Transgenic chlamydomonas for exocytosis of antibacterial peptide as well as construction method and application of transgenic chlamydomonas

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to transgenic chlamydomonas capable of secreting antibacterial peptide outside cells as well as a construction method and application of the transgenic chlamydomonas. Specifically, the invention provides transgenic chlamydomonas capable of secreting antibacterial peptide outside cells. Tests prove that not only can the water quality be improved and the immunity of fishes be improved, but also the step of purifying the antibacterial peptide protein can be effectively omitted. The zebra fish experiment is carried out, and it is proved that the survival rate of the zebra fish can be increased. Meanwhile, compared with an escherichia coli and yeast expression system, the chlamydomonas reinhardtii can also be used as bait of aquatic organisms such as fishes and shrimps, can also be cultured in a closed culture pond, and has important application potential in the aquaculture industry.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbiology, and particularly relates to a transgenic Chlamydomonas reinhardtii that extracellularly secretes antibacterial peptides, and a construction method and application thereof. Background Art

[0002] The information disclosed in the background art of the present invention is only intended to enhance the overall understanding of the present invention, and is not necessarily regarded as an admission or an indication in any form that this information constitutes the prior art already known to those of ordinary skill in the art.

[0003] In recent years, due to the advantages of broad-spectrum bactericidal activity, high efficiency, and low cost, antibiotics have been widely used in medical treatment, animal breeding, crop production, and other aspects. The long-term use of antibiotics has brought serious problems of bacterial antimicrobial resistance (AMR), and even multi-drug resistant bacteria have emerged. The infection frequency caused by antibiotic-resistant bacteria, especially the "ESKAPE" pathogens (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter spp.) continues to increase, leading to serious morbidity and mortality. However, the research and development of new antibiotics have not been smooth. According to the statistics of the FDA, in the first decade of the 21st century, only 9 new antibiotic varieties were launched. Therefore, there is an urgent need to find new antibacterial drugs with high activity, low toxicity, and unique antibacterial mechanisms to cope with the spread of drug-resistant bacteria worldwide.

[0004] Antibacterial peptides are small peptides composed of 12-50 amino acid residues. Currently, more than 3,100 natural antibacterial peptides have been discovered. These peptides are important components of the innate immune systems of most organisms (including plants, mollusks, amphibians, fish, and mammals, etc.), participating in regulating the immune system to combat various invasive pathogens, and are considered key defense components of the non-specific immune function of organisms. Antibacterial peptides have broad-spectrum antibacterial effects, not only killing certain fungi, protozoa, and drug-resistant bacteria, but also having certain antiviral and anti-tumor effects.

[0005] In the field of aquaculture, the application prospect of antimicrobial peptides is broad. Sparanegtin is a novel antimicrobial peptide protein identified in the mud crab (Scylla paramamosain). It is most abundantly expressed in the testis of male crabs and is significantly expressed under lipopolysaccharide (LPS) or Vibrio alginolyticus challenge. Recombinant Sparanegtin (rSparanegtin) exhibits activity against Gram-positive and Gram-negative bacteria and has effective binding affinity with several polysaccharides. In addition, rSparanegtin has a disruptive effect on the cell wall and surface of Pseudomonas aeruginosa. It also plays an immunoprotective role in the treatment of Paracoccus mastitis and regulates several immune-related genes against Vibrio alginolyticus infection by significantly reducing the bacterial load in the gills, thereby playing an immunomodulatory role in the hepatopancreas and improving the survival rate of crabs. These findings indicate that Sparanegtin not only has antibacterial activity but may also provide protection by regulating the host's immune response, which makes it potentially valuable as an antibiotic alternative in aquaculture. The discovery of Sparanegtin provides new ideas and methods for addressing the increasingly serious antibiotic resistance crisis, and the physical disruptive effect of this antimicrobial peptide makes it difficult for bacteria to develop resistance, which provides a new strategy for the treatment of infections in the post-antibiotic era.

[0006] As a novel antimicrobial peptide, although Sparanegtin shows potential as an antibiotic alternative, it still faces some drawbacks and challenges in practical applications. On the one hand, production and purification are difficult. The currently mainly used heterologous protein expression systems are mainly the Escherichia coli and yeast expression systems. The E. coli system is simple to operate and low in cost, but there are problems such as endotoxin contamination and lack of eukaryotic protein modification ability. The yeast system can perform post-translational modification, but it may lead to over-glycosylation, affecting the antibacterial activity. In addition, both of these systems require heterotrophic fermentation, consuming a large amount of resources, increasing costs and environmental burdens. On the other hand, the clinical application of sparanegtin is still in its early stage, and relevant clinical trials and data are not yet sufficient. Its long-term safety and effectiveness still need more verification.

[0007] Recent research results show that the Chlamydomonas reinhardtii system has been successfully used to express various antimicrobial peptides, such as ToAmP4, and exhibits significant biological activity. However, there are still many drawbacks in purifying foreign proteins from Chlamydomonas: the expression level of foreign genes may be affected by the integration site in the Chlamydomonas genome, and in some cases, the expression level may be low, which is related to the deletion of specific regions in the Chlamydomonas genome or the integrity of the promoter region; although Chlamydomonas can be used to produce foreign proteins through large-scale culture, how to effectively extract and purify these proteins from the culture medium or cells remains a challenge. Summary of the Invention

[0008] In view of the problems existing in the prior art, the object of the present invention is to provide a transgenic Chlamydomonas reinhardtii that secretes antibacterial peptides extracellularly, and its construction method and application. Specifically, the present invention has developed a new mode of expressing sparanegtin, and by referring to luciferase, the screening efficiency of positive transformants is improved, and it is more convenient and intuitive to obtain Chlamydomonas reinhardtii transformants with high expression of sparanegtin. It has been verified that there is no need to purify the protein on a large scale, and the supernatant of the culture contains sparanegtin protein. The obtained sparanegtin protein has activity, inhibits the growth rate and concentration of bacteria in the environment, and improves the survival rate of aquatic organisms. Based on the above research results, the present invention is completed.

[0009] Specifically, the technical solution of the present invention is as follows:

[0010] In the first aspect of the present invention, there is provided a transgenic Chlamydomonas reinhardtii that secretes antibacterial peptides extracellularly, and the transgenic Chlamydomonas reinhardtii is obtained by using Chlamydomonas reinhardtii as the starting algal strain and expressing an exogenous antibacterial peptide and ubiquitin protein; wherein, the antibacterial peptide is Sparanegtin protein.

[0011] In the present invention, the Chlamydomonas reinhardtii is Chlamydomonas reinhardtii. By exogenous introduction of ubiquitin protein, the target antibacterial peptide (such as Sparanegtin protein) is secreted from the flagella of Chlamydomonas reinhardtii.

[0012] Furthermore, the transgenic Chlamydomonas reinhardtii further comprises a reporter gene, and the reporter gene may be a gene encoding luciferase.

[0013] In the second aspect of the present invention, there is provided a construction method of the above-mentioned transgenic Chlamydomonas reinhardtii, and the construction method comprises: using a plasmid with a luciferase tag and ubiquitin protein, introducing the sparanegtin sequence into the plasmid to obtain a recombinant plasmid, and introducing the recombinant plasmid into the starting algal strain.

[0014] In the third aspect of the present invention, there is provided the application of the above-mentioned transgenic Chlamydomonas reinhardtii in any one or more of the following:

[0015] (a) Bioproduction of Sparanegtin protein;

[0016] (b) Aquaculture.

[0017] In the fourth aspect of the present invention, there is provided a method for improving water quality and enhancing the immunity of aquatic animals, and the method comprises: applying the transgenic Chlamydomonas reinhardtii to the water body for raising aquatic animals.

[0018] The beneficial technical effects of the above one or more technical solutions:

[0019] The above technical solution provides a transgenic Chlamydomonas reinhardtii that secretes antibacterial peptides extracellularly. Experimental results have shown that it can not only improve water quality and enhance the immunity of fish, but also effectively eliminate the step of purifying antibacterial peptide proteins. In addition, the above technical solution has also conducted zebrafish experiments, demonstrating that it helps to improve the survival rate of zebrafish.

[0020] Meanwhile, compared with the Escherichia coli and yeast expression systems, Chlamydomonas reinhardtii can also be used as feed for aquatic organisms such as fish and shrimp, and can be cultured in closed aquaculture ponds, showing great application potential in the aquaculture industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The accompanying drawings forming a part of this invention are used to provide a further understanding of the invention. The schematic embodiments of the invention and their descriptions are used to explain the invention and shall not be construed as an improper limitation to the invention.

[0022] Figure 1 Schematic diagram of recombinant plasmids constructed based on different biological elements in the present invention.

[0023] Figure 2 Schematic diagram of luciferase expression of transformants screened from the secretory plasmid part in the present invention and results of extracellular antibacterial peptide protein secretion of some positive transformants.

[0024] Figure 3 Schematic diagram of luciferase expression of transformants of the non-secretory (no ubiquitin) plasmid in the present invention and results of sparanegtin protein expression only in the cell body of the non-secretory plasmid.

[0025] Figure 4 Graph showing the content of antibacterial peptides in the culture supernatant of Chlamydomonas in the present invention.

[0026] Figure 5 Graph showing the detection of sparanegtin protein expression by Western blotting in the present invention.

[0027] Figure 6 Graph showing the results of in vitro antibacterial experiments in the present invention.

[0028] Figure 7 Graph showing the results of zebrafish challenge experiments in the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0029] It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs.

[0030] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular forms are also intended to include the plural forms. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they specify the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0031] As mentioned above, expressing antimicrobial peptides in Chlamydomonas has high purification difficulty on the one hand; on the other hand, it has little advantage in aquaculture. Directly extracting the protein and acting on the fish living environment or using Chlamydomonas as feed has high costs and has little effect on increasing fish production.

[0032] In view of this, a typical embodiment of the present invention provides a transgenic Chlamydomonas that secretes antimicrobial peptides extracellularly. The transgenic Chlamydomonas uses Chlamydomonas as the starting algal strain and is obtained by expressing exogenous antimicrobial peptides and ubiquitin proteins. Among them, the antimicrobial peptide is Sparanegtin protein.

[0033] In the present invention, the Chlamydomonas is Chlamydomonas reinhardtii.

[0034] The amino acid sequence of Sparanegtin protein is shown in SEQ ID NO.1; the nucleic acid molecule encoding the Sparanegtin protein has a nucleotide sequence shown in any one of SEQ ID NO.2-3, preferably SEQ ID NO.3; this nucleotide sequence is obtained by optimizing the codons of Sparanegtin protein, which is more conducive to stable and high-level expression in Chlamydomonas.

[0035] In the present invention, the amino acid sequence of the ubiquitin protein is shown in SEQ ID NO.4; the nucleic acid molecule encoding the ubiquitin protein has a nucleotide sequence shown in SEQ ID NO.5.

[0036] Furthermore, the transgenic Chlamydomonas also contains a reporter gene, and the reporter gene can be a gene encoding luciferase; furthermore, the luciferase can be Gaussia luciferase (Gluc, Gaussia Luciferase).

[0037] In another specific embodiment of the present invention, a method for constructing the above transgenic Chlamydomonas is provided. The construction method includes: using a plasmid with a luciferase tag and ubiquitin protein, introducing the sparanegtin sequence into the plasmid to obtain a recombinant plasmid, and introducing the recombinant plasmid into the starting algal strain.

[0038] The secretion efficiency of a single sparanegtin fragment fails to reach the expected effect. In the experiment, we carried out the research on 2×sparanegtin. The secretion efficiency did not increase significantly compared with that of 1×sparanegtin, and the results of in vitro antibacterial experiments showed that the antibacterial effect of 2×sparanegtin was even inferior to that of 1×sparanegtin. However, unexpectedly, adding the linker (GSGGSG) sequence between 2×sparanegtin proteins significantly improved the secretion efficiency of sparanegtin protein and could enhance the antibacterial effect of 2×sparanegtin. Therefore, further, in the recombinant plasmid, the sparanegtin is in double copies; furthermore, there is a linker between the sparanegtins, and the linker can be (GSG) n ; where n is a positive integer, and further n is 1 to 3. Preferably, n is 2.

[0039] The recombinant plasmid can be pZZ-PsaD-2×HA-ubiquitin-2×sparanegtin(linker)-6×His-luc-paro.

[0040] In another specific embodiment of the present invention, the above transgenic Chlamydomonas reinhardtii is provided for use in any one or more of the following:

[0041] (a) Biologically producing sparanegtin protein;

[0042] (b) Aquaculture.

[0043] Furthermore, in the aquaculture, it is specifically manifested as improving water quality and enhancing the immunity of aquatic animals.

[0044] Among them, the aquatic animals can be fish, crustaceans, amphibians, mollusks, etc., such as fish, shrimp, crab, shellfish, soft-shelled turtle, bullfrog, etc., which are not specifically limited herein.

[0045] In another specific embodiment of the present invention, a method for improving water quality and enhancing the immunity of aquatic animals is provided. The method includes: applying the transgenic Chlamydomonas reinhardtii to the water body for raising aquatic animals.

[0046] Among them, the aquatic animals can be fish, crustaceans, amphibians, mollusks, etc., such as fish, shrimp, crab, shellfish, soft-shelled turtle, bullfrog, etc., which are not specifically limited herein.

[0047] The following further explains the present invention through examples, but does not constitute a limitation to the present invention. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention.

[0048] Example

[0049] 1. Plasmid construction: Obtain a plasmid capable of heterologously expressing sparanegtin in Chlamydomonas reinhardtii CC-5415 nit1 agg1 mt+ (Witman g1, https: / / www.chlamycollection.org / ). Use the EcoR V restriction endonuclease to digest the vector alone, and ligate the antimicrobial peptide target fragment into the vector by homologous recombination. At the same time, add a 6×His tag, and its sequence is located in the homologous arms amplified by sparanegtin. After plasmid ligation, transform it, and the sequencing result is correct ( Figure 1 ). Construct 1×sparanegtin, 2×sparanegtin, and sparanegtin-linker-sparanegtin plasmids. Construct the pZZ-PsaD-2×HA-2×sparanegtin-6×His-luc-paro plasmid, that is, the sparanegtin non-secretory plasmid, which is used as a negative control. The target fragment is ligated to the vector by homologous recombination, and double digestion with Nde1 and EcoR1 restriction endonucleases is used to verify the correct insertion. Sequence the plasmid, and no mutations are found, and the sequencing result is correct.

[0050] Among them, the amino acid sequence of Sparanegtin: ALTPIPSPDFFTVAALAAAVHSPSATADIMVTNLAARALTPIPSLASFPTAAAVV TSAGV (SEQ ID NO.1)

[0051] Sequence before codon optimization:

[0052] The nucleic acid sequence of Sparanegtin: 5′-GCGCTGACGCCGATCCCGAGCCCGGATTTCTTCACCGTGGCGGCCTTGGCGGCGGCCGTGCATTCTCCGTCGGCCACAGCGGATATTATGGTCACCAACTTGGCAAGAGGAGCGCTGACGCCGATCCCGAGCCTGGCTTCCTTTCCTACGGCAGCCGCGGTGGTCACTTCGGCGGGGGTT-3′ (SEQ ID NO.2)

[0053] Sequence after codon optimization

[0054] Sparanegtin nucleic acid sequence: 5'-GCGCTGACCCCTATTCCCAGCCCGGACTTTTTCACCGTCGCTGCCCTGGCTGCGGCCGTGCATAGCCCCTCCGCTACCGCCGACATTATGGTCACGAACCTCGCTGCTCGCGCTCTCACCCCCATTCCTTCGCTCGCCAGCTTCCCTACCGCTGCCGCTGTGGTCACGAGCGCTGGCGTT-3' (SEQ ID NO.3).

[0055] Ubiquitin amino acid sequence:

[0056] MQIFVKTLTGKTITLEVESSDTIENVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGA (SEQ ID NO.4)

[0057] Ubiquitin nucleic acid sequence:

[0058] ATGCAGATTTTCGTGAAGACCCTGACCGGCAAGACTATCACCCTCGAGGTG

[0059] GAGTCGTCCGACACCATTGAGAACGTCAAGGCCAAGATCCAGGACAAGGA

[0060] GGGCATCCCCCCGGACCAGCAGCGCCTGATCTTCGCCGGCAAGCAGCTGG

[0061] AGGACGGCCGCACCCTGGCTGACTACAACATCCAGAAGGAGTCGACTCTGCACCTGGTGCTGCGCCTGCGCGGTGCG (SEQ ID NO.5)

[0062] luc is Gaussia luciferase, and its nucleotide sequence is as follows:

[0063] ATGgtcaacGGCGTGAAGGTGCTGTTCGCCCTGATCTGCATCGCCGTGGC

[0064] CGAGGCCAAGCCCACCGAGAACAACGAGGACTTCAACATCGTGGCCGTGG

[0065] CCAGCAACTTCGCCACCACCGACCTGGACGCCGACCGCGGCAAGCTGCCC

[0066] GGCAAGAAGCTGCCCCTGGAGGTGCTGAAGGAGATGGAGGCCAACGCCC

[0067] GCAAGGCCGGCTGCACCCGCGGCTGCCTGATCTGCCTGAGCCACATCAAG

[0068] TGCACCCCCAAGATGAAGAAGTTCATCCCCGGCCGCTGCCACACCTACGA

[0069] GGGCGACAAGGAGAGCGCCCAGGGCGGCATCGGCGAGGCCATCGTGGAC

[0070] ATCCCCGAGATCCCCGGCTTCAAGGACCTGGAGCCCATGGAGCAGTTCATC

[0071] GCCCAGGTGGACCTGTGCGTGGACTGCACCACCGGCTGCCTGAAGGGCCT

[0072] GGCCAACGTGCAGTGCAGCGACCTGCTGAAGAAGTGGCTGCCCCAGCGCT

[0073] GCGCCACCTTCGCCAGCAAGATCCAGGGCCAGGTGGACAAGATCAAGGGC

[0074] GCCGGCGGCGACgatacg(SEQ ID NO.6)

[0075] In the present invention, the nucleotide sequence of plasmid pZZ-PUC19-PsaD-2×HA-ubiquitin-sparanegtin-linker-sparanegtin-6×His-luc-paromomycin is:

[0076]

[0077] 2. Results of luciferase screening for transformants

[0078] The plasmid was introduced into Chlamydomonas by electroporation. After overnight recovery, it was spread on a resistant plate for screening. Single colonies were picked and cultured in a 96-well plate to obtain whole-cell samples, which were snap-frozen in liquid nitrogen and then the luciferase expression was detected. The specific steps are as follows:

[0079] (1) Take 10 μL of the cultured cells and place them on a Chlamydomonas observation slide. If the growth condition of Chlamydomonas is normal (swimming normally) and there is no contamination, electroporation can be carried out;

[0080] (2) Take 50 mL of Chlamydomonas and centrifuge it at 2300 rpm for 3 min in a 50 mL centrifuge tube. After centrifugation, remove the supernatant;

[0081] (3) Resuspend with TAP medium to make the total volume of Chlamydomonas reach 10 mL, and pipette to mix the Chlamydomonas cells evenly;

[0082] (4) Count on a hemocytometer and calculate the total number of Chlamydomonas;

[0083] (5) Centrifuge the Chlamydomonas cells at 2300 rpm for 3 min, and resuspend with the calculated TAP to make the concentration of Chlamydomonas reach 1×10 8 cells / mL;

[0084] (6) Prepare 1.5 mL centrifuge tubes and mix the DNA fragment and Chlamydomonas cells in the required volume;

[0085] (7) Transfer the mixed Chlamydomonas cells to an electroporation cuvette, let it stand on ice for 15 min and then perform electroporation;

[0086] (8) Electroporation parameters: 800 V, 1575 Ω, 50 μF;

[0087] (9) After electroporation, let it recover on ice for 10 min, and transfer the Chlamydomonas cells to 10 mL of TAP liquid;

[0088] (10) Place it in a weak light environment to recover for 24 h;

[0089] (11) Spread the recovered Chlamydomonas on a resistant plate for screening.

[0090] The transformants initially screened on the resistant plate were cultured in a 96-well plate, the supernatant was collected, the luciferase expression level was detected, and the positive transformants that could secrete were picked out for Western blotting experiment to detect whether the antibacterial peptide protein was secreted into the cells. The specific process of transformant screening:

[0091] (1) Pick the mutants screened on the resistance plate onto the P plate and grow them at 22 °C under a photoperiod (light:dark = 14 h:10 h) for 3 - 4 days. Dip an appropriate amount of Chlamydomonas into a 96-well plate containing M medium (150 μL) and continue to culture it under the photoperiod for about 2 days.

[0092] (2) Luciferase detection: Wait for the Chlamydomonas in the 96-well plate to grow for 3 - 4 days, and prepare to detect the expression level of Luciferase. Centrifuge the Chlamydomonas in the 96-well plate, collect the supernatant, and pipette the same volume of cells into a new 96-well plate;

[0093] (3) OD detection: Use a microplate reader to detect and record the OD600 value of the 96-well plate for normalizing the luciferase value;

[0094] (4) Sample collection: The 96-well plate is quickly frozen in liquid nitrogen and stored at -20 °C, which is the sample for Luciferase data;

[0095] (6) Substrate preparation: Coelenterazine is dissolved in absolute ethanol to form a stock solution (1 mM) and diluted at a ratio of 1:100 with buffer2 (0.1 M K2HPO4 (pH = 7.6), 0.5 M NaCl, 1 mM EDTA);

[0096] (7) Sample detection: Thaw and mix the stored Luciferase samples, take 20 μL of the mixture and place it in a white 96-well plate, and automatically add 50 μL of the diluted substrate to each well through a microplate reader to measure the Luciferase value.

[0097] (8) Data collation: Plot the luminescence values at different time points based on the measured fluorescence values and OD600. The luminescence intensity represents the gene expression level.

[0098] Figure 2 Show the transformants of the secreted plasmid part (show 96), and the yellow ones are positive transformants.

[0099] To further verify the secretion results, select three positive transformants of each plasmid to be activated in a 24-well plate, collect 1 ml of cells, centrifuge at 2300 rpm for 3 minutes, collect the supernatant, take 50 μL of the supernatant and add the substrate to detect the luciferase expression. As Figure 2 shown, the detection of a value in the supernatant indicates that the transformant can secrete the antimicrobial peptide protein normally. It can also be seen from the results that the secretion efficiency: Sparanegtin-linker-sparanegtin > 1×sparanegtin > 2×sparanegtin.

[0100] Detect the luciferase expression of sparanegtin non-secretory (no ubiquitin) plasmid transformants, and screen whole cells in a 96-well plate. Figure 3 Show partial screening results.

[0101] To further verify the secretion results, activate the non-secretory positive transformants in a 24-well plate, collect 1 ml of cells, centrifuge at 2300 rpm for 3 minutes, collect the supernatant, and resuspend the precipitate with the same volume of buffer1 (1.5 mM Tris (pH = 7.8), 1 mM EDTA) as the supernatant. Take 50 μl of the supernatant and precipitate separately and add the substrate to detect the luciferase expression. As Figure 3 shown, the constructed non-secretory plasmid can only express sparanegtin protein in the cell body.

[0102] 3. Detect the content of antibacterial peptides in the culture supernatant of Chlamydomonas.

[0103] Static culture Chlamydomonas cells expressing 2×sparanegtin (linker) protein in a 24-well plate. Take 100 μl of the cell suspension at 4 h, 12 h, 24 h, and 48 h respectively, centrifuge at 2300 rpm for 3 minutes, transfer the supernatant to a new EP tube, and freeze it in liquid nitrogen; resuspend the precipitate with the same volume of buffer1 as the supernatant and freeze it in liquid nitrogen. After natural thawing, take 50 μl of the liquid and add 50 μl of the substrate to detect the luciferase expression.

[0104] 4. Detect the expression of sparanegtin protein by Western blotting

[0105] Detect the expression of pZZ-PsaD-2×HA-ubiquitin-2×sparanegtin-6×His-luc-paro plasmid in Chlamydomonas by Western blotting. The size of the expressed protein is about 70 KD. The negative control is the g1 Chlamydomonas sample without any treatment, and the positive control is the purified Lea2B protein with His tag, with a size of about 10 KD.

[0106] 5. In vitro antibacterial experiment

[0107] Detect the antibacterial effect of sparanegtin protein in vitro. Incubate bacteria in a shaker at 37°C until the OD600 reaches 2.0, and then dilute the OD600 to 0.2 using LB. Centrifuge 30 mL of Chlamydomonas at 2300 rpm for 3 min, and filter the supernatant through a 0.22 μm filter to remove cell debris. The Chlamydomonas used is divided into the following groups: Chlamydomonas supernatant group (g1), sparanegtin Chlamydomonas secretion group, sparanegtin Chlamydomonas non-secretion group, carbenicillin antibiotic group, and TAP medium only group. Add 22.5 mL of Chlamydomonas supernatant and 7.5 mL of LB medium to each group, and then add 30 μL of the bacterial dilution. Detect the change in OD value every 3 h. At the 24th hour, add 25 mL of the corresponding Chlamydomonas supernatant to each group, and measure for a total of 30 hours. The results show that sparanegtin secreted by Chlamydomonas has antibacterial activity (against Aeromonas hydrophila and Mycobacterium).

[0108] 6. Zebrafish challenge experiment

[0109] Divide zebrafish of the same age and size into five groups equally: blank control group, sparanegtin secretion group, sparanegtin non-secretion group, g1 Chlamydomonas supernatant control group, and carbenicillin antibiotic control group. Keep each group of fish in a liquid with a volume of 300 mL, and add bacteria until the total volume contains 5×10 7 bacteria. 300 mL is 150 mL of Chlamydomonas supernatant plus 150 mL of water, and change it every day. Observe and count the survival of zebrafish. The results show that 2×sparanegtin cannot improve the survival rate of zebrafish, 1×sparanegtin slightly increases the survival rate, and 2×sparanegtin (linker) can significantly improve the survival rate of zebrafish.

[0110] Matters not covered by this invention are well-known technologies.

[0111] The above are only the preferred embodiments of the present invention and are not used to limit the present invention. For those skilled in the art, the present invention can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A transgenic Chlamydomonas reinhardtii that secretes antibacterial peptides extracellularly, characterized in that, The transgenic Chlamydomonas reinhardtii is obtained by using Chlamydomonas reinhardtii as the starting algal strain and expressing an exogenous antimicrobial peptide and ubiquitin protein; wherein, the antimicrobial peptide is Sparanegtin protein; The Chlamydomonas reinhardtii is Chlamydomonas reinhardtii.

2. The transgenic Chlamydomonas reinhardtii according to claim 1, wherein The amino acid sequence of Sparanegtin protein is shown in SEQ ID NO.1; the nucleotide sequence of the nucleic acid molecule encoding the Sparanegtin protein is shown in any one of SEQ ID NO.2-3, preferably SEQ ID NO.

3. The amino acid sequence of the ubiquitin protein is shown in SEQ ID NO.4; the nucleotide sequence of the nucleic acid molecule encoding the ubiquitin protein is shown in SEQ ID NO.

5.

3. The transgenic Chlamydomonas reinhardtii according to claim 1, wherein The transgenic Chlamydomonas reinhardtii further comprises a reporter gene, and the reporter gene is a gene encoding luciferase; furthermore, the luciferase is Gaussia luciferase.

4. The construction method of the transgenic Chlamydomonas reinhardtii according to any one of claims 1 to 3, characterized in that, The construction method includes: using a plasmid with a luciferase tag and ubiquitin protein, introducing the sparanegtin sequence into the plasmid to obtain a recombinant plasmid, and introducing the recombinant plasmid into the starting algal strain.

5. The construction method according to claim 4, characterized in that, In the recombinant plasmid, the sparanegtin is in double copies; furthermore, a linker is contained between the sparanegtins.

6. The construction method according to claim 5, characterized in that The linker is (GSG) n ; where n is a positive integer, further n is 1 to 3, preferably, n is 2.

7. Use of the transgenic Chlamydomonas reinhardtii according to any one of claims 1-3 in any one or more of the following: (a) Biologically producing Sparanegtin protein; (b) Aquaculture.

8. The application according to claim 7, wherein In the aquaculture, it specifically shows improving water quality and enhancing the immunity of aquatic animals.

9. A method for improving water quality and enhancing the immunity of aquatic animals, the method comprising: Applying the transgenic Chlamydomonas reinhardtii according to any one of claims 1-3 to the water body for raising aquatic animals.

10. The method according to claim 9, characterized in that, The aquatic animals are fish, crustaceans, amphibians and mollusks.

Images