherwise specified.

[0023] Test locusts: Collected from Cangzhou, Hebei, and purified through long-term breeding in the laboratory for multiple generations. Locust eggs are hatched in an intelligent climate chamber at a temperature of 30±2°C and a relative humidity of 60±5%. Breeding conditions: Diapause induction conditions, photoperiod L 10 h:D 14 h, non-diapause conditions, photoperiod L 16 h:D 8 h, temperature is 28±0.5°C for both, relative humidity is 60±5% for both, and fresh wheat seedlings planted artificially are fed.

[0024] Main reagents: TRIzol ® The RNA extraction reagent was purchased from Jinsha Biotechnology Co., Ltd. The RNA reverse transcription kit and high-efficiency DNA polymerase were purchased from Yeasen Biotechnology Co., Ltd. The real-time fluorescence quantitative kit, DNA gel recovery and purification kit, and high-purity plasmid DNA small-scale extraction kit were purchased from Nanjing Novoprotein Science and Technology Co., Ltd. The pClone007 gene cloning vector kit and 5α chemically competent cells were purchased from Tsingke Biotechnology Co., Ltd. The double-stranded RNA synthesis kit was purchased from Promega Corporation, USA.

[0025] Example 1 In this example, the locust retinoic acid-induced protein 1 gene was obtained. rai1 .

[0026] 1.1 Extraction of total locust RNA Using the TRIzol® RNA extraction reagent, the total locust RNA was extracted using the locusts raised in the laboratory of the inventors. The specific steps are as follows: 1) The locust tissues were placed in a mortar pre-cooled with liquid nitrogen. During grinding, liquid nitrogen was continuously added until the powder had no obvious particles. The locust powder was transferred to a 2 mL centrifuge tube, and 1 mL of pre-cooled TRIzol® RNA isolation reagent was added. The mixture was vortexed until thoroughly mixed and left standing on ice for 10 min.

[0027] 2) The standing sample was transferred to a refrigerated centrifuge pre-cooled to 4°C, centrifuged at 12000 r / min for 10 min; the supernatant was aspirated and transferred to a clean 1.5 mL centrifuge tube, 200 μL of chloroform was added, vortexed for 30 s, and left standing on ice for 5 min. After standing, it was centrifuged at 4°C, 12000 r / min for 5 min. The supernatant was again aspirated and transferred to a new 1.5 mL centrifuge tube, 200 μL of chloroform was added, vortexed for 30 s, and left standing on ice for 5 min. After standing, it was centrifuged at 4°C, 12000 r / min for 5 min.

[0028] 3) The supernatant was aspirated into a new 1.5 mL centrifuge tube, an equal volume of pre-cooled isopropanol was added, vortexed for 30 s, transferred to an RNA spin column, left standing on ice for 10 min, centrifuged at 4°C, 12000 r / min for 2 min, and the filtrate was discarded. 600 μL of absolute ethanol was added to the above centrifuge tube, and the precipitate was washed by pipetting. It was centrifuged at 4°C, 12000 r / min for 2 min, and the filtrate was discarded. This step was repeated once. 4) Centrifuge the centrifuge tube containing the RNA spin column at 4°C and 12,000 r / min for 3 min to remove excess ethanol. Transfer the RNA spin column to a new 1.5 mL centrifuge tube and air-dry it for 5 min. Add 50 μL of RNase-free water (DEPC-treated water, i.e., ultrapure water) preheated to 65°C to the above RNA spin column, heat it for 2 min, and centrifuge it at 4°C and 12,000 r / min for 3 min to obtain the filtrate. Detect the RNA concentration and OD 260 / OD 280 value of the filtrate to confirm the quality of RNA in the filtrate, and take 2 μL of the extracted RNA for agarose gel electrophoresis detection. Store the remaining filtrate at -20°C for short-term use.

[0029] 1.2 Reverse transcription to obtain Locusta migratoria cDNA Using the total RNA of Locusta migratoria obtained in 1.1 as a template, referring to the instructions of the Hifair ® Ⅲ 1st Strand cDNA SynthesisKit kit, reverse transcription was performed to obtain Locusta migratoria cDNA. The specific steps are as follows: 1) Pipette 3 μL of 5×gDNA Digester Mix, 2 μL of Total RNA, and 10 μL of RNase Free dH2O to prepare a 15 μL system solution. After reacting the above solution in a metal bath at 42°C for 2 min, quickly cool it in ice water.

[0030] 2) Pipette 2 μL of 10×Hifair Ⅲ Super Buffer, 1 μL of Hifair Ⅲ RT Enzyme Mix, 1 μL of Random Primers N6 (50 μM), and 1 μL of Oligo(dT)18 (50 μM) into the reaction solution of the previous step to prepare a 20 μL reaction system. After pipetting and mixing the above reaction system, place it in a metal bath at 25°C for 5 min; then immediately transfer it to a metal bath at 60°C for 15 min; finally, transfer it to a metal bath at 85°C for 5 min to inhibit the enzyme activity. After the reaction, place it in ice water to cool, and Locusta migratoria cDNA is obtained. Collect Locusta migratoria cDNA and store it at -20°C.

[0031] 1.3 Clone the retinoic acid-induced protein 1 gene rai1 Design primers based on the gene sequence obtained from the Locusta migratoria transcriptome, 1) According to the gene sequence obtained from the Locusta migratoria transcriptome, use DNAMAN8 to design the retinoic acid-induced protein 1 generai1 Specific primer pairs. The specific primer pairs are rai1 -F and rai1 -R. The primer sequence information is shown in Table 1.

[0032] 2) Take 2 μL of Locusta migratoria cDNA template, 25 μL of 2×Hieff Canace Advance Fast PCR Master Mix, rai1 2 μL of rai1 -F primer,

[0033] 2 μL of

[0034] -R primer, and 19 μL of ddH2O to prepare a 50 μL PCR reaction solution.

[0035] 3) Place the PCR reaction solution in a PCR instrument and use the following PCR program: 98°C for 30 s; 98°C for 10 s, 60°C for 5 s, 72°C for 30 s, for 30 cycles; 72°C for 2 min to obtain the PCR product, and store the PCR product at 4°C.

[0036] 4) Electrophorese the above PCR product on a 1% agarose gel, cut the gel block containing the target band with a blade and put it into a sterile centrifuge tube. Then use a gel extraction kit to recover and purify the target band to obtain the PCR recovery product.

[0037] 5) Pipette 5 μL of 5×pClone007 Versatile Simple Vector, 3 μL of ddH2O, and 2 μL of the PCR recovery product, and incubate at 25°C for 20 min to obtain the ligation vector.

[0036] 6) Transform the above ligation into 5α competent cells, let it stand in ice water for 25 min, then heat shock in a 42°C metal bath for 60 s, and quickly place it on ice for 2 min.

[0037] 7) After standing, add 500 μL of liquid LB medium without antibiotics to a 1.5 mL centrifuge tube, and resuscitate and shake the bacteria at 37°C, 200 rpm / min for 1 h. After shaking the bacteria, pipette 100 μL of the bacterial liquid onto a 1‰ AMP LB solid medium and spread it evenly with a spreader. Seal the plate and invert it in a 37°C constant temperature incubator for 12 h. Pick a single colony into a 2 mL centrifuge tube containing 1 mL of 1‰ AMP LB liquid medium. Shake the bacteria at 37°C, 200 rpm / min for 3 - 6 h and observe the growth situation.

[0038] 8) After the bacterial liquid becomes turbid, take 1 μL of the bacterial liquid, 12.5 μL of 2×Rapid Taq Master Mix, rai1 2 μL of rai1Prepare a 25 μL PCR reaction system with 2 μL of -R primer and 7.5 μL of ddH2O.

[0039] 9) Put the 25 μL PCR reaction system prepared in 8) into a PCR instrument for PCR. The PCR reaction program is as follows: 98°C for 30 s; 98°C for 10 s, 60°C for 5 s, 72°C for 30 s, for 30 cycles; react at 72°C for 2 min to obtain the PCR product. The PCR product is subjected to 1% agarose gel electrophoresis, and the positive clone strains corresponding to the lanes with correct electrophoretic band sizes in the results are sent to a biological company for sequencing.

[0040] 10) Retain the positive clone strains with successful sequencing and analyze the sequencing results. Extract plasmids from the positive clone strains and store them at 4°C.

[0041] The sequencing results show that: a DNA fragment with a size of 3225 bp is obtained by PCR amplification, and its nucleotide sequence is as shown in SEQ ID NO:1: Name the gene shown in SEQ ID NO:1 as the Locusta migratoria retinoic acid-induced protein 1 gene rai1 , and the amino acid sequence encoded by it is as shown in SEQ ID NO:2; Name the amino acid sequence shown in SEQ ID NO:2 as the Locusta migratoria retinoic acid-induced protein 1 RAI1.

[0042] Table 1 Primer sequence information table

[0043] Example 2 This example is an application test of the Locusta migratoria retinoic acid-induced protein 1 gene rai1 in controlling Locusta migratoria pests.

[0044] 2.1 Design and synthesis of dsRNA of the Locusta migratoria retinoic acid-induced protein 1 gene Use the T7 RiboMAX TM Express RNAi System kit to synthesize dsRNA. The specific steps are as follows: Design primers according to the cloned gene fragment. The expected length of the target fragment to be amplified is 360 bp, and a T7 promoter is introduced at the 5' end of the primer. The designed primer pairs are rai1 -2F and rai1 -2R, and the sequences are shown in Table 1.

[0045] Take 1 μL of the plasmid of the positive clone strain obtained in Example 1, 12.5 μL of 2×Rapid Taq Master Mix, 2 μL of F primer, 2 μL of R primer, and 7.5 μL of ddH2O to prepare a 25 μL reaction system. Use rai1 -2F andrai1 Perform PCR on - 2R in the above - mentioned PCR reaction system to obtain a target fragment containing the T7 promoter sequence.

[0046] The PCR reaction conditions are as follows: 98°C for 30 s; 98°C for 10 s, 60°C for 5 s, 72°C for 30 s, for 30 cycles; after reacting at 72°C for 2 min, store at 4°C.

[0047] Recover the PCR product, detect the concentration of the target DNA with a NanoPhotometer micro - spectrophotometer, and the recovered concentration should be greater than 150 ng / μL.

[0048] Use the T7 RiboMAX TM Express RNAi System kit to transcribe the recovered PCR product in vitro to synthesize double - stranded RNA of the Locusta migratoria retinoic acid - induced protein 1 gene rai1 and detect the concentration of the dsRNA with a NanoPhotometer micro - spectrophotometer. Adjust the dsRNA concentration to 1000 ng / μL to prepare a dsRNA solution (the solvent is Nucleause free water).

[0049] The dsRNA expressed by the coding gene of Locusta migratoria retinoic acid - induced protein 1 obtained is double - stranded RNA, which consists of a sense strand and an antisense strand. The nucleotide sequence of the sense strand is shown in SEQ ID NO:3, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:4. SEQ ID NO:4 is the reverse complementary sequence of SEQ ID NO:3. The specific nucleotide sequences are as follows: Sense strand (SEQ ID NO:3): AGTGGTGATCTCTTTGGTCCTTATCTCGTATCTCGTCCAGAACGGGAGTTGCCTGCATCGGCAGATGAGAAGGATATAGTTGAGGAACAGTCACGAGGTGGAAGTGGAACACGTGGAAAACGAAGCCTTCGCACTGCACATATGGTTGAACATTTCCATCAAAAGATGTCAAAGAAGGCAAAGAGGTCACATTCAGTTGATGGAAGTGTTGCTGTATCTGGAATGACCCCAGTTGGTAAGGATGATAGTTGTTACGAGGTGTGGACACATGAAGAATGTGCAGTCTGGGCAGCTGGTGTACATTTAGTGGGTACGCGCATTGTTGGACTGCAGGAAGCTGTTTGGGGTGCAGTACGCACT.

[0050] Antisense strand (SEQ ID NO: 4): AGTGCGTACTGCACCCCAAACAGCTTCCTGCAGTCCAACAATGCGCGTACCCACTAAATGTACACCAGCTGCCCAGACTGCACATTCTTCATGTGTCCACACCTCGTAACAACTATCATCCTTACCAACTGGGGTCATTCCAGATACAGCAACACTTCCATCAACTGAATGTGACCTCTTTGCCTTCTTTGACATCTTTTGATGGAAATGTTCAACCATATGTGCAGTGCGAAGGCTTCGTTTTCCACGTGTTCCACTTCCACCTCGTGACTGTTCCTCAACTATATCCTTCTCATCTGCCGATGCAGGCAACTCCCGTTCTGGACGAGATACGAGATAAGGACCAAAGAGATCACCACT。

[0051] The above-mentioned Locusta migratoria retinoic acid-induced protein 1 gene rai1 dsRNA can also be obtained by artificial synthesis. Name the above dsRNA as d srai1 。

[0052] 2.2 Application test of d srai1 in controlling Locusta migratoria pests Set up a ds rai1 experimental group and a double-distilled water control group (Control). Among them, the Locusta migratoria in the experimental group was injected with a ds rai1 solution with a concentration of 1000 ng / μL, and the Locusta migratoria in the double-distilled water control group was injected with double-distilled water. The specific test method is as follows: Use a micro syringe to separately suck 5 μL of a ds rai1 solution (experimental group, ds rai1 ) and 5 μL of double-distilled water (control group, control), and inject them into the intersegmental membrane between the third and fourth abdominal segments of the female adult Locusta migratoria on the second day after the female adult Locusta migratoria emerges. The needle of the syringe is parallel to the abdomen to avoid damaging the internal organ tissues of the locust. Each treatment is repeated 5 times, and each repeated treatment has 20 female adults. After injection, the Locusta migratoria are raised in an intelligent climate chamber, and the feeding conditions are as follows: temperature 28 °C, humidity 60%, short-day condition: photoperiod L 10 h:D 14 h; long-day condition: photoperiod L 16 h:D 8 h.

[0053] Forty-eight hours after injection, total RNA of locusts in the experimental group and the control group was extracted, cDNA was synthesized using a reverse transcription kit, and gene rai1 expression was detected by RT-qPCR. actin gene was used as an internal reference gene.

[0054] The gene rai1 fluorescent quantitative primer pairs were rai1 -3F and rai1 -3R, and the actin gene primer pairs were actin-F and actin-R. The primer sequence information is shown in Table 1.

[0055] The RT-qPCR detection results are as Figure 1 shown. The results show that, compared with the control group, the expression of gene rai1 in locusts in the experimental group was significantly decreased, indicating that ds rai1 successfully interfered with the expression of gene rai1 in locusts.

[0056] Statistical analysis of locust diapause rate: Eggs (locust eggs) laid by locusts injected with ds rai1 or double-distilled water under long and short light conditions were taken, incubated at 28 °C, and the number of hatched larvae D1 was counted. The remaining eggs were stored at 4 °C for one month to break diapause, and then hatched again to count the number of hatched larvae D2. The remaining eggs were unfertilized eggs or dead eggs. The locust egg diapause rate = D2 / (D1 + D2)×100%.

[0057] The statistical results of locust egg diapause rate are as Figure 2 shown. The results show that under short-day conditions, the diapause rate of locust eggs in the ds rai1 experimental group was 44.8%, and the diapause rate of locust eggs in the double-distilled water control group (Control) was 81.3%. The results indicate that after interfering with the gene rai1 of female adult locusts, the diapause rate of offspring eggs of locusts under short light conditions was significantly decreased compared with the control group (P < 0.05); under long-day conditions, the diapause rate of locust eggs in the ds rai1 experimental group was 5.7%, and the diapause rate of locust eggs in the double-distilled water control group was 20.7%. The results indicate that after interfering with the gene rai1 of female adult locusts, the diapause rate of offspring eggs of locusts under long light conditions was also significantly decreased compared with the control group ( P < 0.05).

[0058] When controlling locusts, by breaking the diapause of locust eggs or reducing the diapause rate of locust eggs during the overwintering period, the locust eggs that should be in the soil are hatched into larvae before the coming spring. The newly hatched larvae cannot survive in the cold climate, achieving the goal of intergenerational control of locusts.

[0059] 2.3 Field efficacy test Test location: Cangzhou City, Hebei Province.

[0060] Experimental treatment: Experimental group: ds rai1 , concentration was 1000 ng / μL; control group: double distilled water.

[0061] Experimental method: RNA interference treatment was performed on the second day after the female locusts emerged from their cocoons. 10 μL of ds rai1 Solution (test group, ds rai1 ) and 10 μL double distilled water (control group, control), each treatment was repeated 3 times, and 20 female adults were treated in each replicate. After injection, the female adults of the experimental group and the control group were placed in field cages (size 2 m × 2 m × 2 m), and male adults were placed in each field cage at a ratio of 20:20 for female and male adults to simulate natural mating conditions. The egg laying was observed on the 5th, 10th, 15th, and 20th days after injection, and the egg sheaths were collected for hatching. The diapause rate of locust eggs was calculated, and the statistical method was referred to 2.2.

[0062] Experimental results: The statistical results of the diapause rate of locust eggs are as follows Figure 3 As shown, the results show that d srai1 The diapause rate of locust eggs in the experimental group was 56.2%, while that in the double distilled water control group was 66.6%. The results showed that interfering with the gene expression of female adults of migratory locusts rai1 After that, the diapause rate of locust offspring eggs was significantly lower than that in the control group (P<0.05).

[0063] This example shows that locust retinoic acid-induced protein 1 gene rai1 It can be used to prevent and control locust pests. By reducing the dormancy rate of locust eggs, the larvae that should have hatched in the spring of the following year are hatched in winter in advance. The larvae hatched in winter cannot survive in the cold climate, thus achieving the purpose of inter-generational locust prevention and control and realizing biological control of locusts.

[0064] As described above, the basic principle, main features and advantages of the present invention are well described. The above embodiments and descriptions are only descriptions of the preferred embodiments of the present invention, and the present invention is not limited by the above embodiments. Without departing from the spirit and scope of the present invention, various changes and improvements made by ordinary technicians in this field to the technical solution of the present invention should fall within the protection scope determined by the present invention.

Claims

1. Locusta migratoria retinoic acid-induced protein 1, characterized in that, The amino acid sequence of the locust retinoic acid-induced protein 1 is shown in SEQ ID NO:

2.

2. The locust retinoic acid-induced protein 1 according to claim 1, wherein, A tag is linked to the N-terminus and / or C-terminus of the amino acid sequence of the locust retinoic acid-induced protein 1; wherein the tag is used for the expression, detection, tracing or purification of the recombinant protein. 3.Encoding the gene of locust retinoic acid-induced protein 1 as claimed in claim 1, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

4. dsRNA designed with the gene described in claim 3 as the target gene for interfering with or inhibiting the expression of the locust retinoic acid-induced protein 1 gene.

5. The dsRNA according to claim 4, wherein The dsRNA is composed of a sense strand and an antisense strand; wherein the nucleotide sequence of the sense strand is shown in SEQ ID NO: 3, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:

4.

6. An expression cassette or expression vector containing the gene described in claim 3.

7. An interference vector containing the dsRNA of the locust retinoic acid-induced protein 1 described in claim 1.

8. Use of the locust retinoic acid-induced protein 1 described in claim 1, or the gene described in claim 3, or the dsRNA described in claim 4 in regulating the growth and development of locusts.

9. The application according to claim 8, wherein The regulation of the growth and development of locusts is to relieve the diapause of locust eggs or reduce the diapause rate of locust eggs.

10. A method for relieving diapause of locust eggs or reducing the diapause rate of locust eggs, characterized in that: Comprising: dsRNA designed with the gene described in claim 3 as the target gene to obtain inhibition of the expression of the locust cyclin gene; Injecting the dsRNA into the locust body to reduce or inhibit the expression level of the retinoic acid-induced protein 1 gene or inhibit the function or activity of the locust retinoic acid-induced protein 1.