Application of a geniculate oligotrophic monosporus and its fermentation broth in the control of rice false smut and rapeseed sclerotinia stem rot

Abstract

This invention discloses the application of a *Oligotrophomonas geniculata* strain and its fermentation broth in the control of rice false smut and rapeseed sclerotinia stem rot, relating to the field of microbial technology. The *Oligotrophomonas geniculata* strain has the preservation number CCTCC NO: M20232222. The *Oligotrophomonas geniculata* strain provided by this invention exhibits good biocontrol efficacy and high safety in the control of rice false smut and sclerotinia stem rot. The application of this invention can significantly reduce the use of biochemical agents in the control of rice and rapeseed diseases. Furthermore, this strain can also be applied to the control of peach brown rot with significant effects.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and more specifically to the application of a geniculate oligotrophic bacterium and its fermentation broth in the prevention and control of rice false smut and rapeseed sclerotinia stem rot. Background Technology

[0002] Rice false smut ( Ustilaginoidea virens Rice blast disease caused by smut is also known as false smut or green smut. This disease infects the rice panicle glumes during the booting stage and forms dark green blasted grains after the rice grains have filled.

[0003] In the early stages of rapeseed sclerotinia stem rot, water-soaked brown spots appear on the stem. Later, the pith becomes hollow and the cortex longitudinally cracks, making the plant prone to lodging or breakage. Leaves and flowers are also affected; leaves develop grayish-brown concentric rings, and infected petals rot and fall off, preventing fruit setting and causing reinfection. Existing rapeseed varieties lack sufficient resistance to sclerotinia stem rot, and control still heavily relies on spraying chemical agents.

[0004] Currently, although chemical control remains the mainstream method for disease control, over-reliance on fungicides carries several risks, including pesticide residues in agricultural products, the development of pesticide resistance, and non-point source pollution. Therefore, achieving reduced use and increased efficiency of chemical fungicides is a key issue in green and sustainable control strategies. Biological control eliminates the drawbacks of chemical control and aligns with the principles of environmentally friendly and green control. Biological control utilizes beneficial microorganisms or their metabolic products to inhibit or kill pathogens, achieving the goal of reducing disease occurrence in an environmentally friendly, non-toxic, residue-free, and cost-effective manner. It is a significant method for plant disease control. However, there is currently a scarcity of biocontrol strains targeting rice false smut and rapeseed sclerotinia stem rot, creating an urgent market demand.

[0005] Therefore, providing biocontrol strains that can prevent and control rice false smut and rapeseed sclerotinia stem rot is a technical problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides a geniculate oligotrophomonad strain that has a good inhibitory effect on the pathogens of rice false smut and rapeseed sclerotinia stem rot, and is a biocontrol strain with great development potential.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] A strain of *Oligotrophomonas geniculata*, with accession number CCTCC NO: M20232222, was deposited on November 15, 2023, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China. Following adjacent inoculation phylogenetic analysis (atpD guaA mutM ppsArecA), it was classified and named... Stenotrophomonas geniculata .

[0009] Another object of the present invention is to provide a microbial inoculant, comprising the above-mentioned Oligotrophozoites geniculateus or its fermentation broth.

[0010] Another object of the present invention is to provide the application of the above-mentioned geniculate oligotrophoblast or the above-mentioned microbial agent in the prevention and control of rice false smut.

[0011] Another object of the present invention is to provide the application of the above-mentioned geniculate oligotrophomonas or the above-mentioned microbial agents in the prevention and control of sclerotinia stem rot in rapeseed.

[0012] Another object of the present invention is to provide the application of the above-mentioned geniculate oligotrophoblast or the above-mentioned microbial agent in the prevention and control of peach brown rot.

[0013] Beneficial effects: The geniculate oligotrophoblast provided by this invention is effective in the prevention and control of rice false smut and sclerotinia rot, with good biocontrol effect and high safety, and has no negative effect on rice germination and growth.

[0014] The application of this invention can significantly reduce the use of biochemical agents in rice and rapeseed diseases. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0016] Figure 1 : Colony images of the biocontrol strains screened in this invention after 3 days of growth.

[0017] Figure 2 Images of colonies and Gram staining of strain 28-1 of this invention.

[0018] Figure 3 Phylogenetic tree of strain 28-1 of this invention using the adjacent inoculation method (atpD guaA mutM ppsA recA).

[0019] Figure 4 The inhibitory effect of strain 28-1 of this invention on rice false smut, sclerotinia sclerotiorum and brown rot.

[0020] Figure 5 The fermentation broth of strain 28-1 of this invention exhibits inhibitory effects on rice false smut, sclerotinia sclerotiorum, and brown rot.

[0021] Figure 6 The inhibitory effect of the fermentation broth of strain 28-1 of this invention on the germination of conidia of rice false smut.

[0022] Figure 7 The present invention describes the effects of bacterial suspension and fermentation broth of strain 28-1 on the prevention and control of rice false smut, rapeseed sclerotinia stem rot and peach brown rot.

[0023] Figure 8 The efficacy of bacterial suspension of strain 28-1 of this invention in controlling sclerotinia stem rot in rapeseed.

[0024] Figure 9 Soaking treatment of strain 28-1 of this invention has no adverse effects on the growth of rice plants. Detailed Implementation

[0025] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0026] The following examples further illustrate the content of the present invention, but should not be construed as limiting the present invention.

[0027] Example 1 Test Materials

[0028] 1. Tested pathogen strains and crop varieties

[0029] Rice blast fungus: JS60-2;

[0030] Sclerotinia sclerotiorum rot strain: 1980 UF-70;

[0031] Brown rot pathogen: Bmpc7;

[0032] Rice variety: Late Indica 98;

[0033] Rapeseed variety: Huashuang No. 4;

[0034] Peach variety: Chunmei.

[0035] 2. Culture medium

[0036] (1) CM solid culture medium: D-Glucose 20 g, Peptone 4 g, Casamino acids 2 g, Yeastextract 2 g, NaNO3 12 g, KH2PO4 3.04 g, KCl 1.04 g, MgSO4·7H2O 1.04 g, Traceelements 2 mL, Vitamin solution 2 mL, agar powder 30 g, add distilled water to make up to 2000 mL, adjust pH to 6.5, dispense into containers and autoclave at 121℃ for 15 min.

[0037] Trace elements (100 mL): 5 g Na4EDTA, 2.2 g ZnSO4·7H2O, 1.1 g H3BO3, 0.5 gMnCl2, 0.5 g FeSO4·7H2O, 0.17 g CoCl2·6H2O, 0.16 g CuSO4, 0.15 g NaMoO4·5H2O.

[0038] Vitamin solution (100 mL): 0.01 g each of the following substances: Biotin, Pyridoxin, Thiamine, Riboflavin, PABA (p-aminobenzonic acid), Nicotinic acid.

[0039] (2) LB solid medium: 5 g yeast extract, 10 g tryptone, 10 g NaCl, 20 g agar powder, add ultrapure water to a final volume of 1000 mL, stir on a magnetic stirrer at 640 r•min -1 Stir and dispense into containers, then autoclave at 121°C for 30 min.

[0040] (3) LB liquid medium: 5 g yeast extract, 10 g tryptone, 10 g NaCl, add ultrapure water to a final volume of 1000 mL, stir on a magnetic stirrer at 640 r•min -1 Stir and dispense, then autoclave at 121℃ for 30 min.

[0041] (4) PDA solid culture medium: 200 g potato, 20 g glucose, 20 g agar powder, 0.05 g chloramphenicol, 1000 mL ultrapure water, dispensed and sterilized at 121℃ for 30 min.

[0042] (5) PSA solid culture medium: 200 g potato, 20 g sucrose, 20 g agar powder, 0.05 g chloramphenicol, 1000 mL ultrapure water, dispensed and sterilized at 121℃ for 30 min.

[0043] 3. Test reagents

[0044] 100 μg / mL Kanamycin, 75% ethanol solution, 1×TAE solution, etc.

[0045] Example 2: Isolation and Identification of Strains

[0046] (1) Isolation and purification of strains:

[0047] Microbial samples were collected from the panicle of disease-resistant rice varieties and serially diluted to 10⁻⁶ concentrations. -5 10 -6 10 -7 150 μL of bacterial suspension was spread onto LB medium, with four plates for each concentration. The plates were placed in a 20°C biochemical incubator. Based on the differences in colony color, size, and edge morphology, different single colonies were picked after 2, 5, and 10 days. The colonies were purified by streak plating on the original culture. 900 μL of the expanded biocontrol bacterial suspension was added together with 900 μL of 50% glycerol solution into an EP tube and stored at -80°C for later use.

[0048] Rice acarinic toxin was added to LB medium during isolation to isolate and screen strains that were resistant to or capable of decomposing rice acarinic toxin.

[0049] Twenty-one antagonistic biocontrol strains were obtained after isolation and purification, of which 16 showed biocontrol potential. The colony colors of the isolated and purified biocontrol strains ranged from white, light yellow, to bright yellow, with TR-3, TR-4, and TR-5 being milky white and 28-1 being light yellow. Some colonies had clear boundaries, such as TR-3, TR-4, and TR-5, while others did not. TR-1, TR-2, TR-3, TR-4, TR-5, TR-6, TR-7, TR-8, TR-9, and 28-1 were glossy (see appendix). Figure 1 The 16S rRNA-specific sequences of the above strains were amplified by PCR, and the obtained sequences were aligned using NCBI-blast after Sanger sequencing. The strain identification results are shown in Table 1. The amplification primers used were: 8F: AGAGTTTGATCCTGGCTCAG and 1492R: GGTTACCTTGTTACGACTT.

[0050] Table 1. Identification of strains by 16S rRNA sequence alignment

[0051] serial number Strain identification results Chinese name TR-1 Anhui Flavobacterium TR-2 Pseudomonas TR-3 Polysacchariformis TR-4 Polysacchariformis TR-5 Polysacchariformis TR-6 Ureaplasma urealyticum TR-7 Flavobacterium TR-8 Acinetobacter TR-9 Acinetobacter juni N28-4 Bacillus subtilis N28-6 Bacillus N28-7 Bacillus subtilis N28-8 Bacillus belesiensis N28-9 Bacillus belesiensis 28-1 geniculate oligotrophomonas 28-3 Acidobacteria 28-4 Acidobacteria 28-5 Bacillus 28-8 staphylococcus 28-9 Acidobacteria 28-10 Bacillus subtilis

[0052] Of these, 28-1 was identified as *Oligotrophomonas geniculata* by adjacent multi-site phylogenetic analysis (atpD guaA mutM ppsA recA). Stenotrophomonas geniculata (See appendix) Figure 3 This strain was deposited on November 15, 2023, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M20232222, and classified as follows: Stenotrophomonas geniculata .

[0053] Example 2

[0054] 1. Antibacterial ability test

[0055] The inhibitory effect of biocontrol bacteria on rice false smut was verified using the plate confrontation method.

[0056] For bacterial activation and concentration adjustment, first add 5 mL of LB liquid culture medium to a sterile glass test tube. Using sterilized forceps, hold a sterile pipette tip, dip it into a small amount of biocontrol bacteria, transfer it into the LB liquid culture medium, and seal the tube. Incubate at 180 r•min. -1 Shake at 28℃ for 10 h. Under aseptic conditions, a portion of the activated bacterial solution was taken out and diluted with sterilized ultrapure water. The solution was then analyzed using a spectrophotometer at an OD wavelength. 600 To perform the measurement, first use LB liquid medium to zero the culture medium and adjust the absorbance of the bacterial culture medium to 0.7, then dilute the remaining uncontaminated bacterial solution.

[0057] Confrontation culture of bacteria and pathogenic fungi: Mycelial cakes were created using a 5 mm punch. The pathogens to be tested were inoculated into the center of CM solid medium. 5 μL of antagonistic bacterial suspension was pipetted onto the plate at 1 / 4 of its diameter. The plate was sealed with sealing film and incubated at 28℃ in a biochemical incubator. Incubation was performed for 20 days for *Aspergillus oryzae*, 4 days for *Sclerotinia sclerotiorum*, and 6 days for *Brachys thunbergii*. Fungal growth was measured, and the inhibition rate was calculated compared to the control. Statistical data were then analyzed for significance (see appendix). Figure 4 The results showed that the inhibition rates against rice false smut, sclerotinia sclerotiorum, and brown rot reached 98.7%, 72.1%, and 49.1%, respectively.

[0058] The formula for calculating the inhibition rate is: Inhibition rate = (Control colony diameter - Treated colony diameter) / (Control colony diameter - Mycelium cake diameter) × 100%.

[0059] 2. Determination of the antibacterial ability of fermentation broth

[0060] Strain 28-1 was inoculated into CM medium and incubated at 28°C with shaking for 48 hours. After filtration through a 0.22 μm bacterial filter, the fermentation broth was added to PSA medium at a ratio of 10%, i.e., 20 mL of fermentation broth was added to 200 mL of medium. Rice false smut mycelial blocks were inoculated onto PSA agar plates, and the inhibition rate was measured and calculated after 20 days of growth. The results are attached. Figure 5 The colony diameter was significantly lower than the control, with an inhibition rate of 81.9%. Simultaneously, the fermentation broth was added to PDA medium at a ratio of 10%, and fresh *Sclerotinia sclerotiorum* mycelial blocks were inoculated in the middle of the medium. After 4 days of growth, the inhibition rate was measured and calculated, reaching 98.3%. PDA containing 10% fermentation broth was inoculated with *Brachys thunbergii* mycelial blocks, and after 6 days of growth, the inhibition rate was measured and calculated, reaching 35.9% (see Appendix). Figure 5 ).

[0061] 3. Determination of the inhibitory effect of fermentation broth on conidial germination

[0062] Strain 28-1 was inoculated onto CM medium and incubated at 28°C with shaking for 48 hours. After filtration through a 0.22 μm bacterial filter, the fermentation broth was added to the rice false spore suspension at a ratio of 10%, i.e., 2 mL of fermentation broth was added to 20 mL of medium, resulting in a final spore suspension concentration of 10%. -7 Germination rate / mL. Germination rate and germ tube length were recorded after 48 h. Germination inhibition rate reached 73.2%, and germ tube growth inhibition reached 91.0% (see Appendix). Figure 6 ).

[0063] 4. Indoor testing for disease control in bacterial culture and fermentation broth

[0064] Strain 28-1 was inoculated onto CM medium and incubated at 28°C with shaking for 48 hours. The bacterial culture was adjusted to OD600 = 0.5 to obtain the test culture; the culture was then filtered using a bacterial filter to obtain the fermentation broth. 0.5% Tween 20 was added to the bacterial culture, and 0.5% Myfeel adjuvant was added to the fermentation broth.

[0065] First, rice was sprayed with the test bacterial solution and fermentation broth, respectively. Four hours later, rice was inoculated with a suspension of rice false smut mycelium spores at a conidium concentration of 10. -7 ~10 -8 Twenty days later, the incidence of disease was investigated and the number of rice germ balls was counted.

[0066] The bacterial solution and fermentation broth were sprayed onto rapeseed leaves, and sclerotium mycelial blocks were inoculated 1 hour later. The diameter of the lesions was measured 2 days later, and the inhibition rate was calculated.

[0067] Similarly, the test bacterial solution and fermentation broth were sprayed onto peach fruits, and brown rot fungal mycelial blocks were inoculated 1 hour later. The diameter of the lesions was measured 3 days later, and the inhibition rate was calculated.

[0068] Healthy rapeseed plants were selected, and after 30 minutes of spraying with the test bacterial solution, they were sprayed with a suspension of Sclerotinia sclerotiorum mycelium. The plants were then placed in the dark and kept moist, with water spraying serving as a control. Disease severity was assessed after 9 days, and the study was repeated three times (severity grading index:

[0069] Grade 0: No disease spots on the entire plant;

[0070] Level 1: The affected area accounts for less than 5% of the surface area of ​​the main stem;

[0071] Level 3: The affected area accounts for 5.1% to 15% of the main stem surface area;

[0072] Level 5: The affected area accounts for 15.1% to 30% of the main stem surface area;

[0073] Level 7: The affected area accounts for 30.1% to 50% of the main stem surface area;

[0074] Level 9: The affected area accounts for more than 50.1% of the main stem surface area.

[0075] In indoor bioassay experiments, the bacterial suspension and fermentation broth showed inhibition rates of 72.7% and 73.1% against rice false smut, respectively; 100% and 100% against rapeseed sclerotinia stem rot, respectively; and 56.0% and 62.7% against peach brown rot, respectively (see appendix). Figure 7 Pre-inoculation treatment with a suspension of *Sclerotinia sclerotiorum* mycelium from rapeseed plants significantly reduced the incidence of sclerotinia rot, with an inhibition rate of 89.0% (see attached table). Figure 8 ).

[0076] 5. Safety test of the strain on rice seed germination and seedling growth

[0077] Seed germination experiment: Before conducting the seed germination experiment, bacterial activation is necessary. A small amount of a single colony of the biocontrol strain is dipped into 5 mL of LB liquid medium and incubated at 180 r•min. -1 Shake at 28℃ for 10 hours. Under aseptic conditions, take a portion of the activated bacterial solution and dilute it with sterilized ultrapure water to adjust the OD value of the spectrophotometer. 600 =0.5, the control was adjusted to LB liquid culture medium solution, and the dilution ratio was recorded. Seed disinfection involved soaking in 70% ethanol for 1 min, followed by rinsing with sterile water, then soaking in 2% sodium hypochlorite for 20 min. After multiple rinses with sterile water, 25 mL of ultrapure water was added to an Erlenmeyer flask, with 100 mg of carboxymethyl vitamin added to every 25 mL of solution. An appropriate amount of bacterial solution was added according to the previously adjusted ratio, and 300 soaked seeds were poured in. The mixture was incubated at 150 r•min. -1The seeds were shaken at 28℃ for 10 h, then incubated in a moist glass petri dish. Germination was observed and recorded after 7 days, and significance analysis showed that treatment with strain 28-1 had no adverse effect on rice seed germination.

[0078] Seedling growth promotion experiment: Seedlings that germinated in the seed germination experiment were transplanted into sterilized soil. After growing under suitable conditions for 30 days, their fresh weight, dry weight, plant height, and root length were recorded, and significance analysis was performed. The results showed that treatment with strain 28-1 significantly promoted the dry weight and stem length of rice. It had no adverse effects on germination rate, fresh weight, and root length (see Table 2 and appendix). Figure 9 ).

[0079] Table 2

[0080] strain Germination rate % Fresh weight (g) dry weight (g) stem length mm Root length mm 28-1 99.00±1.00a 1.10±0.41a 0.26±0.08a 458.81±41.26a 107.56±25.04ab TR-3 100.00±1.00a 1.33±0.33a 0.21±0.06ab 416.00±32.84b 104.06±21.01ab TR-4 99.00±1.00a 1.32±0.26a 0.21±0.05ab 381.00±33.04c 108.62±16.77ab TR-5 100.00±1.00a 1.11±0.42a 0.22±0.09ab 425.31±37.85b 81.75±15.70c Blank control 99.00±1.00a 1.33±0.42a 0.18±0.08b 418.06±45.29b 117.93±15.86a

[0081] 6. Control effect in field trials

[0082] The pesticide was applied 5-7 days before the rice heading stage (August 11, 2024), at which time the tips of the flag leaf and the second leaf from the top were aligned. Application was carried out around 16:00. There was no rain on the day of application, the temperature was 27℃~37℃, and the southwest wind was at level 2, suitable for application. A second application was conducted one week later. The experiment consisted of 4 treatments, each replicated 3 times, for a total of 12 plots. Isolation rows were set up between different treatments to prevent cross-contamination between different pesticides. The treatments were: water control, 15 mL / 667m² of 430 g / L tebuconazole suspension. 2 Soaking treatment with strain 28-1, spray treatment with strain 28-1.

[0083] The disease survey was conducted after the rice ripened to a golden yellow stage. Five sampling points were used, with six panicles sampled at each point. The total number of panicles, the number of diseased panicles, and the disease severity were recorded. Disease index and control efficacy were calculated (see Table 3). According to the grading standards, panicles were classified as follows: Grade 0 indicates no diseased grains; Grade 1 indicates one warty head or diseased grain per panicle; Grade 2 indicates two warty heads or diseased grains per panicle; Grade 3 indicates 3–5 warty heads or diseased grains per panicle; Grade 4 indicates 6–9 warty heads or diseased grains per panicle; and Grade 5 indicates more than 10 warty heads or diseased grains per panicle.

[0084] The results showed that both the 28-1 seed soaking treatment and the spraying treatment could significantly reduce the occurrence of rice false smut, with average control efficacy of 87.0% and 79.6%, respectively, which were not significantly different from the tebuconazole treatment.

[0085] Table 3 Field experiment on rice false smut control using biocontrol bacterium 28-1

[0086]

[0087] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0088] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A strain of geniculate oligotrophomonas ( Stenotrophomonasgeniculata ), characterized in that, The preservation number of the Stenotrophomonas geniculata is CCTCC NO: M20232222.

2. A microbial inoculant, characterized in that, The Stenotrophomonas geniculata of claim 1.

3. The Stenotrophomonas geniculata of claim 1 or the microbial inoculant of claim 2 for use in preventing and treating rice false smut.

4. The Stenotrophomonas geniculata of claim 1 or the microbial inoculant of claim 2 for use in preventing and treating rapeseed sclerotinia.

5. The Stenotrophomonas geniculata of claim 1 or the microbial inoculant of claim 2 for use in preventing and treating peach brown rot.

Images