Membrane protein targeted degradation system based on YVKM sequence as well as construction method and application of membrane protein targeted degradation system

By designing a membrane protein-targeted degradation system based on YVKM sequence, and using the Clathrin-mediated endocytosis pathway to target the degradation of CTLA4 protein, the limitations of the CTLA4 blocking method in the prior art were solved, and the anti-cancer effect of CAR-T cells was enhanced.

CN120289655APending Publication Date: 2025-07-11THE SECOND AFFILIATED HOSPITAL TO NANCHANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510506970.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-22
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

Existing methods for cellular protein expression regulation such as DNA knockout and RNA interference have problems with off-target effects and slow regulation. CAR-T immunotherapy has limitations such as antigen escape, drug resistance and T cell depletion. Traditional CTLA4 blocking methods may lead to inflammatory storms or hyper-progression of the disease.

Method used

Design a membrane protein-targeted degradation system based on the YVKM sequence, and target the degradation of CTLA4 proteins through recombinant YVKM, CAAX and protein-targeting sequences using the Clathrin-mediated endocytosis pathway, including the CleTAC system, and use the CleTAC plasmid to target the degradation of endogenous CTLA4 proteins.

Benefits of technology

Significantly degrade endogenous CTLA4 protein, enhance the anti-cancer effect of CAR-T cells, improve the therapeutic effect, enhance the tumor-killing ability and cytokine secretion of CAR-T cells, and reduce T cell depletion.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120289655A_ABST
    Figure CN120289655A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to a membrane protein targeted degradation system based on a YVKM sequence and a construction method and application of the membrane protein targeted degradation system, the membrane protein targeted degradation system is formed by recombining the YVKM sequence, a CAAX sequence and a protein targeted sequence, and the CAAX sequence is located at the C end of the recombinant sequence. According to the membrane protein targeted degradation system, a YVKM sequence, a CAAX membrane positioning sequence and an endogenous protein targeted binding sequence are recombined and targeted to lysosome degradation through a Clathrin-mediated endocytosis pathway, and a new strategy for targeted degradation of endogenous protein is provided.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technologies, and particularly relates to a membrane protein targeted degradation system based on the YVKM sequence, a construction method thereof, and an application thereof. Background Art

[0002] Currently, the methods for regulating cell protein expression are mostly DNA knockout and RNA interference at the gene level. Although these two methods are simple and effective, their regulation has many limitations, such as off-target effects and slow regulation speed of proteins with long half-lives. These defects limit the application of these methods in scientific research and clinical treatment.

[0003] Chimeric Antigen Receptor (CAR) T cell immunotherapy is a new type of treatment method. It exerts an anti-cancer effect by modifying and transforming the patient's T cells in vitro to target specific antigens in tumors. However, CAR-T immunotherapy has some limitations, including antigen escape, primary and secondary drug resistance, and T cell exhaustion. T cell exhaustion refers to the gradual loss of T cell effector functions caused by prolonged exposure to the antigen environment. Studies have found that the mechanism of T cell exhaustion often originates from the overexpression of immune checkpoint proteins, such as PD-1, HAVCR2, CTLA4, etc. Among them, CTLA4 blockade immunotherapy has been proven to have significant clinical efficacy and is widely used in many hematological malignancies and even advanced tumors.

[0004] Currently, there are many classical methods for immunotherapy, including Ticilimumab (anti-CTLA4 monoclonal antibody), Pembrolizumab (anti-PD-1 monoclonal antibody), CAR-T cells combined with anti-CTLA4 monoclonal antibody, T cells edited by CRISPR-Cas9 for CTLA4, etc. Although these methods are widely used, they also have some disadvantages: T cells edited by CRISPR-Cas9 irreversibly modify the genome, and anti-CTLA4 monoclonal antibodies may cause inflammatory storms or disease superprogression (the immune system overshoots and attacks normal tissues), etc. Therefore, it is of great significance to develop a new type of efficient system for targeted degradation of the membrane protein CTLA4. Summary of the Invention

[0005] Aiming at the deficiencies of the prior art, the purpose of the present invention is to provide a membrane protein targeted degradation system based on the YVKM sequence, a construction method thereof, and an application thereof. This membrane protein targeted degradation system recombines the YVKM sequence, the CAAX membrane localization sequence, and the endogenous protein targeting binding sequence, and targets to lysosomes for degradation through the Clathrin-mediated endocytosis pathway, providing a new strategy for targeted degradation of endogenous proteins.

[0006] Clathrin-mediated endocytosis (CME) is a lysosomal endocytic degradation pathway of cells themselves, which requires the participation of clathrin and adaptor complex AP2. YXXΦ is considered an important motif in CME, where Φ refers to an amino acid with a hydrophobic side chain. YXXΦ mediates the binding to AP50 (the μ2 subunit of AP2) and internalization from the cell membrane. Studies and experiments have shown that non-CME substrates fused with the YXXΦ sequence can also follow CME. Therefore, the inventors use CME as a degradation pathway to degrade membrane proteins.

[0007] Farnesylation is a type of isoprenylation, which is a chemical modification that provides non-polar farnesyl groups to proteins, making them more likely to bind to cell membranes. Substrates involved in farnesylation have a common CAAX motif at the C-terminus, where C is cysteine, A is an aliphatic amino acid, and X is any amino acid at the COOH-terminus. The hydrophobic farnesyl group is crucial for membrane binding and protein localization.

[0008] Cytotoxic T lymphocyte-associated antigen 4 (CTLA4), also known as CD152, is a leukocyte differentiation antigen and a transmembrane receptor on T cells that participates in the negative regulation of immune responses and is considered to play an important role in immunotherapy. Many evidences and studies have shown that after CTLA4 binds to B7, negative regulatory signals are generated, which inhibit the activation of T cells by suppressing IL-2 production and cell cycle progression. Blocking CTLA4 can effectively promote the proliferation and killing effect of T cells. Among them, the B7 family is a group of transmembrane proteins of the immunoglobulin superfamily, which mediates co-stimulation or co-inhibition of T cells by binding to two T cell surface receptors, CD28 or CTLA4; IL-2 is a key cytokine that plays a key role in cellular immunity and can activate T cells, promote T cell proliferation, and promote the cytolytic activity of killer cells. Currently, CTLA4 blockade immunotherapy has been proven to have significant clinical efficacy and is widely used in many hematological malignancies and even advanced tumors. Therefore, it is extremely urgent to develop and transform a degradation system based on the CME pathway that can target and degrade the CTLA4 membrane protein of CAR-T cells.

[0009] Therefore, to achieve the above object, the present invention provides a membrane protein targeted degradation system based on the YVKM sequence. The membrane protein targeted degradation system is recombined by the YVKM sequence, the CAAX sequence, and the protein targeting sequence. The CAAX sequence is at the C-terminus of the recombinant sequence. Among them, the base sequence corresponding to the YVKM sequence is shown in SEQ ID NO:3; the base sequence corresponding to the CAAX sequence is shown in SEQ ID NO:5. The composed recombinant sequence is collectively referred to as CleTAC.

[0010] Further, in the above technical solution, the protein targeting sequence is in the middle of the recombinant sequence.

[0011] Further, in the above technical solution, there are 2-3 groups of consecutive YVKM sequences in the recombinant sequence, that is, there are 2 groups of consecutive YVKM sequences (YVKM×2) or 3 groups of consecutive YVKM sequences (YVKM×3) in the recombinant sequence.

[0012] Further, in the above technical solution, the protein targeting sequence is an exogenous overexpressed protein sequence or an endogenous protein sequence, targeting the degradation of overexpressed EGFP, endogenous HER2 protein or CTLA4 protein.

[0013] Further, in the above technical solution, when the membrane protein targeted degradation system targets the degradation of overexpressed EGFP, the protein targeting sequence is the VHH sequence, and its amino acid sequence has the corresponding base sequence shown in SEQ ID NO:4.

[0014] Further, in the above technical solution, when the membrane protein targeted degradation system targets the endogenous HER2 protein, the protein targeting sequence is the HER2-binding sequence, and its amino acid sequence has the corresponding base sequence shown in SEQ ID NO:7. Specifically, the HER2-binding sequence is a HER2 protein binding sequence predicted by RFdiffusion combined with ProteinMPNN and AlphaFold 3 and verified, and its corresponding base sequence is specifically shown as follows: ATGGCGATGGTGAACCGCCATCGCGCGGAAGCGCGCATTAGCGGCAGCGGCCGCACCATTATTGCGAACGCGGCGCTGCTGCTGCTGAAAGTGCTGCGCGAAGTGGCGAAATATCTGAAACCGGGCGAAAAAGTGCTGATTAGCATTAACATTAAAGCGATTGGCATGAGCGGCGAAACCATTGCGGATCTGATTGCGACCATTGCGGATGTGCTGGCGCGCTATATTGAACGCCTGAAAGGCTATGAAATTGAAGTGCTGCTGGCGCTGGTGAAACAGGGCCTGAGCGTGGAAGATATGAAAGTGCTGTGCGATACCATTATTGCGGCGGCGGCGAAACTGAAAGCGGCGGGCGTGAAAAAAATTACCGTGATTATTAGCACCAGCGAAGAATGCCGCCCGGTGGTGGAAGAAACCGCGAAACGCCTGGCGGAACTGGGCGTGACCTGCATTGGCGTGAAAGAAGAAGATCTGGAAAAACTGCTGGAAGAAAAACTGAAAGAAGCGGAAGCGGAAGGCTATGATATTATTGAAATTAACATTACCGTGGAAGAAAGCCCGGGCCCGGTGCGCATTGAATTTCGCCTGGAAATTGAAGAACCG (SEQ ID NO:7).

[0015] Furthermore, in the above technical solution, when the membrane protein targeting degradation system targets the endogenous CTLA4 protein, the protein targeting sequence is the PP2AA sequence, and its amino acid sequence has the corresponding base sequence shown in SEQ ID NO:8. Specifically, the PP2AA sequence refers to the regulatory subunit A of protein phosphatase 2A (PP2A), which can target and bind to the CTLA4 protein, and its corresponding base sequence is specifically shown as follows:

[0016] The present invention also provides a method for constructing a membrane protein targeted degradation system based on the YVKM sequence, comprising the following steps: using myr-Akt1 as a plasmid vector, selecting XbaI and EcoRI as restriction sites to obtain a backbone, inserting the YVKM sequence and the protein targeting binding sequence into the backbone in sequence, after synthesizing the plasmid, inserting the CAAX sequence at the C-terminus of the obtained synthesized plasmid sequence to obtain the recombinant plasmid.

[0017] The present invention also provides an application of the above-mentioned membrane protein targeted degradation system in degrading exogenous overexpressed EGFP, degrading endogenous HER2 protein or inhibitory receptor CTLA4 protein. Specifically, when applied to degrade overexpressed EGFP in cells, after lentivirus infecting the receptor cells with the plasmid of the protein targeted degradation system with the protein targeting sequence being EGFP for 6-8 h, changing the medium and adding multiple rounds of puromycin for screening, after obtaining the stable cell line, detecting the degradation situation of EGFP by flow cytometry; when applied to endogenous HER2 protein and inhibitory receptor CTLA4 protein, after lentivirus infecting the receptor CAR-T cells with the plasmid of the protein targeted degradation system with the protein targeting sequence being PP2AA for 6-8 h, detecting the expression levels of HER2 and CTLA4 in CAR-T cells, the tumor killing ability of CAR-T cells, cytokine secretion, and the expression levels of exhaustion markers.

[0018] The present invention also provides an application of the above-mentioned membrane protein targeted degradation system in the preparation of anti-tumor drugs.

[0019] The beneficial effects of the present invention are: By recombining the YVKM sequence with the CAAX sequence and the protein targeting sequence, and targeting to lysosome degradation through the Clathrin-mediated endocytosis pathway, the present invention can provide a new strategy for targeted degradation of endogenous membrane proteins.

[0020] The YVKM-VHH / PP2AA / HER2-binding-CAAX (Clathrin-mediate endocytosis-inspired targeting chimeras, hereinafter referred to as CleTAC) protein targeted degradation system designed by the present invention can target exogenous overexpressed and endogenous membrane proteins. Currently, the degradation levels of exogenous overexpressed EGFP protein, endogenous HER2 protein and CTLA4 protein have been successfully verified, and significant degradation of intracellular EGFP, HER2 and CTLA4 can be achieved; applying this degradation system is expected to reduce the expression level of the CTLA4 inhibitory receptor protein on the CAR-T cell membrane, so as to enhance the anti-cancer effect of CAR-T cells and thus improve the treatment effect, providing a basis for the development of anti-cancer drugs. Description of the Drawings

[0021] Figure 1 Schematic diagram of the recombinant plasmid targeting the degradation of overexpressed EGFP of the present invention; Figure 2 Flow cytometry detection diagram of the change of EGFP green fluorescence level and intensity regulated by CleTAC of the present invention; Figure 3 Flow cytometry detection diagram of the green fluorescence level and intensity of the endocytosis pathway mediated by Clathrin in which CleTAC plays a role of the present invention; Figure 4 Western blot diagram of the immunoprecipitation detection of the binding of CleTAC to the key unit AP50 of the Clathrin pathway of the present invention; Figure 5 Fluorescence confocal detection diagram of the degradation of EGFP green fluorescent protein on the cell membrane regulated by CleTAC via the Clathrin pathway to lysosomes of the present invention; Figure 6 Flow cytometry detection result diagram of the CAR-mediated HER2 cell nibbling phenomenon (CMT) of the present invention; Figure 7 Diagram of the prediction process of HER2 binding protein by RFdiffusion combined with ProteinMPNN and AlphaFold 3 and the co-IP verification result of the present invention; Figure 8 Result diagram of targeting the degradation of endogenous HER2 protein and reducing the CAR-mediated cell nibbling phenomenon (CMT) of the present invention; Figure 9 Schematic diagram of targeting the degradation of endogenous CTLA4 protein and enhancing the anti-tumor activity of CAR-T cells of the present invention; Figure 10 Flow cytometry detection result diagram of the CAR-T cell killing experiment after knocking out CTLA4 by CleTAC of the present invention; Figure 11 Detection result diagram of cytokines secreted by CAR-T cells after knocking out CTLA4 by CleTAC of the present invention; Figure 12 Schematic diagram of the construction of the in-situ glioma nude mouse model of the present invention; Figure 13 Comparison diagram and line graph of the fluorescence intensity of in-vivo imaging of nude mice after CAR-T treatment after knocking out CTLA4 by CleTAC of the present invention; Figure 14 Line graph of the volume change and survival curve of nude mice after CAR-T treatment after knocking out CTLA4 by CleTAC of the present invention; Figure 15This is the result graph of detecting cytokines in the serum of nude mice after CAR-T treatment with CTLA4 knocked out by CleTAC in the present invention. Detailed implementation manners

[0022] Unless otherwise specified, the experimental methods in the following examples are all conventional methods. Unless otherwise specified, the raw materials involved in the following examples are all ordinary commercially available products and can be obtained through market purchase. For the methods not specifically described, they are all carried out with reference to the conventional methods in the art.

[0023] The lentiviral plasmid vector myr-Akt1 (Addgene-46969) was purchased from addgene; The synthesis of the complete plasmid sequence was carried out by Genewiz (Suzhou) Inc. The lentiviral packaging plasmid vectors are PsPAX2 and PMD2.0.

[0024] The present invention will be further described in detail below in conjunction with the embodiments: Example 1: Design and construction of recombinant plasmid Using the lentiviral plasmid vector myr-Akt1 as the vector, XbaI and EcoRI were selected as the restriction enzyme sites to obtain the backbone. In sequence, the bases corresponding to the EGFP sequence (SEQ ID NO:1 - ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG), the P2A sequence (SEQ ID NO:2 - GCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT), the base sequence corresponding to the YVKM sequence (SEQ ID NO:3 - TATGTGAAAATG), the base sequence corresponding to the GFP nanobody (VHH) sequence (SEQ ID NO:4 -The base sequences corresponding to the sequences of (SEQ ID NO: 5 - TCCGGACTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAGTCGACAACCCTCCTGATGAGAGTGGCCCCGGCTGCATGAGCTGCAAGTGTGTGCTCTCC) and the CAAX sequence were inserted into the backbone, and sequences of EGFP-P2A-VHH-YVKM (VHH-YVKM), EGFP-P2A-YVKM-VHH-CAAX (YVKM-VHH-CAAX), EGFP-P2A-VHH-YVKM -CAAX (VHH-YVKM-CAAX), EGFP-P2A-VHH (control), and EGFP-P2A-VHH-CAAX (control-CAAX) were designed respectively. The plasmids were synthesized by Genewiz (Suzhou) Inc. Among them, P2A is a 2A peptide derived from a virus, which can enable ribosomes to skip the synthesis of the glycine and proline peptide bonds at the C-terminus of the 2A element, thus separating the end of the P2A sequence from the downstream product; GFPnanobody is a single-chain VHH green fluorescent protein nanobody with specific binding activity against GFP, which can specifically bind to EGFP to achieve EGFP targeting. The Y in the YVKM sequence of the EGFP-P2A-VHH-YVKM (VHH-YVKM) recombinant plasmid was mutated to F to obtain the EGFP-P2A-VHH-FVKM (VHH-FVKM) sequence, and the base sequence corresponding to the FVKM sequence is SEQ ID NO: 6 - TTCGTGAAAATG) Based on the YVKM-VHH-CAAX (CleTAC) plasmid, to improve the degradation efficiency of the protein targeting degradation system, two polyploid sequences, EGFP-P2A-YVKM×2-VHH-CAAX (YVKM×2) and EGFP-P2A-YVKM×3-VHH-CAAX (YVKM×3) plasmids, were constructed. The schematic diagram of the recombinant plasmid is as shown in Figure 1 shown. The TM sequence is a transmembrane sequence derived from the PDGFRB protein. Its use here is to anchor the EGFP target, which is not originally a membrane protein, to the membrane through the TM sequence to simulate a membrane protein. Its corresponding base sequence is: SEQ ID NO:9 - ATCTACATCTGGGCGCCCTTGGCCGGGACTTGTGGGGTCCTTCTCCTGTCACTGGTTATCACCCTTTACTGC.

[0025] Example 2: Targeted degradation of exogenous overexpressed EGFP by the CleTAC system Taking human embryonic kidney cells HEK-293T as an example, the recombinant plasmids constructed in Example 1 were co-transfected with lentiviral packaging plasmids (PSpax2 and PMD2.0) at a ratio of 2:1.5:1 for lentiviral packaging. After culturing at 37°C and 5% CO2 for 6 h, the fresh medium was replaced and the cells were cultured for another 24 h. The lentivirus was collected, centrifuged at 800 rpm for 5 min to remove cell debris, and then filtered through a 0.45 μm filter membrane to obtain the lentiviral solution.

[0026] The lentiviral solution was concentrated using a lentivirus concentration kit to increase its titer and improve the efficiency of transfecting cells.

[0027] The specific implementation steps are as follows: (1) Mix the lentivirus concentration reagent and the lentiviral solution at a ratio of 3:1 and invert thoroughly to mix. (2) Invert and mix thoroughly every 30 min and repeat 3 times. (3) Incubate overnight in a 4°C refrigerator. The next day, centrifuge at 300 g for 10 min in a centrifuge, discard the supernatant, retain the precipitate at the bottom, and resuspend the precipitate at the bottom with DMEM complete medium. The purified lentivirus is obtained and used for cell transfection.

[0028] The concentrated lentiviral solution was used to infect HEK-293T cells at MOI = 20. After culturing at 37°C for 24 h, the fresh medium was replaced and the cells were cultured for another 24 h. After multiple rounds of screening with puromycin (50 μg / mL), a stable cell line stably expressing the plasmid was obtained. Flow cytometry was used to detect the content and intensity changes of EGFP green fluorescence. The results are as shown in Figure 2As shown, compared with the control blank control group and the VHH-FVKM mutant control group, the VHH-YVKM group, the VHH-YVKM-CAAX group, the YVKM-VHH-CAAX group, and the YVKM×2 group and YVKM×3 group obtained by repeating the YVKM sequence based on YVKM-VHH-CAAX all showed a significant decrease in the content of EGFP green fluorescence. Therefore, YVKM×3 with the highest degradation efficiency was selected as the degradation system for subsequent verification and was collectively referred to as CleTAC later.

[0029] Example 3: The CleTAC system achieves protein degradation through the Clathrin-mediated endocytosis pathway To prove that the CleTAC protein-targeted degradation system functions through the Clathrin-mediated endocytosis pathway, the control-CAAX and CleTAC stable cell lines constructed in Example 2 were selected, and Pitstop 2 (30 μM, 30 min) was added to the CleTAC stable cell line for treatment. Among them, Pitstop 2 is a Clathrin inhibitor that inhibits Clathrin-mediated endocytosis (CME) by binding to the terminal domain of Clathrin. After 30 min of drug treatment, a flow cytometer was used to detect the level and intensity changes of EGFP green fluorescence, and the results are as Figure 3 shown. It can be seen that the CleTAC group without adding Pitstop 2 showed significant EGFP degradation compared with the control control group, while in the drug treatment group with Pitstop 2 added, this EGFP protein degradation effect was significantly inhibited, indicating that the CleTAC protein-targeted degradation system functions through the Clathrin-mediated endocytosis pathway.

[0030] To further illustrate that the CleTAC protein-targeted degradation system functions through the Clathrin-mediated endocytosis pathway, the co-immunoprecipitation method was used to detect the binding effect of YVKM and FVKM with AP50. Among them, AP50 is the μ2 subunit of the AP2 complex and is considered to bind to the YXXΦ motif and play a key role in the CME pathway. The results are as Figure 4 shown. It can be seen that YVKM has a direct interaction with AP50, while there is an interaction between the mutant FVKM and AP50 but it is significantly weakened compared with that of YVKM.

[0031] The lysosome localization of the control-CAAX group and the CleTAC group was observed and compared using confocal microscopy. Among them, green is the EGFP fluorescent protein, blue is the nuclear localization, and red is the lysosome probe localization. The results are as Figure 5As shown, most of the green fluorescence in the control group was localized on the membrane. In the CleTAC experimental group, significant co-localization of EGFP green fluorescent protein and the red lysosome probe was observed, that is, EGFP localized on the cell membrane was targeted to lysosomes by the CleTAC degradation system and protein degradation was achieved via the CME pathway.

[0032] Example 4: Targeted degradation of endogenous HER2 and CTLA4 by the CleTAC system In T cell-related experiments, the inventors observed an unexpected increase in the surface expression of HER2 antigen on CAR-T cells after stimulation with U251 tumor cells ( Figure 6 A - C). To determine the source of these HER2 antigens, the HER2 surface expression of the remaining U251 cells was further evaluated. Quantitative analysis showed that the HER2 surface level of U251 cells was significantly reduced after CAR-T treatment compared to untreated controls ( Figure 6 D - E). This phenomenon is consistent with previous reports describing CAR-mediated eosinophilia (CMT), which is the process by which activated T cells acquire tumor antigens, thereby reducing the antigen density on tumor cells. CMT usually promotes the emergence of antigen-negative tumor escape variants and generates antigen-positive CAR-T cells.

[0033] Given the negative impact of CMT on CAR-T cells, the inventors designed three novel proteins that can bind to the inner membrane region of HER2 using the RFdiffusion and ProteinMPNN methods ( Figure 7 A and Figure 7 B). These designed proteins were rigorously biochemically verified by quantitative co-immunoprecipitation (co-IP) analysis to confirm their high binding affinity ( Figure 7 C). Subsequently, the VHH sequence in the CleTAC plasmid was replaced with the verified HER2-binding protein to construct the HER2-CleTAC plasmid, which was introduced into T cells by electroporation. CleTAC-mediated HER2 removal significantly reduced the incidence of CMT, thereby preventing CMT-induced T cell death and CAR-T cell exhaustion, and ultimately enhancing the antitumor effect of CAR-T cells ( Figure 8 ).

[0034] PP2AA (regulatory subunit A of protein phosphatase 2A), is thought to specifically bind to the CTLA4 protein and play a targeted localization function.

[0035] To verify that the system can be used to degrade endogenous inhibitory receptor proteins, the VHH in the CleTAC recombinant sequence was replaced with the PP2AA sequence, and the EGFP-P2A sequence was removed. A stable overexpressing YVKM×3-PP2AA-CAAX (CleTAC-P) CAR-T cell was constructed by the same method as constructing the 293T stable cell line described above. The degradation schematic diagram is as shown in Figure 9 Figure [0000132]. CTLA4 on the cell membrane surface binds to the PP2AA sequence in the CleTAC-P degradation system. The YVKM sequence binds to clathrin and adaptor protein complex 2 (AP2), and forms endosomes through clathrin-mediated endocytosis and transports them to lysosomes, achieving targeted degradation of proteins.

[0036] The CAR-T cells used in this example were derived from peripheral blood mononuclear cell (PBMC) samples of healthy donors, and the U251 glioma cell line was used as the target cell. The CAR-T cells and 251-GFP cells were co-cultured at various effector-to-target (E:T) ratios, and the tumorolytic activity after co-culture was measured. The cytotoxicity was determined relative to the luminescence reading of the tumor control well only, defined as 100%. The results are as shown in Figure 10 Figure [0000135]. It can be seen that although the initial number of CAR-T cells was comparable, at different E:T ratios, the percentage of tumor target cells killed by the CAR-T cells in the CleTAC-P group was significantly higher than that of the control CAR-T cell group.

[0037] The enzyme-linked immunosorbent assay (ELISA) method was used to detect the secretion of cytokines. The specific steps are as follows: 1. Select an ELISA microplate with strong antibody adsorption. First, rinse it once with coating buffer. Dilute the cytokine antibody with coating buffer and add 100 μL to each well. Seal it and incubate overnight at 4 °C in the dark. After incubation, wash it once with washing buffer. 2. Add 250 μL of blocking solution to each well and incubate overnight at 4 °C in the refrigerator. Take it out and wash it twice. 3. Add 100 μL of diluted sample to each well, let it stand at room temperature for 1 h, wash it twice, and then add 100 μL of primary antibody to each well. After 1 h at room temperature, wash it four times. 4. Add 100 μL of enzyme-labeled secondary antibody to each well. After 1 h at room temperature, wash it five times. 5. Add 100 μL of substrate to each well and place it at room temperature for 10 min. When the color of the standard well reaches an appropriate depth, add 100 μL of stop solution to terminate the reaction. 6. Use an enzyme-linked immunosorbent assay reader to detect the absorbance at 450 nm. Finally, analyze and process the data. The results are as shown in Figure 11 Figure [0000144].

[0038] From Figure 11 It can be seen that the cytokines (IL-2, IFNγ, IL-6, and IL-1β) secreted by the CleTAC experimental group were significantly more than those of the control group T cells and the CAR-T cell group only transduced with CAR, indicating that the anti-tumor activity of the CAR-T cells in the CleTAC experimental group was enhanced.

[0039] Example 5: Establishment of a nude mouse orthotopic glioma model Select the C57bI / 6 nude mouse orthotopic tumor-bearing model as the research object, and use the U251 glioma cells stably transfected with the EGFP-Luc plasmid constructed above. The specific steps are as follows: (1) Digest the 251 cells with 0.25% trypsin, centrifuge at 1000 rpm for 5 min at room temperature, remove the supernatant, and resuspend and wash the cells twice with sterile PBS by centrifugation; (2) Use a cell counter to calculate the number of cells, and adjust the cell concentration to 1×10 7 cells / mL, and resuspend with PBS to make a cell suspension for injection; (3) Anesthetize the nude mice to be tested with isoflurane, fix their heads in the stereotaxic apparatus in the prone position, disinfect the skin on the top of the head with iodophor, first cut open the skin on the top of the head to expose the anterior fontanelle, and the inoculation site is 0.5 mm behind the midpoint of the anterior fontanelle and 2 mm to the right of the sagittal suture; (4) Use a microsyringe to aspirate 5 μL of the tumor cell suspension and insert the needle vertically to a depth of 4 mm, immediately withdraw the needle about 1 mm, stay for 1 min, and slowly inject the tumor cell suspension at an injection speed of 0.5 μL / min. After the injection is completed, stay for 2 min, slowly withdraw the needle, and stay for 1 min for every 1 mm withdrawn until it is completely withdrawn; (5) Seal the needle hole with bone wax to reduce the leakage of the tumor cell suspension, suture the scalp, and finally disinfect with iodine tincture, and place it in a warm place to wait for the nude mice to wake up. 3 days after implantation, inject PBS into the tail vein of the control group, 3×10 6 CAR-T cells and 3×10 6 CAR-T cells treated with CleTAC, and repeat the injection once every 7 days. The schematic diagram of model establishment is as Figure 12 shown.

[0040] Record the body weight of the nude mice every 7 days, and dynamically monitor the tumor growth with an in vitro imager. The bioluminescent substrate potassium luciferin is dissolved in PBS (15 mg / mL). 10 min after intraperitoneal injection of 150 mg / kg potassium luciferin, obtain bioluminescent images through IVISSpectrum (Perkin Elmer), and use Living Image software (Version 4.3.1) to obtain and quantify the bioluminescent imaging data set. The results are as Figure 13 - 14As shown in the figure, the intensity of bioluminescence imaging shows that under the same experimental conditions and culture environment, the three groups of nude mice were successfully implanted with orthotopic gliomas. After injection of PBS, CAR-T and CleTAC CAR-T, the trend of tumor cells and body weight loss in the CleTAC CAR-T treatment group was significantly and effectively controlled, indicating that the CleTAC system can effectively improve the anti-tumor function of CAR-T cells by degrading CTLA4 compared with untreated CAR-T cells to inhibit tumor growth.

[0041] The same ELISA method for detecting cytokines was used to detect the secretion of cytokines (IFNγ, IL-2, IL-6 and IL-1β) in the serum of the three groups of nude mice, and the results were as follows: Figure 15 As shown. It can be seen that compared with the untreated CAR-T group, the secretion of some serum cytokines increased significantly, indicating that CleTAC CAR-T cells also showed enhanced anti-tumor activity in in vivo experiments.

[0042] In summary, the protein targeted degradation system described in the present invention recombines the YVKM sequence with the CAAX sequence and the protein targeting sequence, and uses the characteristics of the Clathrin-mediated endocytosis pathway to target the target protein to the lysosome for degradation, which can significantly reduce the levels of overexpressed EGFP protein and endogenous CTLA4 in the cell, especially when the YVKM sequence is repeated 3 times, it has a stronger degradation efficiency; this study provides a highly efficient targeted protein degradation system, which has a significant degradation effect on extracellular exogenous EGFP and endogenous inhibitory receptor protein CTLA4, and it has been proven to be able to effectively enhance the anti-tumor function of CAR-T cells, providing a basis for the development of cancer treatment drugs.

[0043] Finally, it should be emphasized that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various changes and modifications. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A membrane protein targeted degradation system based on the YVKM sequence, characterized in that, The membrane protein targeted degradation system is recombined by a YVKM sequence, a CAAX sequence and a protein targeting sequence, and the CAAX sequence is at the C-terminus of the recombinant sequence.

2. The membrane protein targeted degradation system based on the YVKM sequence according to claim 1, wherein, The protein targeting sequence is in the middle of the recombinant sequence.

3. The membrane protein targeted degradation system based on the YVKM sequence according to claim 1, wherein, There are 2-3 groups of consecutive YVKM sequences in the recombinant sequence.

4. The membrane protein targeted degradation system based on the YVKM sequence according to claim 1, wherein, The protein targeting sequence is an exogenous overexpressed protein sequence or an endogenous protein sequence, and targets the degradation of overexpressed EGFP, endogenous HER2 protein or CTLA4 protein.

5. A membrane protein targeted degradation system based on the YVKM sequence according to claim 4, characterized in that, When the membrane protein targeted degradation system targets the degradation of overexpressed EGFP, the protein targeting sequence is a VHH sequence, and its amino acid sequence has a corresponding base sequence as shown in SEQ ID NO:

4.

6. The membrane protein targeted degradation system based on the YVKM sequence according to claim 4, characterized in that, When the membrane protein targeted degradation system targets endogenous HER2 protein, the protein targeting sequence is a HER2-binding sequence, and its amino acid sequence has a corresponding base sequence as shown in SEQ ID NO:

7.

7. The membrane protein targeted degradation system based on the YVKM sequence according to claim 4, wherein, When the membrane protein targeted degradation system targets endogenous CTLA4 protein, the protein targeting sequence is a PP2AA sequence, and its amino acid sequence has a corresponding base sequence as shown in SEQ ID NO:

8.

8. A method for constructing a membrane protein targeted degradation system based on the YVKM sequence according to any one of claims 1-7, characterized in that, It includes the following steps: Using myr-Akt1 as a plasmid vector, selecting XbaI and EcoRI as restriction enzyme sites to obtain a backbone, inserting the YVKM sequence and the protein targeting binding sequence into the backbone in sequence. After synthesizing the plasmid, insert the CAAX sequence at the C-terminus of the obtained synthetic plasmid sequence to obtain the recombinant plasmid.

9. Use of the membrane protein targeted degradation system according to any one of claims 1-7 in the degradation of exogenous overexpressed EGFP, the degradation of endogenous HER2 protein or the inhibitory receptor CTLA4 protein.

10. Use of the membrane protein targeted degradation system according to any one of claims 1-7 in the preparation of anti-tumor drugs.