Application of a long-branched Trichoderma strain for enhancing the fat-soluble medicinal components of Salvia miltiorrhiza and its freeze-dried powder

Abstract

The present invention discloses a long-branch Trichoderma strain and a freeze-dried powder thereof for enhancing the fat-soluble medicinal components of Salvia miltiorrhiza, and belongs to the field of microbial technology. The strain is named SBa-TL, and is deposited in the China Center for Type Culture Collection on April 18, 2025, with a deposit number of CCTCC NO: M 2025821. The present invention provides a long-branch Trichoderma strain and a long-branch Trichoderma freeze-dried powder that can enhance the fat-soluble medicinal components of Salvia miltiorrhiza. The strain and the freeze-dried powder prepared therefrom can effectively promote the growth of Salvia miltiorrhiza plants, increase the above-ground and underground biomass of Salvia miltiorrhiza plants, and significantly improve the content of medicinal components in Salvia miltiorrhiza, especially increase the content of tanshinone I, tanshinone IIA and cryptotanshinone. In the cultivation of improving the quality of Salvia miltiorrhiza, the strain has significant application value.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and in particular to a long-branch Trichoderma strain for enhancing the fat-soluble medicinal components of salvia miltiorrhiza and application of its freeze-dried powder. Background Art

[0002] Salvia miltiorrhiza, scientific name ( Salvia miltiorrhiza Bunge ), also known as red root and blood ginseng root, belongs to the genus Salvia of the family Lamiaceae. As a traditional Chinese medicinal material widely used in my country, Salvia miltiorrhiza is used as a medicinal material with its dried roots and rhizomes. Its pharmacological components have the effects of promoting blood circulation and removing blood stasis, relieving pain, promoting blood circulation, and clearing the heart and calming the mind. It is often used clinically to treat coronary heart disease, angina pectoris, peptic ulcer, cirrhosis and other diseases. The main active ingredients of Salvia miltiorrhiza include water-soluble phenolic acids and fat-soluble tanshinone compounds. These two compounds constitute the core of the pharmacological effects of Salvia miltiorrhiza. Tanshinone compounds mainly include tanshinone I, tanshinone IIA, cryptotanshinone and the like. In view of the scarcity of wild resources, the harsh cultivation environment and the demand for standardized medicinal materials in the modern Chinese medicinal materials industry, the Salvia miltiorrhiza currently on the market mainly relies on artificial cultivation.

[0003] However, due to its dispersed distribution, long resource renewal cycles, and inconsistent quality, Danshen (Salvia miltiorrhiza) faces significant quality challenges. Fluctuations in the content of tanshinones, in particular, are a major factor contributing to substandard Danshen (Salvia miltiorrhiza). Furthermore, the chemical synthesis of tanshinones is challenging, making large-scale production difficult. Therefore, improving the growth environment of Danshen (Salvia miltiorrhiza) and the accumulation of its medicinal components, particularly tanshinone compounds, has become a critical issue that urgently needs to be addressed. Summary of the Invention

[0004] In order to solve the above technical problems, the purpose of the present invention is to provide a long-branched Trichoderma strain and its freeze-dried powder for enhancing the fat-soluble medicinal components of Salvia miltiorrhiza, so as to solve the problem that the content of tanshinone components in existing Salvia miltiorrhiza fluctuates greatly and the quality of Salvia miltiorrhiza is unqualified due to the dispersion of distribution, long resource renewal cycle and inconsistency of quality.

[0005] The technical solution of the present invention to solve the above technical problems is as follows:

[0006] The first object of the present invention is to provide a method for enhancing the lipid-soluble medicinal components of Salvia miltiorrhiza. Trichoderma longibrachiatum ), the strain was named SBa-TL and deposited in China Center for Type Culture Collection on April 18, 2025, with the deposit number CCTCC NO: M 2025821.

[0007] The beneficial effects of the present invention are as follows: the present invention provides a long-branched Trichoderma that can increase the content of medicinal ingredients in Salvia miltiorrhiza. When the strain is applied to Salvia miltiorrhiza plants, the strain can promote a symbiotic relationship between the strain and the plant, significantly promote the growth of Salvia miltiorrhiza, increase the above-ground and underground biomass of Salvia miltiorrhiza plants, and significantly increase the content of effective ingredients of fat-soluble compounds in Salvia miltiorrhiza. Compared with the blank control group, the content of tanshinone I increased by 364%, and the content of cryptotanshinone increased by 359%.

[0008] The second object of the present invention is to provide a microbial preparation comprising the above-mentioned Trichoderma longibrachiatum.

[0009] Furthermore, the above-mentioned microbial preparation includes freeze-dried powder of Trichoderma longibrachiata.

[0010] The beneficial effect of adopting the above-mentioned further technical solution is that the present invention can significantly increase the content of tanshinones in the roots of Salvia miltiorrhiza by treating them with freeze-dried powder of Trichoderma longibrachiata. Specifically, the content of tanshinone I in the freeze-dried powder treatment group (0.15g) reached as high as 1.07 mg / g, a 110% increase compared to the control group; the content of cryptotanshinone in the freeze-dried powder treatment group (0.15g) reached 6.61 mg / g, a 123% increase compared to the control group; and the content of tanshinone IIA in the freeze-dried powder treatment group (0.15g) reached 0.60 mg / g, a 94% increase compared to the control group, significantly enhancing the pharmacological value of Salvia miltiorrhiza in the treatment of cardiovascular diseases.

[0011] Furthermore, the freeze-dried powder of Trichoderma longibrachiatum is prepared by the following method: first, Trichoderma longibrachiatum is inoculated into a solid culture medium, repeatedly subcultured, then the subcultured strain is inoculated into a liquid culture medium for expansion culture, and finally, the culture medium is filtered to collect wet mycelium, freeze-dried and ground to obtain the powder.

[0012] Furthermore, the passage was repeated 2-3 times, with each passage lasting 3-5 days.

[0013] Furthermore, the propagation culture time is 5-7 days, the temperature is 25-30°C, and the shaking frequency is 100-200 r / min.

[0014] The third object of the present invention is to provide the use of the above-mentioned Trichoderma longibrachiata or the above-mentioned microbial preparation in increasing the content of medicinal components of Salvia miltiorrhiza.

[0015] Furthermore, a suspension of Trichoderma longibrachiata mycelium or a microbial preparation is applied to Salvia miltiorrhiza.

[0016] Furthermore, the medicinal ingredients of Danshen include tanshinone compounds.

[0017] The present invention has the following beneficial effects:

[0018] (1) The present invention provides a long-branched Trichoderma that can increase the content of medicinal ingredients in Salvia miltiorrhiza. When the strain is applied to Salvia miltiorrhiza plants, the strain can promote a symbiotic relationship between the strain and the plant, significantly promote the growth of Salvia miltiorrhiza, increase the above-ground and underground biomass of Salvia miltiorrhiza plants, and significantly increase the content of active ingredients in Salvia miltiorrhiza, especially increase the content of tanshinone I, tanshinone IIA and cryptotanshinone, which has significant application value.

[0019] (2) The present invention provides a freeze-dried powder prepared by freeze-drying technology using Trichoderma longibrachiatum as a raw material. The freeze-dried powder can better exert the effect of Trichoderma longibrachiatum, greatly increase the content of tanshinone drugs in the root system of Salvia miltiorrhiza, and significantly enhance the pharmacological value of Salvia miltiorrhiza in the treatment of cardiovascular diseases. The freeze-dried powder can still maintain high activity when stored at room temperature for 6 months and has long-term storage stability. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a morphological diagram of Trichoderma longibrachiatum on PDA plate culture medium in Example 1;

[0021] Figure 2 This is a microscope image of Trichoderma longibrachiatum on a PDA plate medium in Example 1, where Hy represents hyphae and S represents spores;

[0022] Figure 3 This is a graph showing the growth of Salvia miltiorrhiza after the action of Trichoderma longibrachiatum on the plant for 60 days (the total growth period is 90 days) in Example 2, wherein a is the experimental group and b is the control group;

[0023] Figure 4 This is a graph showing the growth of plant morphological indicators of Salvia miltiorrhiza after the long-branched Trichoderma was treated on the plant for 60 days (total growth period is 90 days) in Example 2, where A is root length, B is surface area, C is root volume, D is plant height, and E is the number of leaves;

[0024] Figure 5 This is a plant biomass index graph after the long-branch Trichoderma was treated with Salvia miltiorrhiza for 60 days (total growth period is 90 days) in Example 2;

[0025] Figure 6 This is a graph showing the tanshinone content of Salvia miltiorrhiza after the long-branched Trichoderma was treated for 60 days (total growth period is 90 days) in Example 2, wherein A is tanshinone I, B is cryptotanshinone, and C is tanshinone IIA;

[0026] Figure 7 This is a graph showing the optimal moisture content and optimal particle size growth of the long-branch Trichoderma freeze-dried powder on PDA flat plate culture medium in Example 3, where a represents the optimal moisture content and b represents the optimal particle size;

[0027] Figure 8 This is the appearance of the freeze-dried powder of Trichoderma longibrachiatum obtained in step (4) of Example 3;

[0028] Figure 9 This is a graph showing the growth of Salvia miltiorrhiza after the freeze-dried powder of Trichoderma longibrachiatum in Example 4 was applied to the plant for 75 days (total growth period is 105 days), wherein a represents the experimental group and b represents the control group;

[0029] Figure 10 This is a graph showing the growth of plant morphological indicators after the long-branch Trichoderma freeze-dried powder was applied to Salvia miltiorrhiza for 75 days (total growth period is 105 days) in Example 4, where A is root length, B is surface area, C is root volume, and D is plant height;

[0030] Figure 11 This is a graph showing the biomass index of Salvia miltiorrhiza plants after the freeze-dried powder of Trichoderma longibrachiatum was applied to the plants for 75 days (total growth period is 105 days) in Example 4;

[0031] Figure 12 This is a graph showing the tanshinone content after the freeze-dried powder of Trichoderma longibrachiatum was applied to Salvia miltiorrhiza for 75 days (total growth period is 105 days) in Example 4, where A is tanshinone I, B is tanshinone IIA, and C is cryptotanshinone. DETAILED DESCRIPTION

[0032] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples are only used to explain the present invention and are not intended to limit the scope of the invention. In the embodiments, if specific conditions are not specified, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be purchased commercially.

[0033] Example 1: Isolation and Identification of Trichoderma longibrachiatum for Enhancement of Fat-Soluble Medicinal Components in Salvia miltiorrhiza

[0034] (1) Strain isolation

[0035] Take Hebei Anguo Scutellaria baicalensis ( Scutellaria baicalensis ) rhizosphere soil, using dilution coating method, 10 -4 The soil dilution was applied to a PDA medium supplemented with ampicillin and streptomycin sulfate. The plate was sealed and incubated in a constant temperature incubator at 27°C in the dark. Single colonies were transferred to a new PDA plate for further culture. Figure 1 The colonies shown were observed under a BX51 optical microscope at 400 times magnification and photographed to record the microscopic characteristics of the hyphae. Figure 2 shown.

[0036] (2) Identification of bacterial species

[0037] The DNA of the colony obtained in step (1) was extracted using a genomic DNA extraction kit (SolarBio). The colony DNA was then amplified using primers ITS3: 5'-TCCTCCGCTTATTGATATGC-3' (SEQ ID NO. 1) and ITS4: 5'-GGAAGTAAAAGTCGTAACAAGG-3' (SEQ ID NO. 2). The amplified product was sequenced, and the sequencing result is shown in SEQ ID NO. 3:

[0038] SEQ ID NO.3: TACCATCTGTTGCCTCGGCGGGATTCTCTTGCCCCGGGCGCGTCGCAGCCCCGGATCCCATGGCGCCCGCCGGAGGACCAACTCCAAACTCTTTTTTCTCTCCGTCGCGGCTCCCGTCGCGG CTCTGTTTTATTTTTGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT AATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGG GGATCGGCCCCTCACCGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGGCCACAGCCGTAAAACACCCCAAACTTC.

[0039] The NCBI BLAST tool was used to compare the sequences. The results showed that the strain was Trichoderma longibrachiata ( Trichoderma longibrachiatum ), named SBa-TL, and classified as Trichoderma longibrachiatum SBa-TL.

[0040] Example 2: Trichoderma longifolia promoted the growth of Salvia miltiorrhiza potted plants

[0041] (1) Preparation of inoculum

[0042] First take the long-branch Trichoderma obtained in Example 1 ( Trichoderma longibrachiatum) SBa-TL was inoculated into PDA solid medium and cultured at 25°C until the medium was covered with spores. Five pieces of 8 mm diameter bacterial cake were taken from the solid medium and inoculated into a 250 mL conical flask. 150 mL of PD liquid medium (potato dextrose medium, pH = 6.8) was added and cultured at 26°C and 150 r / min for 7 d. Finally, after the culture was completed, the mycelium was collected using a vacuum filtration pump, 2.0 g of wet mycelium was weighed and added to 200 mL of sterile water to mix well to prepare a bacterial solution with a concentration of 10 mg / mL, which was then stored at 4°C for later use.

[0043] (2) Seedling cultivation and inoculation of Trichoderma longifolia

[0044] Full, mold-free Salvia miltiorrhiza seeds were selected, washed three times with tap water, and then soaked in distilled water for 24 hours. The seeds were then placed in seedling trays lined with moistened filter paper and incubated in the dark at 25°C for 72 hours until germination. The cultivation medium consisted of a 2:1 volume ratio of farmland soil and fine river sand. Each pot (13.8 cm diameter, 7 cm bottom diameter, 12.4 cm height) was filled with 1300 g of medium and watered until completely saturated. Seedlings of uniform growth were transplanted into pots, with four plants per pot. The pots were cultured in an artificial climate chamber (12 h / day photoperiod, 27°C / 22°C day / night temperature, 60% relative humidity). After 30 days of incubation, each plant in the experimental group (Tl) was inoculated with 5 mL of mycelial suspension (corresponding to a mycelial application rate of 50 mg / plant), while the control group (ck) was treated with an equal amount of sterile water. Four replicates were set up for each group. Figure 3 shown.

[0045] (3) Determination of morphological indicators

[0046] Plants were harvested 60 hours after inoculation, and plant height and leaf number were measured at harvest. Using an electronic balance with a precision of 1 in 10,000, the plants were separated from the rhizome junction, and the fresh weights of the aboveground parts and roots were measured separately. After weighing, the roots were cleaned and fully expanded in a glass tank filled with clean water. Root images were acquired using an EPSON V800 scanner, and average root volume, root surface area, and total root length were calculated using the WinRHIZO image analysis system. Subsequently, the aboveground parts and roots were dried in an 80°C oven to constant weight, and the aboveground and root biomass were determined.

[0047] The results of plant morphological index determination are as follows Figure 4 As shown in the figure, the height of the Salvia miltiorrhiza plants treated in the control group was 3.56 cm, the number of leaves was 8, the total root length was 4.13 cm, and the root surface area was 87.55 cm. 2 The average root volume is 0.67 cm 3The plant height of the T1 experimental group was 3.78 cm, an increase of 6.2% compared with the control group; the number of leaves reached 10, an increase of 20.46%. Its total root length was 4.61 cm, an increase of 11.55%; the root surface area was 104.01 cm 2 , increased by 18.8%; the root volume was 0.81 cm 3 , up 22.07%.

[0048] The results of plant biomass index determination are as follows Figure 5 As shown, the aboveground biomass and underground biomass of Salvia miltiorrhiza in the control group were 0.29 g and 0.12 g, respectively, while the aboveground biomass and underground biomass of the Tl experimental group were 0.36 g and 0.47 g, respectively. Compared with the control group, the aboveground biomass of Salvia miltiorrhiza after treatment increased by about 23.17%, and the underground biomass increased significantly, increasing by 276%.

[0049] (4) Quantitative analysis of tanshinones

[0050] High performance liquid chromatography (HPLC) was used to analyze the content of tanshinone active ingredients, and the contents of tanshinone Ⅰ, tanshinone ⅡA and cryptotanshinone were quantitatively determined.

[0051] Take 0.25 g of dry root powder, add 25 mL of methanol and ultrasonically extract for 30 min, then filter with a 0.22 μm microporous filter membrane to obtain the HPLC injection sample solution.

[0052] HPLC conditions:

[0053] The chromatographic column was SymmeTly C18 (4.6×250 mm, 5 μm), the mobile phase A was acetonitrile, and the mobile phase B was a 0.05% mass fraction of phosphoric acid aqueous solution. The gradient elution program was shown in Table 1. The detection wavelength was 270 nm, the flow rate was 1.0 mL / min, the column temperature was 25°C, and the injection volume was 10 μL; the detection wavelength was 270 nm.

[0054] Table 1 Gradient elution program

[0055]

[0056] The experimental results are as follows Figure 6As shown, inoculation with Trichoderma longibrachiatum effectively increased the content of medicinal components in Salvia miltiorrhiza. In the control group, the contents of tanshinone I, tanshinone IIA, and cryptotanshinone in the roots of Salvia miltiorrhiza were 0.114 mg / g, 0.396 mg / g, and 1.141 mg / g, respectively. In the Tl experimental group, the contents of tanshinone I, tanshinone IIA, and cryptotanshinone in the roots of Salvia miltiorrhiza were 0.531 mg / g, 0.383 mg / g, and 5.229 mg / g, respectively. Tanshinone I and cryptotanshinone increased by 364% and 359% compared to the control group. This indicates that inoculation with Trichoderma longibrachiatum significantly increased the contents of tanshinone I and cryptotanshinone in the roots of Salvia miltiorrhiza plants, while the increase in tanshinone IIA was not significant.

[0057] Example 3: Preparation of Trichoderma longibrachiatum freeze-dried powder

[0058] (1) Under sterile conditions, the edge hyphae of the long-branched Trichoderma obtained in Example 1 were picked and inoculated into the center of a PDA plate. The plate was cultured in the dark at 28°C for 5 days and subcultured 2-3 times until the colony morphology was uniform. After the colony was grown, 5 8 mm × 8 mm cakes were prepared using a sterile punch and inoculated into a 250 mL conical flask (containing 150 mL of PD liquid medium). The plate was shaken and cultured at 27°C and 150 rpm for 7 days. A total of 21 bottles of culture solution were prepared. After completion, the long-branched Trichoderma liquid was obtained.

[0059] (2) Preparation of freeze-dried powder and optimization of water content

[0060] Step (1) The bacterial liquid was filtered through a vacuum pump to collect the mycelia. After the mycelia were collected, they were packaged into 5 g portions (wet weight). The wet mycelia were placed in a -20°C refrigerator for pre-freezing for 12 h. After pre-freezing, they were placed in a freeze dryer at -53°C and a vacuum of 10 Pa for drying.

[0061] The moisture content was set at 6 different gradients (0%, 0%-1%, 1%-2%, 2%-3%, 3%-4%, and 4%-5%), with 5 replicates in each group. Mycelia with different moisture contents were obtained by controlling the drying time.

[0062] Solid mycelium with varying moisture contents was inoculated onto PDA solid medium (9 mm × 9 mm Petri dishes) in a clean bench and incubated in the dark at 28°C in a constant-temperature incubator. Each Petri dish contained one identically sized bacterial plate. Five replicates were set for each moisture content range, with the day of inoculation designated as day 0. Colony diameters were measured on days 2 and 3 of inoculation using the cross-hatch method. Colony growth is shown in Table 2. A control group was replaced with fresh bacterial cakes of the same size, with five replicates.

[0063] Table 2 Colony growth of solid mycelium inoculated with different moisture contents

[0064]

[0065] Note: In Table 2, in the same column, the data marked with the same letters have no significant difference, and the data marked with different letters have significant difference.

[0066] The results showed that Trichoderma longifolia grew best at a moisture content of 3%-4%, especially on the third day. The control group (CK) outperformed all moisture groups on the second day, but on the third day, the 3%-4% moisture group outperformed the control group. In summary, Trichoderma longifolia grew best at a moisture content of 3%-4%. Figure 7 As shown in Figure a.

[0067] (3) Effect of powder particle size on freeze-dried powder bacterial agent

[0068] According to the method in step (2), solid mycelium of Trichoderma longifolia with a moisture content of 3%-4% was prepared. The obtained solid mycelium was ground and passed through sieves with apertures of 0.6 mm, 0.25 mm, 0.15 mm and 0.1 mm, respectively, to obtain freeze-dried powder inoculum with particle sizes greater than 0.6 mm, 0.25-0.6 mm, 0.15-0.25 mm, 0.1-0.15 mm and less than 0.1 mm, respectively. The dry powder inoculum of different particle sizes was inoculated into PDA culture medium and cultured in a constant temperature incubator at 28°C in the dark. Each culture dish contained one inoculum of different particle sizes. Five replicates were set for each inoculum, and the day of inoculation was recorded as inoculation day 0. The colony diameter was measured on the second day of inoculation using the cross-cross method. The colony growth is shown in Table 3. The control group was replaced with fresh mushroom cakes of the same size, with five replicates set.

[0069] Table 3 Colony growth of inoculated Trichoderma longibrachiata freeze-dried powder with different particle sizes

[0070]

[0071] Note: In Table 3, in the same column, the data marked with the same letters have no significant difference, and the data marked with different letters have significant difference.

[0072] According to the experimental results in Table 3, under different particle size conditions, the freeze-dried powder of Trichoderma longifolia larger than 0.600 mm showed the best growth state. Figure 7 As shown in Figure b.

[0073] (4) Storage of freeze-dried powdered bacterial agent

[0074] According to the method in step (3), a freeze-dried powder of Trichoderma longibrachiatum with a particle size greater than 600 mm and a moisture content of 3%-4% was prepared, such as Figure 8As shown, the prepared inoculum was stored in a ziplock bag at room temperature (25°C), 4°C and -20°C, respectively. The inoculum was then inoculated into PDA culture medium and cultured in a constant temperature incubator at 28°C in the dark. It was observed that the freeze-dried powder of Trichoderma longifolia could grow normally at the three storage temperatures for 6 months.

[0075] (5) Determination of pH value and spore count of freeze-dried powder inoculant

[0076] Weigh 15 g of the freeze-dried powdered inoculum sample of Trichoderma longibrachiatum obtained in step (4) and put it into a 50 mL beaker. Add deionized water into the beaker at a mass ratio of sample to deionized water = 1:2 and stir evenly. Then let it stand for 30 min. Use a PHBJ-260 portable pH meter to measure the pH value of the sample suspension. Record the reading after the instrument stabilizes. The measured pH value is 6.4.

[0077] The spore count of Trichoderma longifolia was determined by hemocytometer counting method, and the spore concentration of Trichoderma longifolia was 3.2×10 8 CFU / g.

[0078] Example 4: Experiment on promoting the growth of Salvia miltiorrhiza potted plants with freeze-dried Trichoderma longifolia powder

[0079] (1) Preparation of Trichoderma longifolia freeze-dried powder

[0080] The preparation method of the freeze-dried powder of Trichoderma longibrachiatum is the same as step (4) in Example 3.

[0081] (2) Seedling cultivation and inoculation of Trichoderma longifolia freeze-dried powder

[0082] Plump, mold-free Salvia miltiorrhiza seeds were selected, washed three times with tap water, and then soaked in distilled water for 24 hours. The seeds were then placed in seedling trays lined with moistened filter paper and incubated in the dark at 25°C for 72 hours until germination. The cultivation medium consisted of a 2:1 volume ratio of farmland soil and fine river sand. Each pot (15.7 cm diameter, 11.5 cm bottom diameter, 13 cm height) was filled with 1500 g of medium and watered until fully saturated. Seedlings of uniform growth were transplanted into pots, with four plants per pot. The pots were cultured in an artificial climate chamber (12 h / day photoperiod, 27°C / 22°C day / night temperature, and 60% relative humidity). After 30 days of cultivation, the freeze-dried powder of Trichoderma longibrachiatum was inoculated. The inoculation amount was set to 4 gradients, namely 0.045 g, 0.15 g, 0.3 g and 0.45 g. The freeze-dried powder was inoculated into the roots of individual seedlings by root irrigation method. The corresponding grams of the agent were mixed with 20 mL of water to obtain different concentrations of freeze-dried powder inoculation solution of Trichoderma longibrachiatum. Then 5 mL of freeze-dried powder inoculation solution of Trichoderma longibrachiatum of different concentrations were taken and inoculated into the roots of individual seedlings by root irrigation method. Four replicates were set up. In addition, 4 pots of single plants were inoculated with 5 mL of sterile water as blank control. After 75 days of cultivation, the seeds were harvested. Figure 9 shown.

[0083] (3) Determination of morphological indicators

[0084] The determination method is the same as in Example 2.

[0085] The total root length, surface area, root volume and plant height of the blank control group were 804.59 cm, 37.21 cm and 1.33 cm, respectively. 2 、1.37 cm 3 , 8.77 cm, and the total root length, surface area, root volume and plant height of Salvia miltiorrhiza in the treatment groups with different inoculation amounts of long-branch Trichoderma freeze-dried powder are shown in Tables 4 and Figure 10 shown.

[0086] Table 4 Results of morphological index determination of Salvia miltiorrhiza in groups treated with different inoculation amounts of Trichoderma longifolia freeze-dried powder

[0087]

[0088] The results showed that compared with the blank control group, the root length, surface area, root volume and plant height of the Salvia miltiorrhiza treated with the freeze-dried powder of Trichoderma longibrachiatum of the present invention were all improved.

[0089] like Figure 11 As shown in the results, treatment with freeze-dried powder of Trichoderma longibrachiatum significantly increased the biomass of Salvia miltiorrhiza plants. The aboveground and underground biomass of Salvia miltiorrhiza treated with the blank control group were 0.71 g and 0.41 g, respectively. The aboveground and underground biomass of Salvia miltiorrhiza treated with 0.045 g of freeze-dried powder of Trichoderma longibrachiatum were 1.01 g and 1.4 g, respectively, representing increases of 43% and 238% compared with the blank control. The aboveground and underground biomass of Salvia miltiorrhiza treated with 0.15 g of freeze-dried powder of Trichoderma longibrachiatum were 1.11 g and 1.388 g, respectively, representing increases of 57% and 236% compared with the blank control. The aboveground and underground biomass of Salvia miltiorrhiza treated with 0.3 g of freeze-dried powder of Trichoderma longibrachiatum were 1.13 g and 1.53 g, respectively, representing increases of 60% and 271% compared with the blank control. The aboveground and underground biomass of Salvia miltiorrhiza treated with 0.45 g of freeze-dried powder of Trichoderma longibrachiatum were 1.40 g and 1.42 g, respectively, representing increases of 98% and 244% compared with the blank control. From the above, we can see that when the inoculation amount of Trichoderma longibrachiatum freeze-dried powder was 0.45 g, the aboveground biomass of Salvia miltiorrhiza was optimal, increasing by 98%, and when the inoculation amount was 0.3 g, the underground biomass was the largest, increasing by 271%.

[0090] (4) Quantitative analysis of tanshinones

[0091] The determination method is the same as that in Example 2. The contents of tanshinone I, tanshinone IIA and cryptotanshinone in the roots of Salvia miltiorrhiza treated with the blank control group were 0.51 mg / g, 0.31 mg / g and 2.97 mg / g, respectively; the contents of tanshinone I, tanshinone IIA and cryptotanshinone in the roots of Salvia miltiorrhiza treated with different inoculation amounts of Trichoderma longifolia freeze-dried powder are shown in Tables 5 and Figure 12 shown.

[0092] Table 5 Quantitative analysis results of tanshinones in roots of Salvia miltiorrhiza treated with different inoculation amounts of freeze-dried Trichoderma longifolia powder

[0093]

[0094] The results showed that compared with the blank control group, different inoculation amounts of Trichoderma longibrachiatum freeze-dried powder treatments significantly increased the contents of medicinal components such as tanshinone I, tanshinone IIA and cryptotanshinone in the roots of Salvia miltiorrhiza plants, among which the effect was most significant when the inoculation amount was 0.15 g.

[0095] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for enhancing the fat-soluble medicinal components of Salvia miltiorrhiza ( Trichoderma longibrachiatum ), characterized in that The strain was named SBa-TL and deposited in the China Center for Type Culture Collection on April 18, 2025, with the deposit number CCTCC NO: M 2025821.

2. A microbial preparation, characterized in that: The invention comprises the long-branch Trichoderma according to claim 1.

3. The microbial preparation according to claim 2, characterized in that The invention comprises the freeze-dried powder of Trichoderma longibrachiata.

4. The microbial preparation according to claim 3, characterized in that The long-branch Trichoderma freeze-dried powder is prepared by the following method: first, the long-branch Trichoderma is inoculated into a solid culture medium, repeatedly subcultured, then the subcultured strain is inoculated into a liquid culture medium for expansion culture, and finally, the culture medium is filtered to collect wet mycelia, and the powder is freeze-dried and ground to obtain the powder.

5. The microbial preparation according to claim 4, characterized in that The number of repeated passages is 2-3 times, and the duration of each passage is 3-5 days.

6. The microbial preparation according to claim 4, characterized in that The propagation culture is carried out for 5-7 days at a temperature of 25-30° C. and an oscillation frequency of 100-200 r / min.

7. Use of the longibrachiatum according to claim 1 or the microbial preparation according to any one of claims 2 to 6 in increasing the content of medicinal components of Salvia miltiorrhiza, characterized in that: Apply Trichoderma longibrachiata mycelium suspension or microbial preparation to Salvia miltiorrhiza.

8. The use according to claim 7, characterized in that The medicinal components of Danshen include fat-soluble tanshinone compounds.

Images