Bacillus cereus with idebenone production capacity and high oxidation resistance
By screening and identifying Bacillus Oceanobacillus sp.Y-3, the problem of the lack of efficient free radical scavenging and environmentally friendly idebenone production in the prior art is solved, and the ability to efficiently eliminate free radicals and idebenone production is achieved, which is suitable for product development in multiple fields.
Patent Information
- Application Number
- CN202411841499.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-13
- Publication Date
- 2025-07-11
- Estimated Expiration
- 2044-12-13
AI Technical Summary
The prior art lacks microbial strains that efficiently eliminate free radicals, especially strains that have the ability to produce idebenone, and traditional antioxidants have high costs and environmental pollution risks.
Bacillus Oceanobacillus sp.Y-3 was screened and identified. This strain has the ability to efficiently eliminate DPPH radicals, ABTS cation radicals, and hydroxyl radicals, and can produce idebenone, which is suitable for the preparation of microbial agents and product compositions.
Bacillus perinatal CCTCC NO: M 20242434 shows high free radical scavenging ability and iron ion reduction ability, has high antioxidant activity, is suitable for drugs, health products, cosmetics and other fields, and provides environmentally friendly idebenone production methods.
Smart Images

Figure CN120290355A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a Bacillus oceanisediminis strain with the ability to produce idebenone and high antioxidant ability, belonging to the field of microbial strains. Background Art
[0002] Free radicals, as atoms or molecular groups with unpaired electrons generated during the body's metabolic process, play an important role in signal transduction under physiological conditions. However, when free radicals accumulate excessively in the body, they will attack cell structures, leading to a series of oxidative stress reactions such as DNA damage, lipid peroxidation, and protein denaturation, and then triggering various diseases. Therefore, finding effective methods to scavenge free radicals in the body is of great significance for maintaining human health.
[0003] Currently, the scavenging of free radicals is mainly achieved through two ways: one is through the antioxidant enzyme system naturally present in the body, such as superoxide dismutase (SOD), etc.; the other is through exogenous intake of substances with antioxidant activity, such as vitamins, minerals, and certain natural products. However, with the increase in age and physical differences, the activity of antioxidant enzymes in the body will gradually decrease, and there are also certain limitations in the absorption and utilization efficiency of traditional antioxidants. Therefore, the development of new and efficient free radical scavengers has become a current research hotspot.
[0004] Idebenone, as a highly efficient antioxidant, the benzoquinone group in its structure can efficiently capture and scavenge free radicals, thereby protecting cells from oxidative stress damage. In the biomedical field, idebenone has been widely used in the treatment of neurological diseases, cardiovascular diseases, and improving skin health, etc.; in cosmetics and skin care products, idebenone also plays roles in scavenging free radicals, inhibiting lipid peroxidation, inhibiting inflammation, inhibiting DNA damage, etc., and can significantly improve the skin condition. However, chemically synthesized idebenone not only has a high cost but also may cause environmental pollution. Therefore, finding a sustainable and environmentally friendly production method of idebenone is particularly important.
[0005] In the field of microorganisms, probiotics such as lactic acid bacteria and bifidobacteria have been widely used in food fermentation, healthcare, and other fields due to their good biological activity and safety. In recent years, studies have shown that some lactic acid bacteria and bifidobacteria strains have strong antioxidant ability and can scavenge free radicals in the body to protect cells from oxidative damage. However, although a variety of probiotics have been proven to have antioxidant activity, the free radical scavenging ability varies significantly among different strains, and relatively few strains can efficiently scavenge multiple free radicals, and no prior art on microbial production of idebenone has been disclosed or reported. Therefore, screening and isolating strains with higher free radical scavenging ability and the ability to produce idebenone is of great significance for the development of new functional products that can be used in multiple fields such as food, health products, and cosmetics. Summary of the Invention
[0006] To solve the above problems, a strain of Oceanobacillus sp. Y-3 was screened from the black mud of Yuncheng Salt Lake in Shanxi. This strain has the ability to efficiently scavenge free radicals, antioxidant ability, and the ability to produce idebenone. Through physiological and biochemical analysis and phenotypic characteristic analysis, etc., a comprehensive identification of this strain was carried out, aiming to lay a certain foundation for the development of new and efficient free radical scavengers from the perspective of microorganisms, and provide new ideas and strain resources for the development in the fields of drugs, cosmetics, and health products.
[0007] The first object of the present invention is to provide a strain of Oceanobacillus sp. Y-3 with the ability to produce idebenone and high antioxidant ability, taxonomically named Oceanobacillus sp. Y-3, which was deposited at the China Center for Type Culture Collection on November 05, 2024, with the deposit number CCTCC NO: M 20242434.
[0008] The new Oceanobacillus sp. Y-3 with the ability to produce idebenone and high antioxidant ability of the present invention, CCTCC NO: M20242434, has the following characteristics:
[0009] (1) Colony characteristics: The colony appears as an orange-red round colony, opaque, with a raised middle, and the colony edge is neat, and the size and shape are stable;
[0010] (2) Morphological characteristics: Gram-positive bacteria, without flagella, the bacterial cells are short rod-shaped, with a length range of 1.5 - 1.8 μm and a width range of 0.3 - 0.4 μm;
[0011] (3) Growth characteristics: It can tolerate a salinity of 0 - 5%; the optimum growth temperature is 30 °C; the growth pH range is 6.5 - 9.0, and the optimum growth pH range is 7.0 - 7.2; it can use various sugars such as starch, glucose, sucrose, and maltose as the sole carbon source for growth;
[0012] (4) Physiological and biochemical characteristics: Catalase positive, starch hydrolysis positive, cellulose decomposition positive, glucose oxidation fermentation positive, protease negative, esterase positive, indole positive; it belongs to facultative anaerobes and grows well under both aerobic and anaerobic conditions;
[0013] (5) Antioxidant characteristics:
[0014] a. It can effectively scavenge DPPH free radicals, ABTS cation free radicals, and hydroxyl free radicals, and has strong antioxidant ability: when the concentration of the cell lysate of Bacillus oceanisediminis CCTCC NO: M 20242434 is higher than 12 mg / mL, the scavenging rate of DPPH free radicals reaches more than 90%; when the concentration of the cell lysate of Bacillus oceanisediminis CCTCC NO: M 20242434 is higher than 10 mg / mL, the scavenging rate of ABTS cation free radicals reaches more than 90%; preferably, when the concentration of the cell lysate is 20 mg / mL, the scavenging rate of ABTS cation free radicals reaches more than 99%; the scavenging rate of hydroxyl free radicals by the intracellular extract of absolute ethanol with a concentration of 10 mg / ml reaches 72.23%.
[0015] b. It has strong ferric ion reducing ability. When the concentration of the cell lysate of Bacillus oceanisediminis CCTCC NO: M 20242434 is 16 mg / mL, the FRAP value is 4.28 mmol / L.
[0016] (6) It has the ability to produce idebenone.
[0017] The second object of the present invention is to provide a microbial inoculant containing Bacillus oceanisediminis CCTCC NO: M 20242434 of the present invention.
[0018] In one embodiment of the present invention, the microbial inoculant uses Bacillus oceanisediminis CCTCC NO: M 20242434 as the main microorganism.
[0019] In one embodiment of the present invention, the viable cell count of CCTCC NO: M 20242434 in the inoculant is 10 7 ~10 9 CFU / mL.
[0020] In one embodiment of the present invention, the bacterial concentration range of CCTCC NO: M 20242434 in the inoculant is 10 7 ~10 9 CFU / mL.
[0021] In one embodiment of the present invention, the inoculant is prepared by preparing a seed liquid of CCTCC NO: M 20242434 and then performing subculture.
[0022] In one embodiment of the present invention, the bacterial agent contains viable cells of the strain CCTCC NO: M 20242434 of the present invention, dried cells of the strain CCTCC NO: M 20242434 of the present invention obtained by freeze-drying, immobilized cells of the strain CCTCC NO: M 20242434 of the present invention, liquid bacterial agent of the strain CCTCC NO: M 20242434 of the present invention, solid bacterial agent of the strain CCTCC NO: M 20242434 of the present invention, or the strain CCTCC NO: M 20242434 of the present invention in any other form.
[0023] In one embodiment of the present invention, the bacterial agent further contains other excipients.
[0024] In one embodiment of the present invention, the bacterial agent is a microbial preparation with high efficiency in scavenging DPPH·, ·OH, ABTS + · free radicals, having relatively high reducing power, and having strong antioxidant ability.
[0025] The third object of the present invention is to provide a product composition with antioxidant efficacy. The preparation method of the product composition includes: adding the cell substance and / or metabolite of Bacillus oceanisediminis CCTCC NO: M 20242434 to a product matrix to obtain the product composition.
[0026] In one embodiment of the present invention, the antioxidant efficacy is the ability to scavenge free radicals or the ability to reduce iron ions;
[0027] In one embodiment of the present invention, the free radicals are at least one of DPPH·, ·OH, ABTS + ·.
[0028] The fourth object of the present invention is to provide the application of Bacillus oceanisediminis CCTCC NO: M 20242434, the above-mentioned bacterial agent containing the Bacillus oceanisediminis CCTCC NO: M 20242434, or the above-mentioned product composition in the preparation of a product with the ability to scavenge free radicals or antioxidant function.
[0029] In one embodiment, the product includes but is not limited to drugs, health products, cosmetics or functional foods.
[0030] In one embodiment, the drug further contains pharmaceutically acceptable excipients, and the excipients include but are not limited to at least one of diluents, excipients, fillers, binders, wetting agents, disintegrants, emulsifiers, cosolvents, solubilizers, osmotic pressure regulators, surfactants, coating materials, colorants, pH regulators, antioxidants, bacteriostatic agents or buffers.
[0031] In one embodiment, the drug further contains other drug components with antioxidant ability.
[0032] In one embodiment, the drug includes, but is not limited to, injections, oral liquids, tablets, capsules, dripping pills, and sprays.
[0033] In one embodiment, the administration methods include, but are not limited to, subcutaneous injection, intravenous injection, oral administration, topical application, respiratory inhalation, topical medication, and sublingual administration.
[0034] In one embodiment, the dosage form of the cosmetic can be formulated in the form of solutions, topical ointments, cream foams, nutritive emollients, soft emollients, fillers, soft water, milky lotions, cosmetic bases, perfumes, soaps, liquid detergents, bath agents, sunscreen creams, sunscreen oils, suspensions, emulsions, pastes, gels, lotions, powders, soaps, surfactant-containing detergents, oils, foundations, emulsion foundations, wax foundations, patches, and sprays.
[0035] In one embodiment, the cosmetic further contains at least one cosmetically acceptable carrier.
[0036] In one embodiment, the carrier can be oil, water, surfactant, humectant, lower alcohol, thickening agent, chelating agent, pigment, preservative, or perfume.
[0037] The fifth object of the present invention is to provide a method for producing idebenone, which uses Bacillus oceanisediminis CCTCC NO: M 20242434 or a bacterial agent containing Bacillus oceanisediminis CCTCC NO: M 20242434 to produce idebenone.
[0038] The sixth object of the present invention is to provide a cosmetic, which contains the cell lysate of Bacillus oceanisediminis CCTCC NO: M 20242434 or the above product composition.
[0039] In one embodiment, the cosmetic is a skin care product.
[0040] In one embodiment, the dosage form of the cosmetic can be formulated in the form of solutions, topical ointments, cream foams, nutritive emollients, soft emollients, fillers, soft water, milky lotions, cosmetic bases, perfumes, soaps, liquid detergents, bath agents, sunscreen creams, sunscreen oils, suspensions, emulsions, pastes, gels, lotions, powders, soaps, surfactant-containing detergents, oils, foundations, emulsion foundations, wax foundations, patches, and sprays.
[0041] In one embodiment, the cosmetic further contains at least one cosmetically acceptable carrier.
[0042] In one embodiment, the carrier can be oil, water, surfactant, humectant, lower alcohol, thickener, chelating agent, pigment, preservative, fragrance.
[0043] Biomaterial preservation:
[0044] Oceanobacillus sp. Y-3, taxonomically named Oceanobacillus sp. Y-3, the strain was deposited at the China Center for Type Culture Collection on November 05, 2024, with the deposit number CCTCC NO: M 20242434, and the deposit address is Wuhan University, Wuhan, China.
[0045] Beneficial effects:
[0046] The Oceanobacillus sp. CCTCC NO: M 20242434 strain of the present invention has a high free radical scavenging ability and can efficiently scavenge DPPH free radicals, ABTS cation free radicals, and hydroxyl free radicals: the scavenging rate of the intracellular ethanol extract of Oceanobacillus sp. CCTCC NO: M 20242434 with a concentration of 24 mg / ml for DPPH free radicals reaches 92.81%; the scavenging rate of the intracellular ethanol extract with a concentration of 20 mg / ml for ABTS cation free radicals reaches 99.81%; the scavenging rate of the intracellular ethanol extract with a concentration of 10 mg / ml for hydroxyl free radicals reaches 72.23%;
[0047] The Oceanobacillus sp. CCTCC NO: M 20242434 strain of the present invention has a strong ferric ion reducing ability. When the concentration of the cell lysate of CCTCC NO: M 20242434 is 16 mg / mL, the FRAP value is 4.28 mmol / L;
[0048] The Oceanobacillus sp. CCTCC NO: M 20242434 strain of the present invention also has the ability to produce idebenone.
[0049] Therefore, Oceanobacillus sp. CCTCC NO: M 20242434 has a high free radical scavenging ability and total reducing power, showing high antioxidant activity; the Oceanobacillus sp. CCTCC NO: M 20242434 of the present invention also has the ability to produce idebenone and has great application potential in the fields of health products and cosmetics. Description of the drawings
[0050] Figure 1 It is a colony morphology diagram of Oceanobacillus sp. Y-3;
[0051] Figure 2It is the morphological diagram of the cells of Oceanobacillus sp. Y-3;
[0052] Figure 3 It is the growth situation diagram of Oceanobacillus sp. Y-3 at different temperatures;
[0053] Figure 4 It is the growth situation diagram of Oceanobacillus sp. Y-3 at different salinities;
[0054] Figure 5 It is the growth situation diagram of Oceanobacillus sp. Y-3 under different carbon sources;
[0055] Figure 6 It is the total ion current chromatogram of idebenone reference sample;
[0056] Figure 7 It is the first-order mass spectrum and second-order mass spectrum of idebenone reference sample;
[0057] Figure 8 It is the total ion current chromatogram of the sample solution;
[0058] Figure 9 It is the first-order mass spectrum and second-order mass spectrum of the substance eluting at 4.62 min in the sample solution. Detailed implementation manners
[0059] The present invention is not limited to the embodiments described. The embodiments are only illustrative of the present invention and do not limit the protection scope of the present invention. Without departing from the spirit and essence of the present invention, any modification or substitution made to the methods, steps or conditions of the present invention shall fall within the scope of the present invention.
[0060] In the following embodiments, unless otherwise specifically stated, the solutions mentioned are all using water as the solvent.
[0061] The crude salt involved below is the large salt from Yuncheng Salt Pond, which is sourced from Yuncheng Salt Lake.
[0062] The medium formulations in the following embodiments are as follows:
[0063] 1. Crude salt liquid medium: 50 g of crude salt, 20 g of MgSO4·7H2O, 2.0 g of KCl, 3.0 g of sodium citrate, 0.2 g of anhydrous calcium chloride, 2.0 g of yeast extract, 10.0 g of peptone, add distilled water to make up to 1 L, and adjust the pH to 7.0 - 7.2.
[0064] 2. Crude salt solid medium: 50 g of crude salt, 20 g of MgSO4·7H2O, 2.0 g of KCl, 3.0 g of sodium citrate, 0.2 g of anhydrous calcium chloride, 2.0 g of yeast extract, 10.0 g of peptone. Add distilled water to make up to 1 L, adjust the pH to 7.0 - 7.2, and add 15.0 g of agar. Sterilize at 1×105 Pa and 121 °C for 30 min. After cooling the medium to 50 - 60 °C, pour it into petri dishes, about 15 - 20 mL of the medium for each petri dish. After cooling and solidifying, store for later use.
[0065] Example 1: Morphological observation of strain Y-3
[0066] 1. Source of the strain
[0067] The strain was isolated from the black mud of Yuncheng Salt Lake in Shanxi. The specific isolation method is as follows:
[0068] Add the black mud into the crude salt medium in a laminar flow hood, with the addition amount being 5% of the medium. Shake well, and place it in a shaker incubator at 30 °C for induced culture for 48 h, then transfer it to an incubator at 30 °C. When the supernatant becomes turbid, dilute the bacterial liquid with sterile water to 10 -1 、10 -2 、10 -3 、10 -4 、10 -5 、10 -6 and other concentrations. Take 100 μL of the diluted solutions with different concentrations and spread them evenly on the crude salt solid medium with a disposable spreading rod. After standing until the diluted solution dries, place it in an inverted position in a constant temperature incubator at 30 °C for culture. After obvious colonies grow on the medium, transfer different colonies for culture. Pick the strains with typical characteristics such as orange-red round edges, neat edges, and shiny surfaces, and streak-culture and isolate them one by one on the crude salt solid medium plate to obtain the orange-red Y-3 bacteria, which are the strains involved in the present invention. The purified strains are stored in 20% glycerol and stored in a -80 °C refrigerator for later use.
[0069] 2. Culture characteristics and morphological characteristics
[0070] Streak the isolated strain Y-3 on the crude salt solid medium and culture it at 30 °C. Its colony morphology is as Figure 1 shown. The colonies are orange-red circular colonies, opaque, protruding in the middle, and the colony edges are neat and the size and morphology are stable. Perform Gram staining on the smear of this bacterium, and its cell morphology is as Figure 2 shown. This bacterium is Gram-positive, without flagella, and is short rod-shaped, with a length range of 1.5 - 1.8 μm and a width range of 0.3 - 0.4 μm.
[0071] 3. Growth characteristics of Oceanobacillus sp. Y-3
[0072] The growth temperature range of strain Y-3 is 30-37 °C( Figure 3 ), it can tolerate a salinity of 0-5%( Figure 4 ), the growth pH range is 6.5-9.0, and the optimal growth pH range is 7.0-7.2; it belongs to facultative anaerobes and grows well under both anaerobic and aerobic conditions; it can use various sugars such as starch, glucose, sucrose, and maltose as the sole carbon source for growth( Figure 5 ).
[0073] Example 2: 16S rRNA classification identification and physiological and biochemical characteristics of strain Y-3
[0074] The strain Y-3 in Example 1 was identified by molecular biology. Its 16S rRNA gene was amplified by PCR and sequenced after passing the electrophoresis detection. Among them, the primers used in PCR are as follows: The primer sequence of 27F (SEQ ID NO.1) (5'-3'): AGAGTTTGATCCTGGCTCAG and the primer sequence of 1492R (SEQ ID NO.2) (5'-3'): GGTTACCTTGTTACGACTT.
[0075] The sequencing results showed that the sequence was as shown in SEQ ID NO.3. The sequence was subjected to Blast sequence alignment analysis on the NCBI database, and finally it was determined that strain Y-3 was Oceanobacillus sp., and the homology score was 99.73%.
[0076] Oceanobacillus sp. Y-3 of the present invention was deposited at the China Center for Type Culture Collection on November 05, 2024, and the deposit number is CCTCC NO: M 20242434.
[0077] The sequence of the 16s rDNA of Oceanobacillus sp. Y-3 is as follows (SEQ ID NO.3):
[0078]
[0079] Referring to the "Manual for the Systematic Identification of Common Bacteria", the physiological and biochemical characteristics of Oceanobacillus sp. Y-3 were detected. The results showed that Oceanobacillus sp. Y-3 was positive for catalase, positive for starch hydrolysis, positive for cellulose decomposition, positive for glucose oxidation fermentation, negative for protease, positive for esterase, and positive for indole.
[0080] Example 3: Preparation of the cell lysate of Oceanobacillus sp. Y-3
[0081] Fresh culture medium: 20 g of crude salt, 20 g of MgSO4·7H2O, 2.0 g of KCl, 3.0 g of sodium citrate, 0.2 g of anhydrous calcium chloride, 2.0 g of yeast extract, 10.0 g of peptone. Add distilled water to make up to 1 L and adjust the pH to 7.2.
[0082] (1) Sampling from the cryopreservation tube of the obtained Oceanobacillus sp. Y-3 strain, inoculating it into the crude salt liquid medium, and culturing it in a shaking incubator at 30°C for 3 d. When the culture medium becomes a turbid and opaque red liquid, pick single colonies and continue to inoculate them on the crude salt solid medium plate for 4 d to activate the strain. Pick single colonies and inoculate them into a conical flask containing 100 mL of crude salt liquid medium, and culture them in a shaking incubator at 30°C for 3 d to detect OD 600 until it reaches 0.5, which can be used as the crude salt seed liquid. Add the cultured crude salt seed liquid to a sterile conical flask containing 300 mL of the above fresh culture medium at a ratio of 10% by volume, and culture it in a shaking incubator at 30°C for more than 4 d until OD 600 reaches 0.4 - 0.5 to obtain the cultured fermentation broth.
[0083] (2) For the fermentation broth obtained in step (1) (with OD 600 being 0.4 for subsequent detection), centrifuge it at 4°C and 8000 rpm for 10 min, remove the supernatant, wash the cell precipitate with PBS, centrifuge again to remove the liquid phase, wash it twice with PBS, and then resuspend the cell precipitate with 1% anhydrous ethanol of the volume of the liquid culture medium to obtain the cell liquid. Break the cell wall of the cell liquid in an ultrasonic crusher for 3 cycles, centrifuge and collect the supernatant to obtain the ethanol extract of the cell lysate.
[0084] (3) Combine the obtained ethanol extracts of the cell lysate, concentrate it under reduced pressure, and dry it to obtain the cell lysate of Oceanobacillus sp. Y-3, which is placed in a -80°C refrigerator for standby.
[0085] Example 4: Determination of Antioxidant Activity of Oceanobacillus sp. Y-3 Bacterial Cell Lysate
[0086] 1. Determination of DPPH Radical (DPPH·) Scavenging Ability
[0087] First, prepare ethanol solutions of Oceanobacillus sp. Y-3 bacterial cell lysate with mass concentrations of 24, 12, 6.0, 3.0, 1.5, 0.75, 0.38, and 0.19 mg / mL using absolute ethanol from the Oceanobacillus sp. Y-3 bacterial cell lysate obtained in Example 3; then, prepare a 2,2-diphenyl-1-picrylhydrazyl (DPPH) solution with a concentration of 0.3 mmol / L using absolute ethanol. Pipette 100 μL of the bacterial cell lysate ethanol solution into a 96-well plate, then add 100 μL of the DPPH-ethanol solution, mix well and react in the dark for 30 min, and then measure the absorbance A of the mixture at 517 nm 样品 .
[0088] In the control group, an equal volume of absolute ethanol is used to replace the sample solution (the sample solution refers to the above-mentioned bacterial cell lysate ethanol solution), and in the blank group, an equal volume of absolute ethanol is used to replace the DPPH solution. The specific steps are the same as above, and the absorbances A 对照 and Ablank are measured at 517 nm respectively
[0089] Each test group needs to be repeated 3 times, and the results are averaged to calculate the DPPH radical scavenging rate
[0090] Use ascorbic acid solutions with concentrations of 0.08, 0.04, 0.02, and 0.01 mg / mL as positive controls. The specific steps are the same as above. In the control group, an equal volume of ultrapure water is used to replace the ascorbic acid solution, and in the blank group, an equal volume of ultrapure water is used to replace the DPPH solution, to obtain A 样品 、A 对照 and A 空白 , and calculate their DPPH radical scavenging rates
[0091] The calculation formula for the DPPH radical scavenging rate is as follows, and the obtained results are shown in Table 1
[0092] DPPH radical scavenging rate / % = [1 - (A 样品 - A 空白 ) / A 对照 )] × 100%
[0093] Table 1 DPPH Radical Scavenging Effect of Oceanobacillus sp. Y-3 Bacterial Cell Lysate
[0094]
[0095] 2. Determination of the scavenging ability of ABTS cation radical (ABTS + ·)
[0096] Weigh 6.6 mg of potassium persulfate and dissolve it in 10 mL of distilled water to obtain a potassium persulfate solution with a concentration of 2.45 mmol / L; weigh 7.7 mg of ABTS and dissolve it in 2 mL of the potassium persulfate solution. After reacting in the dark for 16 h, dilute it to obtain a working solution of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) with an absorbance of 0.7 at 734 nm.
[0097] First, prepare ethanol solutions of Oceanobacillus sp. Y-3 cell lysate with concentrations of 20 mg / mL, 10 mg / mL, 5.0 mg / mL, 2.5 mg / mL, 1.25 mg / mL, 0.63 mg / mL, and 0.31 mg / mL using anhydrous ethanol for the cell lysate obtained in Example 3. Transfer 10 μL of ethanol solutions of cell lysate with different concentrations into a 96-well plate respectively, then add 190 μL of ABTS working solution, and measure the absorbance A at 734 nm after reacting in the dark for 15 min 样品 .
[0098] In the control group, an equal volume of anhydrous ethanol is used to replace the sample solution (the sample solution refers to the above-mentioned ethanol solution of cell lysate), and in the blank group, anhydrous ethanol is used to replace the ABTS working solution. The specific steps are the same as above, and the absorbances A 对照 and A 空白 are measured at 734 nm respectively.
[0099] Each experimental group needs to be repeated 3 times, and the results are averaged to calculate the scavenging rate of ABTS cation radical.
[0100] Using ascorbic acid solutions with concentrations of 4.0, 2.0, 0.80, 0.12, 0.10, 0.08, 0.05, and 0.025 mg / mL as positive controls, the specific steps are the same as above. In the control group, an equal volume of ultrapure water is used to replace the ascorbic acid solution, and in the blank group, an equal volume of ultrapure water is used to replace the DPPH solution, to obtain A 样品 , A 对照 and A 空白 , and calculate the scavenging rate of ABTS cation radical.
[0101] The calculation formula for the scavenging rate of ABTS cation radical is as follows, and the obtained results are shown in Table 2.
[0102] Scavenging rate of ABTS cation radical / % = [1 - (A 样品 - A 空白 ) / A 对照 )] × 100%
[0103] Table 2 ABTS cation radical scavenging effect of the cell lysate of Oceanobacillus sp. Y-3
[0104]
[0105] 3. Determination of the scavenging ability of hydroxyl radicals (·OH)
[0106] The cell lysate of Oceanobacillus sp. Y-3 obtained in Example 3 was used to prepare ethanol solutions of Oceanobacillus sp. Y-3 cell lysate at concentrations of 0.63 mg / mL, 1.25 mg / mL, 2.5 mg / mL, 5.0 mg / mL, and 10 mg / mL with absolute ethanol. Take 50 μL of each solution at the above concentration gradients, add 50 μL of 9 mmol / L H2O2 solution, 9 mmol / L FeSO4 solution, and 9 mmol / L salicylic acid-absolute ethanol solution respectively, vortex evenly, and water bath at 37 °C for 35 min. Measure the absorbance at 510 nm and record it as A 样品 .
[0107] Use distilled water to replace the sample solution (the sample solution refers to the above-mentioned ethanol solution of the cell lysate), and the specific steps are the same as above, and record it as A 空白 ; Replace the H2O2 solution with distilled water, and the specific steps are the same as above, and record it as A 对照 , and calculate the hydroxyl radical scavenging rate.
[0108] Use ascorbic acid solutions with concentrations of 0.84, 0.42, 0.21, 0.10, and 0.05 mg / mL as positive controls, and the specific steps are the same as above. In the control group, the H2O2 solution is replaced with an equal volume of ultrapure water, and in the blank group, the ascorbic acid solution is replaced with an equal volume of ultrapure water to obtain A 样品 、A 对照 and A 空白 , and calculate the hydroxyl radical scavenging rate.
[0109] Each group of experiments was performed in parallel 3 times and the average value was taken. The calculation formula for the hydroxyl radical scavenging rate is as follows, and the results are shown in Table 3.
[0110] Hydroxyl radical scavenging rate / % = [A 空白 -(A 样品 -A 对照 )] / A 空白 ×100%
[0111] Table 3 Hydroxyl radical scavenging effect of the cell lysate of Oceanobacillus sp. Y-3
[0112]
[0113] As can be seen from Tables 1, 2 and 3, the ethanol solution of the cell lysate of Oceanobacillus sp. Y-3 has a high scavenging effect on DPPH free radicals, ABTS cation free radicals and hydroxyl free radicals.
[0114] 4. Determination of Ferric Ion Reducing Ability (FRAP)
[0115] Take 25 mL of acetate buffer (pH = 3.6), 2.5 mL of 10 mmol / L 2,4,6-tripyridyltriazine (TPTZ) solution, and 2.5 mL of 20 mmol / L ferric chloride solution and mix them to prepare the TPTZ working solution.
[0116] The cell lysate of Oceanobacillus sp. Y-3 obtained in Example 3 was used to prepare ethanol solutions of the cell lysate of Oceanobacillus sp. Y-3 at concentrations of 16 mg / mL, 8.0 mg / mL, 4.0 mg / mL, 3.0 mg / mL, 2.0 mg / mL, 1.0 mg / mL, 0.50 mg / mL and 0.25 mg / mL with absolute ethanol. In a 96-well plate, add 10 μL of the above-mentioned ethanol solutions of the cell lysate at different concentrations and 190 μL of the TPTZ working solution in sequence. Shake with a microplate reader for 10 s, incubate at 37 °C for 10 min, and measure the absorbance at a wavelength of 593 nm, which is A 样品 。
[0117] In the control group, acetate buffer was used instead of the TPTZ working solution, and in the blank group, absolute ethanol was used instead of the sample solution (the sample solution refers to the above-mentioned ethanol solution of the cell lysate). The specific steps are the same as above, and the absorbances A 对照 and A 空白 。
[0118] Each test group needs to be repeated 3 times, and the results are averaged.
[0119] Prepare a standard solution of ferrous sulfate with a concentration in the range of 0.1 - 1 mmol / L, and measure its absorbance under the same conditions. Using the ferrous sulfate concentration as the abscissa and the absorbance as the ordinate, draw a standard curve, and the regression equation is: y = 0.675x + 0.019 (R 2 = 0.999). Calculate the ferric ion reducing ability of the sample according to the regression equation, expressed in terms of the equivalent concentration of ferrous ions (FRAP value), with the unit of mmol / L.
[0120] y = A 样品 -A 对照 -A 空白 , substitute it into the equation to obtain the x value, which is the FRAP value.
[0121] Ascorbic acid solutions with concentrations of 11, 5.5, 1.38, 0.69, 0.34, 0.02, and 0.01 mg / mL were used as positive controls. The specific steps were the same as above. The control group used acetate buffer instead of TPTZ working solution, and the blank group used an equal volume of ultrapure water instead of ascorbic acid solution to obtain A 样品 , A 对照 and A 空白 , calculate its FRAP value.
[0122] The results are shown in Table 4.
[0123] As shown in Table 4, when the concentration of the ethanol solution of Oceanobacillus sp. bacterial lysate was 16 mg / mL, its FRAP value was 4.28 mmol / L, which was close to the highest FRAP value of vitamin C (4.68 mmol / L), proving that the Oceanobacillus sp. bacterial lysate had a high reducing ability.
[0124] Table 4 Iron ion reducing capacity of Oceanobacillus sp.Y-3 bacterial lysate
[0125]
[0126] Example 5: Qualitative analysis of the ability of Oceanobacillus sp. Y-3 to produce idebenone
[0127] Ultra-high performance liquid chromatography tandem quadrupole time-of-flight mass spectrometry (UPLC-Q-TOF / MS) was used to qualitatively and quantitatively analyze idebenone in Oceanobacillus sp. Y-3 bacterial lysate:
[0128] Liquid chromatography conditions: The chromatographic column was ACQUITY UPLC BEH C 18 Column (2.1 mm × 100 mm, 1.7 μm); mobile phase: A is 0.1% formic acid-water solution, B is acetonitrile; gradient elution program is shown in Table 5, flow rate is 0.3 mL / min; diode array (PDA) detector; column temperature is 45°C; injection volume is 5.0 μL.
[0129] Table 5 Gradient elution program
[0130] Time (min) Mobile phase A (%) Mobile phase B (%) 0.00 100 0 7.00 70 30 8.00 20 80 9.00 0 100 10.00 100 0
[0131] Mass spectrometry conditions: positive ion mode, electrospray ion source, multiple reaction monitoring mode, ion source temperature 100°C, capillary voltage 3.5 kV, cone voltage 20 V, desolvation gas temperature 400°C, IMS gas flow rate 24 mL / min, collision energy 6 / 20 eV.
[0132] The total ion current chromatogram of idebenone standard solution is as follows Figure 6 shown. The peak eluting at 4.62 min is idebenone. Its first-order mass spectrum (TOF MS) and second-order mass spectrum (TOF MS / MS) are as follows Figure 7 shown. The maximum number of protons m / z 339.2154 is the [M+H] + ion peak.
[0133] Take a series of standard working solutions of 1.25, 2.5, 5, 10 μg / mL prepared from the idebenone standard solution and inject them for analysis respectively. With the idebenone concentration as the abscissa and the peak area as the ordinate, a regression equation is made. Analyzed under the above chromatographic conditions, the results show that in the range of 0.5 - 8.0 μg / mL, the peak area has a good linear relationship with the mass concentration: Y = 29753.2598X – 3710.2124 (R 2 = 0.997). Subsequently, the content of idebenone in the sample is calculated through the above standard curve.
[0134] According to the steps of Example 3 (1), 500 mL of the cultured Oceanobacillus sp. Y-3 fermentation broth is obtained, and then processed according to the steps (2) - (3) of Example 3. Finally, 65.6 mg of the Oceanobacillus sp. Y-3 cell lysate is obtained; add 1 mL of methanol and dissolve it by ultrasonic treatment. After centrifugation at 8000 - 9000 rpm, take the supernatant to obtain the sample to be tested. Using the above chromatographic and mass spectrometric conditions, inject the sample to be tested into the chromatograph for chromatographic separation; the chromatographic effluent directly enters the mass spectrometer for detection, and qualitative and quantitative analysis of idebenone is carried out by the mass spectrometer.
[0135] The total ion current chromatogram of the Oceanobacillus sp. Y-3 cell lysate solution is as follows Figure 8 shown. The first-order mass spectrum (TOF MS) and second-order mass spectrum (TOF MS / MS) of the peak eluting at 4.62 min are as follows Figure 9 shown. The maximum number of protons m / z 339.2187 is the [M+H] + ion peak. Comparing Figure 8 , 9 with Figure 6 , 7 it can be seen that the peak eluting at 4.62 min in the sample is consistent with the retention time of the idebenone standard sample, and the [M+H] + ion peak is consistent with the idebenone standard sample. Therefore, it is determined that the peak eluting at 4.62 min is idebenone, and the Oceanobacillus sp. Y-3 cell lysate solution contains idebenone.
[0136] Example 6: Quantitative Analysis of the Ability of Oceanobacillus sp. Y-3 to Produce Idebenone
[0137] Fresh medium: 20 g of crude salt, 20 g of MgSO4·7H2O, 2.0 g of KCl, 3.0 g of sodium citrate, 0.2 g of anhydrous calcium chloride, 2.0 g of yeast extract, 10.0 g of peptone. Add distilled water to make up to 1 L and adjust the pH to 7.2.
[0138] Add the crude salt seed liquid prepared in Example 3 to a sterile conical flask containing 300 mL of the above fresh medium (salinity 2%, pH 7.2) at a ratio of 10% by volume, and culture in a shaking incubator at 30 °C for 5 days until the OD 600 is 0.7 - 0.8 to obtain the cultured fermentation broth. Take the obtained fermentation broth (with OD 600 being 0.7 for subsequent detection), and centrifuge, wash and extract it according to the method in step (2) of Example 3 to obtain the ethanol extract of the cell lysate. Combine the obtained ethanol extracts of the cell lysate, concentrate under reduced pressure, and make up the volume to 1 mL with methanol.
[0139] Using the measurement method and standard curve of Example 5, the content of idebenone in the ethanol extract of the cell lysate of Oceanobacillus sp. Y-3 was measured to be 81.4 μg / L. Since the mass of the freeze-dried cells of Oceanobacillus sp. Y-3 is 0.1809 g, the ability of Oceanobacillus sp. Y-3 strain to produce idebenone was calculated to be 0.45 μg / g.
[0140] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.
Claims
1. An Oceanobacillus sp. Y-3 strain, characterized in that, The Bacillus oceanisediminis was deposited at the China Center for Type Culture Collection on November 05, 2024, with the deposit number CCTCC NO: M 20242434.
2. A microbial inoculant, characterized in that, The microbial agent contains the Bacillus oceanisediminis CCTCC NO: M 20242434 described in claim 1; Optionally, the microbial agent uses the Bacillus oceanisediminis CCTCC NO: M 20242434 as the main microorganism.
3. The microbial agent according to claim 2, wherein The microbial agent contains viable cells of the CCTCC NO: M20242434 strain of the present invention, dry cells of the CCTCC NO: M 20242434 strain of the present invention obtained by freeze-drying, immobilized cells of the CCTCC NO: M 20242434 strain of the present invention, a liquid microbial agent of the CCTCC NO: M20242434 strain of the present invention, a solid microbial agent of the CCTCC NO: M 20242434 strain of the present invention, or the CCTCC NO: M 20242434 strain of the present invention in any other form.
4. A product composition with antioxidant efficacy, characterized in that, The preparation method of the product composition includes: adding the cell mass and / or metabolite of the Bacillus oceanisediminis CCTCC NO: M 20242434 described in claim 1 to a product matrix to obtain the product composition.
5. The product composition according to claim 4, characterized in that, The antioxidant effect is the ability to scavenge free radicals or the ability to reduce iron ions; Optionally, the free radicals are at least one of DPPH·, ·OH, and ABTS + · 6. Use of the Bacillus oceanisediminis CCTCC NO: M 20242434 described in claim 1, the microbial agent containing the Bacillus oceanisediminis CCTCC NO: M 20242434 described in claim 1, or the product composition described in claim 4 in the preparation of a product having the ability to scavenge free radicals or antioxidant function.
7. The application according to claim 6, wherein The product includes but is not limited to drugs, health products, cosmetics or functional foods; Optionally, the product further contains excipients acceptable in pharmacy, food or health products.
8. A method for producing idebenone, characterized in that, The method uses the Bacillus oceanisediminis CCTCC NO: M 20242434 described in claim 1 to produce idebenone.
9. A cosmetic, characterized in that, The cosmetic contains the cell lysate of the Bacillus oceanisediminis CCTCC NO: M20242434 described in claim 1 or the product composition described in claim 4; Optionally, the cosmetic is a skin care product.
10. The cosmetic according to claim 9, characterized in that, The dosage form of the cosmetic can be formulated in the form of solutions, topical ointments, cream foams, nutritive emollients, soft emollients, fillers, soft water, milky lotions, cosmetic bases, perfumes, soaps, liquid cleaners, bath agents, sunscreens, suntan oils, suspensions, emulsions, pastes, gels, lotions, powders, soaps, surfactant-containing cleaners, oils, foundations, emulsion foundations, wax foundations, patches and sprays; Optionally, the cosmetic further contains at least one carrier acceptable in cosmetics; Optionally, the carrier can be oil, water, surfactant, humectant, lower alcohol, thickener, chelating agent, pigment, preservative, perfume.
Citation Information
Patent Citations
Caproic acid-producing sludge bacillus subtilis and application thereof
CN118703398A
Moisturizing cream prepared from lysate extract produced by fermentation of bacillus subtilis
CN120360923A
Ceiling lamp with an earthquake-proof bracket
KR102479209B1
Methods involving bacterial strain replacement
WO2023057598A1
Soluble curcumin and its derivatives
WO2024250032A1