Trichoderma longibrachiatum strain for enhancing fat-soluble medicinal components of salvia miltiorrhiza and application of freeze-dried powder of trichoderma longibrachiatum strain
By establishing a symbiotic relationship with SBa-TL in the T. aphrodisiac strain SBa-TL and Salvia miltiorrhiza, the problem of fluctuations in the content of tanshinone components was solved, and the content of tanshinone compounds was significantly improved and the efficacy of danshinone miltiorrhiza was enhanced.
Patent Information
- Application Number
- CN202510782250.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-12
- Publication Date
- 2025-07-11
- Estimated Expiration
- 2045-06-12
AI Technical Summary
The content of tanshinone fluctuates greatly, resulting in the unqualified quality of danshin miltiorrhiza, and the existing chemical synthesis is difficult to achieve large-scale production.
The SBa-TL strain of T. elongated was used to establish a symbiotic relationship with the Salvia miltiorrhiza plants. By applying the Mycelial suspension of T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated T. elongated
The content of tanshinone I, tanshinone IIA and cryptanshinone was significantly increased, and the efficacy of sanshinone was enhanced in the treatment of cardiovascular diseases. The freeze-dried powder remained highly active for 6 months at room temperature.
Smart Images

Figure CN120290338A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of microorganisms, and particularly relates to the application of a Trichoderma longibrachiatum strain for enhancing the fat-soluble medicinal components of Salvia miltiorrhiza and its freeze-dried powder. Background Art
[0002] Salvia miltiorrhiza, scientific name ( Salvia miltiorrhiza Bunge ), also known as red root and blood ginseng root, belongs to the genus Salvia of the Lamiaceae family. As a traditional Chinese medicine widely used in China, the dried roots and rhizomes of Salvia miltiorrhiza are used as medicinal materials. Its pharmacological components have the effects of promoting blood circulation to remove blood stasis, relieving pain, dredging meridians and collaterals, and clearing the heart and calming the mind. Clinically, it is commonly used to treat coronary heart disease, angina pectoris, peptic ulcer, liver cirrhosis and other diseases. The main active components of Salvia miltiorrhiza include water-soluble phenolic acids and fat-soluble tanshinone compounds, and these two compounds constitute the core of the pharmacological effects of Salvia miltiorrhiza. Tanshinone compounds mainly include tanshinone I, tanshinone IIA, cryptotanshinone, etc. Due to the scarcity of wild resources, the harsh cultivation environment and the demand for standardized medicinal materials in the modern Chinese medicine industry, the current market of Salvia miltiorrhiza mainly relies on artificial cultivation.
[0003] However, due to its scattered distribution, long resource renewal cycle and inconsistent quality, the quality problem of Salvia miltiorrhiza is particularly prominent. Especially the fluctuation of tanshinone component content has become the main factor leading to unqualified quality of Salvia miltiorrhiza. On the other hand, the chemical synthesis of tanshinone components is difficult, and it is difficult to achieve large-scale production. Therefore, how to improve the growth environment of Salvia miltiorrhiza and its medicinal components, especially the content accumulation of tanshinone compounds, has become an important issue that needs to be solved urgently at present. Summary of the Invention
[0004] In order to solve the above technical problems, the purpose of the present invention is to provide the application of a Trichoderma longibrachiatum strain for enhancing the fat-soluble medicinal components of Salvia miltiorrhiza and its freeze-dried powder, so as to solve the problem of large fluctuation in the content of tanshinone components and unqualified quality of Salvia miltiorrhiza caused by the scattered distribution, long resource renewal cycle and inconsistent quality of existing Salvia miltiorrhiza.
[0005] The technical solution of the present invention for solving the above technical problems is as follows: The first object of the present invention is to provide a Trichoderma longibrachiatum ( Trichoderma longibrachiatum ), this strain is named SBa-TL, deposited in the China Center for Type Culture Collection on April 18, 2025, and the deposit number is CCTCC NO: M 2025821.
[0006] The beneficial effects of the present invention are as follows: The present invention provides a Trichoderma longibrachiatum that can increase the content of medicinal components in Salvia miltiorrhiza. Applying this strain to Salvia miltiorrhiza plants can enable the strain to form a symbiotic relationship with the plants, significantly promote the growth of Salvia miltiorrhiza, increase the aboveground and underground biomass of Salvia miltiorrhiza plants, and significantly increase the content of the active components of lipophilic compounds in Salvia miltiorrhiza. Compared with the blank control group, the content of tanshinone I increased by 364%, and the content of cryptotanshinone increased by 359%.
[0007] The second object of the present invention is to provide a microbial agent, which includes the above-mentioned Trichoderma longibrachiatum.
[0008] Furthermore, the above-mentioned microbial agent includes freeze-dried powder of Trichoderma longibrachiatum.
[0009] The beneficial effect of adopting the above further technical solution is: Through the treatment with the freeze-dried powder of Trichoderma longibrachiatum of the present invention, the content of tanshinone medicinal components in the roots of Salvia miltiorrhiza can be greatly increased. Specifically, the content of tanshinone I in the freeze-dried powder treatment group (0.15 g) is as high as 1.07 mg / g, which is 110% higher than that of the control group; the content of cryptotanshinone in the freeze-dried powder treatment group (0.15 g) reaches 6.61 mg / g, which is 123% higher than that of the control group; the content of tanshinone IIA in the freeze-dried powder treatment group (0.15 g) is 0.60 mg / g, which is 94% higher than that of the control group, thus significantly enhancing the medicinal value of Salvia miltiorrhiza in the treatment of cardiovascular diseases.
[0010] Furthermore, the freeze-dried powder of Trichoderma longibrachiatum is prepared by the following method: First, inoculate Trichoderma longibrachiatum on a solid medium and repeat subculture, then inoculate the subcultured strain into a liquid medium for propagation culture, and finally filter the medium to collect wet mycelium, which is then freeze-dried and ground to obtain.
[0011] Furthermore, the number of times of repeated subculture is 2 - 3 times, and the time for each subculture is 3 - 5 d.
[0012] Furthermore, the time for propagation culture is 5 - 7 d, the temperature is 25 - 30 °C, and the oscillation frequency is 100 - 200 r / min.
[0013] The third object of the present invention is to provide the application of the above-mentioned Trichoderma longibrachiatum or the above-mentioned microbial agent in increasing the content of medicinal components in Salvia miltiorrhiza.
[0014] Furthermore, apply the mycelium suspension of Trichoderma longibrachiatum or the microbial agent to Salvia miltiorrhiza.
[0015] Furthermore, the medicinal components of Salvia miltiorrhiza include tanshinone compounds.
[0016] The present invention has the following beneficial effects: (1)The present invention provides a Trichoderma longibrachiatum that can increase the content of medicinal components in Salvia miltiorrhiza. Applying this strain to Salvia miltiorrhiza plants can enable the strain to establish a symbiotic relationship with the plants, significantly promote the growth of Salvia miltiorrhiza, increase the above-ground and underground biomass of Salvia miltiorrhiza plants, and significantly increase the content of active ingredients in Salvia miltiorrhiza, especially increase the content of tanshinone I, tanshinone IIA, and cryptotanshinone, having significant application value.
[0017] (2)The present invention provides a freeze-dried powder prepared from Trichoderma longibrachiatum by freeze-drying technology. This freeze-dried powder can be more beneficial to exert the effect of Trichoderma longibrachiatum, can greatly increase the content of tanshinone drugs in the roots of Salvia miltiorrhiza, significantly enhance the medicinal efficacy value of Salvia miltiorrhiza in the treatment of cardiovascular diseases. This freeze-dried powder can maintain high activity after being stored at room temperature for 6 months and has long-term storage stability. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 It is a morphological diagram of Trichoderma longibrachiatum on a PDA plate medium in Example 1; Figure 2 It is a microscopic diagram of Trichoderma longibrachiatum on a PDA plate medium in Example 1, where Hy is hyphae and S is spores; Figure 3 It is a growth situation diagram of Trichoderma longibrachiatum acting on Salvia miltiorrhiza for 60 days (total growth period is 90 days) in Example 2, where a is the experimental group and b is the control group; Figure 4 It is a growth situation diagram of plant morphological indexes of Trichoderma longibrachiatum acting on Salvia miltiorrhiza for 60 days (total growth period is 90 days) in Example 2, where A is root length, B is surface area, C is root volume, D is plant height, and E is the number of leaves; Figure 5 It is a diagram of plant biomass indexes of Trichoderma longibrachiatum acting on Salvia miltiorrhiza for 60 days (total growth period is 90 days) in Example 2; Figure 6 It is a diagram of tanshinone content of Trichoderma longibrachiatum acting on Salvia miltiorrhiza for 60 days (total growth period is 90 days) in Example 2, where A is tanshinone I, B is cryptotanshinone, and C is tanshinone IIA; Figure 7 It is a growth diagram of the optimal water content and optimal particle size of Trichoderma longibrachiatum freeze-dried powder on a PDA plate medium in Example 3, where a is the optimal water content and b is the optimal particle size; Figure 8 It is an external appearance diagram of the Trichoderma longibrachiatum freeze-dried powder prepared in step (4) of Example 3; Figure 9 It is a growth situation diagram after Trichoderma longibrachiatum freeze-dried powder acts on Salvia miltiorrhiza for 75 days (total growth period is 105 days) in Example 4, where a is the experimental group and b is the control group; Figure 10 It is a diagram showing the growth of plant morphological indexes of Trichoderma longibrachiatum freeze-dried powder acting on Salvia miltiorrhiza for 75 days (total growth period is 105 days) in Example 4. Among them, A is the root length, B is the surface area, C is the root volume, and D is the plant height; Figure 11 It is a diagram of plant biomass indexes of Trichoderma longibrachiatum freeze-dried powder acting on Salvia miltiorrhiza for 75 days (total growth period is 105 days) in Example 4; Figure 12 It is a diagram of tanshinone content of Trichoderma longibrachiatum freeze-dried powder acting on Salvia miltiorrhiza for 75 days (total growth period is 105 days) in Example 4. Among them, A is tanshinone I, B is tanshinone IIA, and C is cryptotanshinone. Detailed implementation mode
[0019] The principles and features of the present invention will be described below with reference to the accompanying drawings. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention. For those not specified in the examples, the conventional conditions or the conditions recommended by the manufacturer are adopted. For the reagents or instruments not specified by the manufacturer, they are all conventional products that can be obtained through commercial purchase.
[0020] Example 1: Isolation and identification of Trichoderma longibrachiatum for enhancing fat-soluble medicinal components of Salvia miltiorrhiza (1) Strain isolation Take the rhizosphere soil of Scutellaria baicalensis Georgi from Anguo, Hebei Scutellaria baicalensis ), and use the dilution coating method to coat the 10 -4 soil dilution solution onto the PDA medium supplemented with ampicillin and streptomycin sulfate. After sealing the petri dish, it is cultured in the dark at 27°C in a constant temperature incubator in an inverted manner. The obtained single colonies are transferred to a new PDA plate for continued culture, and the colonies shown in Figure 1 are obtained. The microscopic characteristics of the hyphae are observed and photographed under a 400-fold BX51 optical microscope, and the results are as shown in Figure 2 .
[0021] (2) Strain identification Use a genomic DNA extraction kit (SolarBio) to extract the DNA of the colonies obtained in step (1). Then use the primers ITS3: 5'-TCCTCCGCTTATTGATATGC-3' (SEQ ID NO.1) and ITS4: 5'-GGAAGTAAAAGTCGTAACAAGG-3' (SEQ ID NO.2) to amplify the colony DNA, and sequence the amplification product. The sequencing result is as shown in SEQ ID NO.3: SEQ ID NO.3: TACCAATCTGTTGCCTCGGCGGGATTCTCTTGCCCCGGGCGCGTCGCAGCCCCGGATCCCATGGCGCCCGCCGGAGGACCAACTCCAAACTCTTTTTTCTCTCCGTCGCGGCTCCCGTCGCGGCTCTGTTTTATTTTTGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCCTCACCGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGGCCACAGCCGTAAAACACCCCAAACTTC。
[0022] The sequence was compared using the NCBI BLAST tool. The results showed that the strain was Trichoderma longibrachiatum ( Trichoderma longibrachiatum ), named SBa-TL, and taxonomically named Trichoderma longibrachiatum SBa-TL.
[0023] Example 2: Pot experiment of promoting the growth of Salvia miltiorrhiza by Trichoderma longibrachiatum (1) Preparation of inoculum First, take the Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) SBa-TL obtained in Example 1, inoculate it into a PDA solid medium and culture it until the medium is covered with sporophytes at a culture temperature of 25 °C; then take 5 fungal cakes with a diameter of 8 mm from the solid medium and inoculate them into a 250 mL conical flask filled with 150 mL of PD liquid medium (potato dextrose medium, pH = 6.8), and culture them under shaking conditions at 26 °C and 150 r / min for 7 d; finally, after the culture is completed, collect the mycelium using a vacuum filtration pump, weigh 2.0 g of wet mycelium, add it to 200 mL of sterile water and mix well to prepare a bacterial solution with a concentration of 10 mg / mL, and store it at 4 °C for later use.
[0024] (2) Seedling raising and inoculation with Trichoderma longibrachiatum Select Danshen seeds that are plump and free from mildew. After washing them 3 times with tap water, soak them in distilled water for 24 h, and then place them in a seedling tray lined with moist filter paper. Conduct dark cultivation at 25°C for 72 h until the seeds germinate. The cultivation substrate is composed of farmland soil and fine river sand mixed at a volume ratio of 2:1. Fill 1300 g of the substrate into each pot (the pot mouth diameter is 13.8 cm, the bottom diameter is 7 cm, and the height is 12.4 cm), and water it until it is completely saturated. Transplant the seedlings with consistent growth into the pots, with 4 plants planted in each pot, and place them in an artificial climate chamber for cultivation (photoperiod 12 h / d, day and night temperature 27°C / 22°C, relative humidity 60%). After 30 d of cultivation, each plant in the experimental group (Tl) is inoculated with 5 mL of mycelial suspension by root irrigation (corresponding mycelial application rate is 50 mg / plant), while the control group (ck) is treated with an equal amount of sterile water, and 4 replicates are set for each group, as Figure 3 shown.
[0025] (3) Determination of morphological indicators Harvest the plants 60 h after inoculating the bacterial liquid. When harvesting, measure the plant height and the number of leaves of the plants. Use an electronic balance with a precision of one ten-thousandth to separate the plants from the rhizome connection point, and weigh the fresh weights of the above-ground part and the roots respectively. After weighing, wash the roots clean and place them in a glass tank filled with clear water to fully expand, obtain root pictures through a scanner (EPSON V800), and use the WinRHIZO image analysis system to calculate the average root volume, root surface area, and total root length. Subsequently, place the above-ground part and the roots of the plants in an 80°C oven and dry them to a constant weight to measure the biomass of the above-ground part and the roots.
[0026] The results of the determination of plant morphological indicators are as Figure 4 shown. The plant height of the Danshen plants treated in the control group is 3.56 cm, the number of leaves is 8, the total root length is 4.13 cm, the root surface area is 87.55 cm 2 and the average root volume is 0.67 cm 3 . While the plant height of the Tl experimental group is 3.78 cm, an increase of 6.2% compared with the control group; the number of leaves reaches 10, with an increase of 20.46%. Its total root length is 4.61 cm, an increase of 11.55%; the root surface area is 104.01 cm 2 , an increase of 18.8%; the root volume is 0.81 cm 3 , an increase of 22.07%.
[0027] The results of the determination of plant biomass indicators are as Figure 5As shown in the figure, the above-ground biomass and underground biomass of Salvia miltiorrhiza treated in the control group were 0.29 g and 0.12 g respectively, while the above-ground biomass and underground biomass of the Tl experimental group were 0.36 g and 0.47 g respectively. Compared with the control group, the above-ground biomass of Salvia miltiorrhiza after treatment increased by about 23.17%, and the underground biomass increased significantly, by 276%.
[0028] (4)Quantitative analysis of tanshinones The content of tanshinone active ingredients in Salvia miltiorrhiza was analyzed by high performance liquid chromatography (HPLC), and the contents of tanshinone I, tanshinone IIA and cryptotanshinone were quantitatively detected.
[0029] Take 0.25 g of dry root powder, add 25 mL of methanol and extract by ultrasonic for 30 min, filter with a 0.22 μm microporous filter membrane to obtain the HPLC injection sample solution.
[0030] HPLC conditions: SymmeTly C18 chromatographic column (4.6×250 mm, 5 μm), mobile phase A is acetonitrile, B is an aqueous solution of phosphoric acid with a mass fraction of 0.05%, the gradient elution program is shown in Table 1, the detection wavelength is 270 nm, the flow rate is 1.0 mL / min, the column temperature is 25°C, and the injection volume is 10 μL; the detection wavelength is 270 nm.
[0031] Table 1 Gradient elution program
[0032] The experimental results are as Figure 6 shown. The experimental group can effectively improve the content of medicinal components of Salvia miltiorrhiza by inoculating Trichoderma longibrachiatum. The contents of tanshinone I, tanshinone IIA and cryptotanshinone in the roots of Salvia miltiorrhiza in the control group were 0.114 mg / g, 0.396 mg / g, and 1.141 mg / g respectively; the contents of tanshinone I, tanshinone IIA, and cryptotanshinone in the roots of Salvia miltiorrhiza in the Tl experimental group were 0.531 mg / g, 0.383 mg / g, and 5.229 mg / g respectively; among them, tanshinone I and cryptotanshinone increased by 364% and 359% compared with the control group. It can be seen that the medicinal component contents of tanshinone I and cryptotanshinone in the roots of Salvia miltiorrhiza plants were extremely significantly increased by inoculating Trichoderma longibrachiatum, while the increase in the content of tanshinone IIA was not obvious.
[0033] Example 3: Preparation of Trichoderma longibrachiatum freeze-dried powder (1)Under aseptic conditions, pick the edge hyphae of Trichoderma longibrachiatum obtained in Example 1 and inoculate them in the center of a PDA plate. Incubate in the dark at 28 °C for 5 d, and subculture 2-3 times until the colony morphology is uniform. After the colony grows, use a sterile punch to prepare 5 pieces of 8 mm×8 mm agar plugs, and inoculate them into a 250 mL conical flask (containing 150 mL of PD liquid medium). Incubate with shaking at 27 °C and 150 r / min for 7 d, and a total of 21 bottles of Trichoderma longibrachiatum liquid are prepared. After completion, Trichoderma longibrachiatum liquid is obtained.
[0034] (2)Preparation of freeze-dried powder and optimization of water content The mycelium of step (1) is collected by vacuum filtration with a vacuum pump, and the collected mycelium is divided into portions of 5 g (wet weight). The wet mycelium is placed in a -20 °C refrigerator for pre-freezing for 12 h, and after pre-freezing, it is placed in a freeze dryer for drying at -53 °C and a vacuum degree of 10 Pa.
[0035] Six different gradients of water content (0%, 0%-1%, 1%-2%, 2%-3%, 3%-4%, 4%-5%) are set, and 5 replicates are set for each group. Mycelium with different water contents is obtained by controlling the drying time.
[0036] The solid mycelium with different water contents is inoculated into PDA solid medium in a laminar flow hood (the size of the petri dish is 9 mm×9 mm), and incubated in the dark in a 28 °C constant temperature incubator. Each petri dish contains 1 agar plug of the same size, and 5 replicates are set for each water content range. The inoculation day is recorded as the 0th day of inoculation. Using the cross method, measure the colony diameter on the 2nd and 3rd days after inoculation, and the colony growth is shown in Table 2. The control group is replaced with fresh agar plugs of the same size, and 5 replicates are set.
[0037] Table 2 Colony growth of solid mycelium inoculated with different gradients of water content
[0038] Note: In Table 2, among the same column, the data marked with the same letter have no significant difference, and the data marked with different letters have significant differences.
[0039] The results show that Trichoderma longibrachiatum grows best under the condition of 3%-4% water content, especially on the third day. The growth performance of the control group (CK) on the second day is better than that of all water content groups, but on the third day, the growth performance of the 3%-4% water content group exceeds that of the control group. To sum up, Trichoderma longibrachiatum grows best when the water content is 3%-4%, as shown in Figure 7 Figure a in
[0040] (3)Effect of powder particle size on freeze-dried powder microbial agents Prepare solid mycelium of Trichoderma longibrachiatum with a water content of 3%-4% according to the method in step (2). After grinding the obtained solid mycelium, sieve it through sieves with pore sizes of 0.6 mm, 0.25 mm, 0.15 mm, and 0.1 mm respectively to obtain freeze-dried bacterium agents with particle sizes greater than 0.6 mm, 0.25-0.6 mm, 0.15-0.25 mm, 0.1-0.15 mm, and less than 0.1 mm. Inoculate the freeze-dried bacterium agents with different particle sizes into PDA medium and culture them in the dark in an incubator at 28°C. Each petri dish contains one kind of bacterium agent with a specific particle size, and each kind of bacterium agent is set with 5 replicates. Record the day of inoculation as the 0th day of inoculation. Using the cross method, measure the colony diameter on the 2nd day of inoculation. The colony growth situation is shown in Table 3. The control group uses fresh fungus cakes of the same size instead, with 5 replicates set.
[0041] Table 3 Colony growth of Trichoderma longibrachiatum freeze-dried powder with different particle sizes
[0042] Note: In Table 3, in the same column, the data marked with the same letter have no significant difference, and the data marked with different letters have significant differences.
[0043] According to the analysis of the experimental results in Table 3, under the condition of different particle sizes, the freeze-dried powder of Trichoderma longibrachiatum with a particle size greater than 0.600 mm shows the best growth state as Figure 7 shown in Figure b in
[0044] (4)Storage of freeze-dried bacterium agent Prepare the freeze-dried bacterium agent of Trichoderma longibrachiatum with a particle size greater than 600 mm and a moisture content of 3%-4% according to the method in step (3). As Figure 8 shown, store the prepared bacterium agent in a self-sealing bag and store it at room temperature (25°C), 4°C, and -20°C respectively. Then inoculate the bacterium agent into PDA medium and culture it in the dark in an incubator at 28°C. It is observed that the freeze-dried bacterium agent of Trichoderma longibrachiatum can grow normally after being stored for 6 months at the three storage temperatures.
[0045] (5)Determination of pH value and spore number of freeze-dried bacterium agent Weigh 15 g of the freeze-dried bacterium agent sample of Trichoderma longibrachiatum prepared in step (4) and put it into a 50 mL beaker. Add deionized water to the beaker according to the mass ratio of sample:deionized water = 1:2 and stir evenly. Then let it stand for 30 min. Use a PHBJ-260 portable pH meter to measure the pH value of the sample suspension. Record the value after the instrument reading is stable. The measured pH value is 6.4.
[0046] The spore number of Trichoderma longibrachiatum is determined by the hemocytometer method, and the spore concentration of Trichoderma is measured to be 3.2×10 8 CFU / g.
[0047] Example 4: Pot Experiment on Promoting the Growth of Salvia miltiorrhiza by Trichoderma longibrachiatum Freeze-dried Powder (1)Preparation of Trichoderma longibrachiatum Freeze-dried Powder The preparation method of Trichoderma longibrachiatum freeze-dried powder is the same as that in step (4) of Example 3.
[0048] (2)Seeding and Inoculation of Trichoderma longibrachiatum Freeze-dried Powder Select plump and non-mildewed Salvia miltiorrhiza seeds, wash them 3 times with tap water, then soak them in distilled water for 24 h, and then place them in a seedling tray lined with moist filter paper. Incubate them in the dark at 25 °C for 72 h until the seeds germinate. The cultivation substrate is composed of farmland soil and fine river sand mixed in a volume ratio of 2:1. Each pot (the diameter of the pot mouth is 15.7 cm, the diameter of the pot bottom is 11.5 cm, and the height is 13 cm) is filled with 1500 g of the substrate and watered until it is completely saturated. Transplant the seedlings with consistent growth into the pots, plant 4 plants in each pot, and place them in an artificial climate chamber for cultivation (photoperiod 12 h / d, day and night temperature 27 °C / 22 °C, relative humidity 60%). After 30 d of cultivation, inoculate the Trichoderma longibrachiatum freeze-dried powder bactericide. Four gradients of inoculation amounts are set, namely 0.045 g, 0.15 g, 0.3 g, and 0.45 g. The freeze-dried powder bactericide is inoculated into the roots of single seedlings by the root irrigation method. Mix the corresponding grams of the bactericide with 20 mL of water to obtain Trichoderma longibrachiatum freeze-dried powder inoculation solutions with different concentrations. Then take 5 mL of Trichoderma longibrachiatum freeze-dried powder inoculation solutions with different concentrations and use the root irrigation method to inoculate them into the roots of single seedlings respectively. Set 4 replicates, and set another 4 pots of single seedlings inoculated with 5 mL of sterile water as blank controls. Continue to cultivate for 75 d and then harvest, as Figure 9 shown.
[0049] (3)Measurement of Morphological Indexes The measurement method is the same as that in Example 2.
[0050] The total root length, surface area, root volume, and plant height of Salvia miltiorrhiza in the blank control group are 804.59 cm, 37.21 cm 2 , 1.37 cm 3 , 8.77 cm, respectively. The results of the total root length, surface area, root volume, and plant height of Salvia miltiorrhiza in the treatment groups with different inoculation amounts of Trichoderma longibrachiatum freeze-dried powder are shown in Table 4 and Figure 10 shown.
[0051] Table 4 Measurement Results of Morphological Indexes of Salvia miltiorrhiza in Treatment Groups with Different Inoculation Amounts of Trichoderma longibrachiatum Freeze-dried Powder
[0052] The results show that compared with the blank control group, the root length, surface area, root volume, and plant height of Salvia miltiorrhiza treated with Trichoderma longibrachiatum freeze-dried powder in the present invention are all increased.
[0053] As Figure 11 shown, the biomass of Salvia miltiorrhiza plants can be significantly increased by treatment with Trichoderma longibrachiatum freeze-dried powder. The above-ground biomass and underground biomass of Salvia miltiorrhiza treated in the blank control group were 0.71 g and 0.41 g respectively; the above-ground biomass and underground biomass of Salvia miltiorrhiza in the treatment group with 0.045 g of Trichoderma longibrachiatum freeze-dried powder were 1.01 g and 1.4 g respectively, a 43% and 238% increase compared to the blank control. The above-ground biomass and underground biomass of Salvia miltiorrhiza in the treatment group with 0.15 g of Trichoderma longibrachiatum freeze-dried powder were 1.11 g and 1.388 g respectively, a 57% and 236% increase compared to the blank control. The above-ground biomass and underground biomass of Salvia miltiorrhiza in the treatment group with 0.3 g of Trichoderma longibrachiatum freeze-dried powder were 1.13 g and 1.53 g respectively, a 60% and 271% increase compared to the blank control. The above-ground biomass and underground biomass of Salvia miltiorrhiza in the treatment group with 0.45 g of Trichoderma longibrachiatum freeze-dried powder were 1.40 g and 1.42 g respectively, a 98% and 244% increase compared to the blank control. As can be seen from the above, the above-ground biomass of Salvia miltiorrhiza is optimal when the inoculation amount of Trichoderma longibrachiatum freeze-dried powder is 0.45 g, with a 98% increase, and the underground biomass is the largest when the inoculation amount is 0.3 g, with a 271% increase.
[0054] (4)Quantitative analysis of tanshinones in Salvia miltiorrhiza The determination method is the same as that in Example 2. The contents of tanshinone I, tanshinone IIA, and cryptotanshinone in the roots of Salvia miltiorrhiza treated in the blank control group were 0.51 mg / g, 0.31 mg / g, and 2.97 mg / g respectively; the contents of tanshinone I, tanshinone IIA, and cryptotanshinone in the roots of Salvia miltiorrhiza in the treatment groups with different inoculation amounts of Trichoderma longibrachiatum freeze-dried powder are shown in Table 5 and Figure 12 as follows.
[0055] Table 5 Quantitative analysis results of tanshinones in the roots of Salvia miltiorrhiza in the treatment groups with different inoculation amounts of Trichoderma longibrachiatum freeze-dried powder
[0056] The results show that compared with the blank control group, the treatment with different inoculation amounts of Trichoderma longibrachiatum freeze-dried powder significantly increased the contents of the medicinal components of tanshinone I, tanshinone IIA, and cryptotanshinone in the roots of Salvia miltiorrhiza plants. Among them, the effect was the most significant when the inoculation amount was 0.15 g.
[0057] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.
Claims
1. Trichoderma longibrachiatum for enhancing fat-soluble medicinal components of Salvia miltiorrhiza Trichoderma longibrachiatum ) characterized in that This strain is named SBa-TL, deposited in the China Center for Type Culture Collection on April 18, 2025, with the deposit number CCTCC NO: M 2025821.
2. A microbial preparation, characterized in that, It includes Trichoderma longibrachiatum as described in claim 1.
3. The microbial preparation according to claim 2, wherein It includes the freeze-dried powder of Trichoderma longibrachiatum.
4. The microbial preparation according to claim 3, characterized in that, The freeze-dried powder of Trichoderma longibrachiatum is prepared by the following method: First, inoculate Trichoderma longibrachiatum on a solid medium and repeat subculture. Then, inoculate the subcultured strain into a liquid medium for propagation culture. Finally, filter the medium to collect wet mycelium, which is then freeze-dried and ground.
5. The microbial preparation according to claim 4, characterized in that, The number of times of repeated subculture is 2 - 3 times, and the time for each subculture is 3 - 5 d.
6. The microbial agent according to claim 4, wherein The time for propagation culture is 5 - 7 d, the temperature is 25 - 30 °C, and the oscillation frequency is 100 - 200 r / min.
7. Use of Trichoderma longibrachiatum as described in claim 1 or the microbial preparation as described in any one of claims 2 - 6 in increasing the content of medicinal components of Salvia miltiorrhiza.
8. The application according to claim 7, characterized in that Apply the mycelium suspension of Trichoderma longibrachiatum or the microbial preparation to Salvia miltiorrhiza.
9. The application according to claim 7, characterized in that The medicinal components of Salvia miltiorrhiza include lipophilic tanshinone compounds.
Citation Information
Patent Citations
Trichiderma longibraciatum strain
CN101693879A
Endophytic fungus in salvia miltiorrhiza bunge and application thereof
CN102676392A
Endophytic fungi for improving salviae miltiorrhizae yield and content of effective components and application thereof
CN106801014A
Composite preparation for promoting growth of codonopsis pilosula and preparation method and application thereof
CN112352794A
Mucor circinelloides capable of promoting root development of salvia miltiorrhiza and tanshinone synthesis and application of mucor circinelloides
CN112574892A