Lactobacillus rhamnosus ZX03 with antidiarrheal effect and application of lactobacillus rhamnosus ZX03

Abstract

The invention belongs to the technical field of probiotics, and particularly relates to lactobacillus rhamnosus ZX03 with an antidiarrheal effect and application of the lactobacillus rhamnosus ZX03. According to the invention, a novel Lactobacillus rhamnosus ZX03 strain is separated from feces of a healthy infant in Guangzhou city, Guangdong province, and DSS-induced zebra fish IBD model test finds that the strain can reduce aggregation of intestinal neutrophil and macrophage, inhibit intestinal peristalsis, increase the content of hyaluronic acid in the body and reduce tyrosinase activity, so that the strain can be used for preventing and treating the intestinal tract neutrophil and macrophage, and can be used for preventing and treating the intestinal tract neutrophil and macrophage. And an effect of protecting intestinal tissues can also be achieved. It is indicated that the strain has the antidiarrheal effect, can be prepared into a medicament to regulate human intestinal flora and contribute to antidiarrheal, or can improve animal intestinal health and improve production performance in livestock breeding, such as development of antidiarrheal-related probiotic functional products, and has wide application prospects in the field of diarrhea treatment and prevention.

Description

Technical Field

[0001] The present invention belongs to the technical field of probiotics, and particularly relates to a Lactobacillus rhamnosus ZX03 with antidiarrheal efficacy and its application. Background Art

[0002] The term "probiotics" originated from the Greek language. With the in-depth understanding of probiotics, keywords such as regulating the intestinal flora, indigenous bacteria, live microorganisms, and viable cell count have been incorporated into the concept of probiotics. Currently, the widely accepted definition of probiotics by the Food and Agriculture Organization of the United Nations / World Health Organization is that when administered in sufficient amounts, they are live microorganisms that are beneficial to the host. In recent years, probiotic cells and their lysates have also been proven to provide beneficial effects to the human body.

[0003] Diarrhea, commonly known as "having loose stools", refers to the frequency of defecation significantly exceeding the usual habit, with thin feces, increased water content, a daily fecal output exceeding 200 g, or the feces containing undigested food, and even containing pus, blood, mucus, etc. The normal daily intake of gastrointestinal fluid in humans is about 9 L. Through the absorption of water by the intestine, the water content in feces is only about 100 - 200 mL. If the amount of fluid entering the colon exceeds the absorption capacity of the colon or / and the absorption capacity of the colon decreases, it will lead to an increase in the water output in feces and cause diarrhea. Diarrhea can reduce the body's resistance, cause problems such as malnutrition, anemia, and vitamin deficiency, weaken the body's resistance to infectious diseases and various infections, lead to easy spread of inflammation, and increase the risk of urinary tract infections. Diarrhea can also cause disorders of water and electrolyte balance and acid-base balance. Severe dehydration, electrolyte disorders, and acidosis cause serious damage to the body and can endanger life if not rescued in time. Diarrhea also causes embarrassment and inconvenience to life and work, and recurrent chronic diarrhea causes great pain to the patient's body and mind, seriously affecting the patient's quality of life.

[0004] Lacticaseibacillus rhamnosus is a probiotic lactic acid bacterium that has been extensively studied abroad in recent years. This bacterium is mostly found in the intestines of humans and animals. Taxonomically, it belongs to the genus Lactobacillus and is a Gram-positive probiotic that is anaerobic, acid-tolerant, and does not produce spores. Lacticaseibacillus rhamnosus cannot utilize lactose but can ferment various monosaccharides (such as glucose, arabinose, and maltose). Most strains can produce a small amount of soluble ammonia but do not produce indole or hydrogen sulfide. It has biological characteristics such as acid tolerance, bile salt tolerance, and resistance to various antibiotics. A large amount of data has shown that Lacticaseibacillus rhamnosus has broad development and application prospects in the field of probiotics. Current research results have confirmed that Lacticaseibacillus rhamnosus has the following probiotic functions: (1) Antibacterial effect. Reports indicate that Lacticaseibacillus rhamnosus has an inhibitory effect on some pathogenic bacteria in food and the intestine, and the antibacterial substances produced by its fermentation have an inhibitory effect on Gram-positive, Gram-negative, and various pathogenic bacteria; (2) Antioxidant effect. Studies have shown that the bacterial suspension, cell-free extract, and exopolysaccharide of Lacticaseibacillus rhamnosus all have strong antioxidant activity; (3) Immunomodulatory effect. However, there is currently no report on using Lacticaseibacillus rhamnosus to treat diarrhea.

[0005] In summary, due to the complex pathogenesis of diarrhea and the differences in the probiotic characteristics of probiotics at the strain level, there are differences in the efficacy and action mechanisms of different strains of the same species of probiotics. Screening for probiotic strains with outstanding antidiarrheal effects and clear action mechanisms remains a difficult and hot topic in current research. Summary of the Invention

[0006] To overcome the deficiencies of the above-mentioned prior art, the present invention isolated a new strain of Lacticaseibacillus rhamnosus ZX03 from the feces of a healthy infant in Guangzhou, Guangdong Province. This strain has antidiarrheal efficacy and broad application prospects in the field of treating and preventing diarrhea.

[0007] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0008] In the first aspect of the present invention, a strain of Lacticaseibacillus rhamnosus ZX03 is provided. The Lacticaseibacillus rhamnosus ZX03 strain was isolated from the feces of a healthy infant in Guangzhou, Guangdong Province, and its deposit number is CCTCC NO: M 20242114.

[0009] Preferably, the 16S rDNA of the Lacticaseibacillus rhamnosus ZX03 strain is as shown in SEQ ID No: 1.

[0010] The second aspect of the present invention provides the use of the Lacticaseibacillus rhamnosus ZX03 strain in the preparation of antidiarrheal products.

[0011] Preferably, the antidiarrheal product is applicable to diarrhea caused by inflammatory bowel disease.

[0012] Preferably, the antidiarrheal effect is to reduce the aggregation of neutrophils and macrophages in the intestine, inhibit intestinal peristalsis; and / or increase the content of hyaluronic acid in the body, reduce the activity of tyrosinase, and protect intestinal tissues.

[0013] Preferably, the product includes a medicament or feed.

[0014] The third aspect of the present invention provides a probiotic agent, which uses the Lacticaseibacillus rhamnosus ZX03 strain as the main active ingredient.

[0015] Preferably, in the agent, the number of ZX03 strains is not less than 10 5 CFU / mL.

[0016] Preferably, the agent further includes excipients acceptable in the pharmaceutical or feed field.

[0017] Preferably, the agent of the present invention can be a liquid agent or a solid agent, and can be prepared by adding excipients permitted in the field of microbial preparations using conventional technical means.

[0018] Compared with the prior art, the beneficial effects of the present invention are:

[0019] A new strain of Lacticaseibacillus rhamnosus ZX03 was isolated from the feces of a healthy infant in Guangzhou, Guangdong Province. Through experiments on a DSS-induced zebrafish IBD model, it was found that this strain can reduce the aggregation of intestinal neutrophils and macrophages, inhibit intestinal peristalsis, increase the content of hyaluronic acid in the body, reduce the activity of tyrosinase, and also protect the intestinal tissue. This shows that the newly isolated Lacticaseibacillus rhamnosus ZX03 strain of the present invention can maintain intestinal health by reducing the aggregation of intestinal inflammatory cells, inhibiting intestinal peristalsis, and protecting the intestinal tissue on the one hand, and can strengthen the intestinal barrier, promote tissue repair by increasing the content of hyaluronic acid in the body, and reduce intestinal inflammation and regulate the intestinal microecology by reducing the activity of tyrosinase, protecting the intestinal tissue, and thus alleviating diarrhea symptoms. It can be seen that the Lacticaseibacillus rhamnosus ZX03 strain provided by the present invention has an antidiarrheal effect, can be made into a medicine to regulate the human intestinal flora, help to stop diarrhea, or can improve the intestinal health of animals and improve production performance in livestock breeding, such as developing probiotic functional products related to antidiarrhea, and has broad application prospects in the field of treating and preventing diarrhea. Description of the Drawings

[0020] Figure 1 It is a phylogenetic tree of Lacticaseibacillus rhamnosus ZX03 strain (the tree-building strains are from the Genome database of NCBI);

[0021] Figure 2 It is an intuitive diagram (A) and statistical chart (B) of the intestinal colonization of Lacticaseibacillus rhamnosus ZX03 in zebrafish (n = 6);

[0022] Figure 3 It is an intuitive diagram (A) and statistical chart (B) of the effect of Lacticaseibacillus rhamnosus ZX03 on the number of neutrophils (n = 6);

[0023] Figure 4 It is an intuitive diagram (A) and statistical chart (B) of the effect of Lacticaseibacillus rhamnosus ZX03 on the number of macrophages in the zebrafish intestine (n = 6);

[0024] Figure 5 It is an intuitive diagram (A) and statistical chart (B) of the effect of Lacticaseibacillus rhamnosus ZX03 on the intestinal peristalsis of zebrafish (n = 6);

[0025] Figure 6 It is an intuitive diagram of the effect of Lacticaseibacillus rhamnosus ZX03 on the zebrafish intestinal tissue;

[0026] Figure 7Statistical chart of the effect of Lactobacillus rhamnosus ZX03 on the hyaluronic acid content in zebrafish (n = 6);

[0027] Figure 8 Statistical chart of the effect of Lactobacillus rhamnosus ZX03 on the tyrosinase activity in zebrafish (n = 6). Specific implementation manners

[0028] The following further describes the specific implementation manners of the present invention. It should be noted here that the description of these implementation manners is used to help understand the present invention, but does not limit the present invention. In addition, the technical features involved in the various implementation manners of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0029] Unless otherwise specified, the experimental methods in the following examples are all conventional methods. Unless otherwise specified, the test materials used in the following examples can all be obtained through conventional commercial channels.

[0030] In the following examples, the E3 culture water was prepared as follows: Weigh 11.7 g of sodium chloride, 0.506 g of potassium chloride, 1.465 g of anhydrous magnesium sulfate, and 1.584 g of anhydrous calcium chloride, mix them, add an appropriate amount of pure water and stir evenly, then add an appropriate amount of pure water to dilute to 4 L to obtain 10×E3 culture water. Store it at room temperature for no more than 7 days (the reagents used for preparation are all analytical pure reagents, all purchased from Macklin, and the conductivity of pure water should be less than or equal to 10 us / cm). When using, measure 400 mL of the 10×E3 culture water prepared in the previous step into a suitable container, and add 3.6 L of pure water and stir evenly.

[0031] In the following examples, the bacterial solution, the drugs used in the positive group, and the drugs used to establish the model were all diluted to the corresponding concentrations with E3 culture water.

[0032] Example 1: Isolation of Lactobacillus rhamnosus ZX03 strain

[0033] The Lactobacillus rhamnosus ZX03 strain was isolated from the feces of a healthy infant in Guangzhou, Guangdong Province. The specific method is as follows:

[0034] Collect fresh feces using a 50 mL sterile centrifuge tube, transport it to the laboratory under cold chain conditions, and after surface disinfection, transfer the sample to a biosafety cabinet. Add an appropriate amount of sterile water according to the fecal mass for sufficient dissolution (usually 100 mg of feces plus 800 μL - 1 mL of sterile water), take an appropriate amount of the sample and spread it on an MRS culture plate, and culture it at 37°C in an anaerobic workstation. After 48 h, pick a single colony and inoculate it onto a new MRS culture plate, and continue culturing it in the anaerobic workstation. Refer to the "Bergey's Manual of Determinative Bacteriology" (Eighth Edition) and the "Manual of Fungal Taxonomy and Identification" to observe the growth status of the colonies. Name the purified and isolated strain, numbered ZX03. The growth status of this strain is that the colony is round, with a smooth surface, neat edges, and is milky white and opaque.

[0035] Perform an enlarged culture on the isolated ZX03 strain. After molecular identification of the ZX03 strain using the 16S rDNA universal primers (27F: AGAGTTTGATCCTGGCTCAG; 1492R: TACGGCTACCTTGTTACGACTT), 16S sequencing was carried out by Genewiz Biotechnology Co., Ltd. The obtained 16S rDNA sequence (SEQ ID No: 1) was BLAST-aligned in the Genome database of NCBI. The results showed that the homology of Lactobacillus rhamnosus ZX03 with the known 16S rDNA sequence of Lactobacillus rhamnosus > 99%, and a phylogenetic tree was constructed with homologous strains for analysis ( Figure 1 ) to confirm that the ZX03 strain is a different strain of the same species of Lactobacillus rhamnosus.

[0036] Finally, preserve the ZX03 strain, and the preservation information is as follows: Preservation time: September 29, 2024; Name of the preservation unit: China Center for Type Culture Collection (CCTCC); Preservation number: CCTCC NO: M 20242114; Address of the preservation unit: Wuhan University, Wuhan, China; Taxonomic name: Lactobacillus rhamnosus.

[0037] Lacticaseibacillus rhamnosus ZX03 16S rDNA sequence (1456 bp, SEQ ID No: 1):

[0038]

[0039] Example 2: Study on the probiotic function of Lacticaseibacillus rhamnosus ZX03 strain

[0040] Intestinal inflammation can damage the intestinal mucosa, increase fluid secretion and peristalsis speed, resulting in reduced water absorption and thus causing diarrhea. Common inflammatory bowel diseases such as Crohn's disease and ulcerative colitis are often accompanied by diarrhea symptoms. The zebrafish inflammatory bowel disease (IBD) model has been widely used in disease research. Dextran Sulfate Sodium Salt (DSS) is a synthetic sulfated polysaccharide belonging to polyanion derivatives, which can affect the synthesis of intestinal wall cell DNA, inhibit epithelial cell proliferation, and damage the intestinal mucosal barrier, etc., and is similar to the inflammatory characteristics induced by trinitrobenzenesulfonic acid. The DSS-induced zebrafish IBD model mimics different characteristics of the mammalian IBD phenotype, including intestinal neutrophil inflammation, excessive mucus production, increased intestinal lymphangiogenesis, and upregulation of pro-inflammatory cytokines, etc.

[0041] This invention studies the probiotic function of Lacticaseibacillus rhamnosus ZX03 strain using the DSS-induced zebrafish IBD model.

[0042] 1. Test materials

[0043] 1.1 Test system

[0044] The zebrafish used in this test are wild-type AB strain zebrafish (purchased from Nanjing Yishulihua Biotechnology Co., Ltd.), Tg(mpx:EGFP) transgenic fluorescent zebrafish labeled with neutrophils, and Tg(mpeg:EGFP) transgenic fluorescent zebrafish labeled with macrophages (constructed by Nanjing Yaoshunyu Biotechnology Co., Ltd.).

[0045] 1.2 Reagents

[0046] Table 1 Reagents and materials

[0047]

[0048] 1.3 Main equipment

[0049] Table 2 Instruments and equipment

[0050]

[0051] 1.4 Information of the test article

[0052] For this detection, a total of 1 test sample was used, and the information is shown in Table 3.

[0053] Table 3 Test Sample Information

[0054]

[0055] 2. Test Method

[0056] 2.1 Intestinal Colonization of Lactobacillus rhamnosus ZX03

[0057] (1) Experimental grouping: normal group, 10 4 CFU / mL, 10 5 CFU / mL, 10 6 CFU / mL Lactobacillus rhamnosus ZX03 groups.

[0058] (2) Intervention: Select wild-type AB zebrafish at 3 dpf and place them in a cell culture plate. Add E3 culture water to the normal group, and add the corresponding concentration of bacterial solution to the Lactobacillus rhamnosus ZX03 groups. Incubate in an incubator at 28.5 °C for 3 days.

[0059] (3) Intestinal fluorescence intensity: After the intervention, place the zebrafish under a fluorescence microscope, take pictures and observe the intestinal fluorescence intensity, and use Image J software to calculate the fluorescence intensity.

[0060] (4) All data were statistically analyzed using GraphPad Prism 8, and the experimental data were expressed as mean ± SEM. One-way ANOVA was used. Compared with the normal group: *** P < 0.001.

[0061] 2.2 Lactobacillus rhamnosus ZX03 Alleviates Intestinal Inflammation

[0062] (1) Experimental grouping: normal group, model group, positive group, 10 4 CFU / mL, 10 5 CFU / mL, 10 6 CFU / mL Lactobacillus rhamnosus ZX03 groups.

[0063] (2) Model construction: Randomly select wild-type AB / Tg(mpx:EGFP) / Tg(mpeg:EGFP) zebrafish at 3 dpf and place them in a 6-well cell culture plate. Add E3 culture water to the normal group, and add DSS to the other groups to construct an intestinal inflammation model. Incubate in an incubator at 28.5 °C for 3 days.

[0064] (3) Intervention: After the model construction, add E3 culture water to the normal group and the model group, add mesalazine solution to the positive group, and add the corresponding concentration of bacterial solution to the Lactobacillus rhamnosus ZX03 groups. Incubate in an incubator at 28.5 °C for 2 days.

[0065] (4) Neutrophil count: After the intervention, discard the solution in the well, wash it twice with E3 culture water, and then place the Tg(mpx:EGFP) zebrafish under an inverted fluorescence microscope for observation and photography.

[0066] (5) Macrophage count: After the intervention, discard the solution in the well, wash it twice with E3 culture water, and then place the Tg(mpeg:EGFP) zebrafish under an inverted fluorescence microscope for observation and photography.

[0067] (6) Nile red staining: After the model construction, add Nile red staining solution and stain in the dark for 16 h. After the staining, perform the intervention as shown in (3). After the intervention, discard the solution in the well, wash it twice with E3 culture water, and then place the zebrafish under an inverted fluorescence microscope for observation and photography.

[0068] (7) Alcian blue staining: After the intervention, discard the solution in the well, wash it twice with E3 culture water, fix it overnight with 4% paraformaldehyde, and then perform paraffin embedding, sectioning, and Alcian blue staining.

[0069] (8) Tyrosinase activity assay: After the intervention, transfer the zebrafish to a centrifuge tube, add sodium deoxycholate for homogenization. After homogenization, centrifuge and take the supernatant, add L-dopa, and incubate at 37 °C in an incubator. Use an enzyme-linked immunosorbent assay (ELISA) reader to detect the absorbance values of each experimental group. The relative activity of tyrosinase is calculated according to the following formula:

[0070]

[0071] (9) Hyaluronic acid content assay: After the intervention, collect the zebrafish into a centrifuge tube, add PBS for homogenization. After homogenization, centrifuge and take the supernatant, and detect the protein concentration by the BCA method and the hyaluronic acid content by ELISA.

[0072] (10) All data were statistically analyzed using GraphPad Prism 10, and the experimental data were expressed as mean ± SEM. Analyzed by t-test, compared with the normal group, ### P < 0.001; compared with the model group, &&& P < 0.001. Analyzed by one-way ANOVA, compared with the model group: ** P < 0.01, *** P < 0.001.

[0073] 3. Experimental results

[0074] 3.1. Colonization of Lactobacillus rhamnosus ZX03 in the zebrafish intestine

[0075] Based on the above test methods, the results of the colonization of Lactobacillus rhamnosus ZX03 in the zebrafish intestine are as followsFigure 2 as shown in Table 4.

[0076] From Figure 2 and Table 4, it can be seen that compared with the normal group, the intestinal fluorescence intensity of zebrafish in the 10 4 CFU / mL Lactobacillus rhamnosus ZX03 group increased, but there was no statistical difference (P > 0.05). The intestinal fluorescence intensity of zebrafish in the 10 5 CFU / mL and 10 6 CFU / mL Lactobacillus rhamnosus ZX03 groups increased extremely significantly (P < 0.001).

[0077] Table 4 Statistical table of the colonization of Lactobacillus rhamnosus ZX03 in the intestine of zebrafish (n = 6)

[0078]

[0079] 3.2. Effect of Lactobacillus rhamnosus ZX03 on intestinal inflammatory diarrhea of zebrafish

[0080] (1) Effect of Lactobacillus rhamnosus ZX03 on the number of neutrophils in the intestine of zebrafish

[0081] Based on the above test method, the effect of Lactobacillus rhamnosus ZX03 on the number of neutrophils in the intestine of zebrafish is as Figure 3 shown in Table 5.

[0082] From Figure 3 and Table 5, it can be seen that compared with the normal group, the number of neutrophils in the intestine of zebrafish in the model group increased extremely significantly (P < 0.001), indicating that the zebrafish enteritis model was successfully constructed this time. Compared with the model group, the number of neutrophils in the intestine of zebrafish in the positive group decreased extremely significantly (P < 0.001), which was consistent with the clinical results, indicating that this experiment was effective. Compared with the model group, the number of neutrophils in the intestine of zebrafish in the 10 4 CFU / mL, 10 5 CFU / mL and 10 6 CFU / mL Lactobacillus rhamnosus ZX03 groups decreased extremely significantly (P < 0.001).

[0083] Table 5 Statistical table of the effect of Lactobacillus rhamnosus ZX03 on the number of neutrophils (n = 6)

[0084]

[0085]

[0086] (2) Effect of Lactobacillus rhamnosus ZX03 on the number of macrophages in the intestine of zebrafish

[0087] Based on the above test method, the effect of Lactobacillus rhamnosus ZX03 on the number of intestinal macrophages in zebrafish is as Figure 4 shown in Table 6.

[0088] The fluorescence intensity of intestinal macrophages is proportional to the number of macrophages. From Figure 4 Table 6, it can be seen that compared with the normal group, the number of intestinal macrophages in zebrafish in the model group increased extremely significantly (P < 0.001), indicating that the intestinal inflammation model of zebrafish was successfully established in this experiment. Compared with the model group, the number of intestinal macrophages in zebrafish in the positive group decreased extremely significantly (P < 0.001), which was consistent with the clinical results, indicating that this experiment was effective. Compared with the model group, the number of intestinal macrophages in zebrafish in the Lactobacillus rhamnosus ZX03 groups of 10 4 CFU / mL, 10 5 CFU / mL, and 10 6 CFU / mL decreased extremely significantly (P < 0.001).

[0089] Table 6 Statistical table of the effect of Lactobacillus rhamnosus ZX03 on the number of intestinal macrophages in zebrafish (n = 6)

[0090]

[0091] (3) Effect of Lactobacillus rhamnosus ZX03 on intestinal peristalsis in zebrafish

[0092] Based on the above test method, the effect of Lactobacillus rhamnosus ZX03 on intestinal peristalsis in zebrafish is as Figure 5 shown in Table 7.

[0093] The Nile red fluorescence intensity in the zebrafish intestine is inversely proportional to the intestinal peristalsis speed. From Figure 5 Table 7, it can be seen that compared with the normal group, the Nile red fluorescence intensity in the zebrafish intestine in the model group decreased extremely significantly (P < 0.001), indicating that the intestinal peristalsis speed of zebrafish increased, indicating that the intestinal inflammation and diarrhea model of zebrafish was successfully established in this experiment. Compared with the model group, the Nile red staining fluorescence intensity in the zebrafish intestine in the positive group increased extremely significantly (P < 0.001), indicating that this experiment was effective. Compared with the model group, the Nile red staining fluorescence intensity in the zebrafish intestine in the Lactobacillus rhamnosus ZX03 groups of 10 4 CFU / mL, 10 5 CFU / mL, and 10 6 CFU / mL all increased extremely significantly (P < 0.001).

[0094] Table 7 Statistical table of the effect of Lactobacillus rhamnosus ZX03 on intestinal peristalsis in zebrafish (n = 6)

[0095]

[0096]

[0097] (4) Effect of Lactobacillus rhamnosus ZX03 on the intestinal tissue of zebrafish

[0098] Based on the above test method, the effect of Lactobacillus rhamnosus ZX03 on the intestinal tissue of zebrafish is as Figure 6 shown.

[0099] It can be Figure 6 seen that compared with the normal group, the number of intestinal villi in the zebrafish of the model group decreased, the height decreased, and the secretion of acidic mucin increased. Compared with the model group, the number and height of intestinal villi in the zebrafish of the positive group increased, and the secretion of acidic mucin decreased significantly. Compared with the model group, there were no obvious changes in the number, height of intestinal villi and the secretion of acidic mucin in the zebrafish of the 10 4 CFU / mL Lactobacillus rhamnosus ZX03 group; the number and height of intestinal villi in the zebrafish of the 10 5 CFU / mL Lactobacillus rhamnosus ZX03 group increased, and the secretion of acidic mucin decreased significantly; the number and height of intestinal villi in the zebrafish of the 10 6 CFU / mL Lactobacillus rhamnosus ZX03 group increased significantly, and the secretion of acidic mucin decreased significantly, similar to the normal group.

[0100] (5) Effect of Lactobacillus rhamnosus ZX03 on the hyaluronic acid content in zebrafish

[0101] Based on the above test method, the effect of Lactobacillus rhamnosus ZX03 on the hyaluronic acid content in zebrafish is as Figure 7 shown in Table 8.

[0102] It can be Figure 7 seen from Table 8 that compared with the normal group, the hyaluronic acid content in the zebrafish of the model group decreased extremely significantly (P<0.001). Compared with the model group, the hyaluronic acid content in the zebrafish of the positive group increased extremely significantly (P<0.001). Compared with the model group, the hyaluronic acid content in the zebrafish of the 10 4 CFU / mL, 10 5 CFU / mL and 10 6 CFU / mL Lactobacillus rhamnosus ZX03 groups all increased extremely significantly (P<0.001).

[0103] Table 8 Statistical table of the effect of Lactobacillus rhamnosus ZX03 on the hyaluronic acid content in zebrafish (n = 6)

[0104]

[0105] (6) Effect of Lactobacillus rhamnosus ZX03 on the tyrosinase activity in zebrafish

[0106] Based on the above test method, the effect of Lactobacillus rhamnosus ZX03 on tyrosinase activity in zebrafish is as Figure 8 shown in Table 9.

[0107] From Figure 8 Table 9, it can be seen that compared with the normal group, the tyrosinase activity in zebrafish of the model group increased extremely significantly (P < 0.001). Compared with the model group, the tyrosinase activity in zebrafish of the positive group decreased extremely significantly (P < 0.001). Compared with the model group, the tyrosinase activity in zebrafish of the Lactobacillus rhamnosus ZX03 groups at 10 4 CFU / mL, 10 5 CFU / mL and 10 6 CFU / mL all decreased significantly (P < 0.01).

[0108] Table 9 Statistical table of the effect of Lactobacillus rhamnosus ZX03 on tyrosinase activity in zebrafish (n = 6)

[0109]

[0110] In summary, Lactobacillus rhamnosus ZX03 at concentrations of 10 4 CFU / mL, 10 5 CFU / mL and 10 6 CFU / mL can reduce the aggregation of neutrophils and macrophages in the zebrafish intestine, inhibit the intestinal peristalsis of zebrafish, increase the hyaluronic acid content in zebrafish, decrease the tyrosinase activity, and at concentrations of 10 5 CFU / mL and 10 6 CFU / mL, can protect the intestinal tissue of zebrafish. The above test results indicate that Lactobacillus rhamnosus ZX03 has an antidiarrheal effect.

[0111] The above has described the embodiments of the present invention in detail, but the present invention is not limited to the described embodiments. For those skilled in the art, without departing from the principles and spirit of the present invention, various changes, modifications, substitutions and variations made to these embodiments still fall within the protection scope of the present invention.

Claims

1. A strain of Lacticaseibacillus rhamnosus ZX03, characterized in that, The Lactobacillus rhamnosus ZX03 strain was isolated from the feces of a healthy infant in Guangzhou, Guangdong Province, and its deposit number is CCTCC NO: M 20242114.

2. A strain of Lacticaseibacillus rhamnosus ZX03 strain according to claim 1, characterized in that, The 16S rDNA of the Lactobacillus rhamnosus ZX03 strain is as shown in SEQ ID No:

1.

3. Use of the Lactobacillus rhamnosus ZX03 strain according to claim 1 or 2 in the preparation of an antidiarrheal product.

4. The application according to claim 3, wherein The antidiarrheal product is applicable to diarrhea caused by inflammatory bowel disease.

5. The application according to claim 3, wherein The antidiarrheal effect is to reduce the aggregation of neutrophils and macrophages in the intestine, inhibit intestinal peristalsis; and / or increase the content of hyaluronic acid in the body, reduce the activity of tyrosinase, and protect intestinal tissues.

6. The application according to claim 3, wherein The product includes a medicament or feed.

7. A probiotic agent, characterized in that, The bacterial agent uses the Lactobacillus rhamnosus ZX03 strain according to claim 1 or 2 as the main active ingredient.

8. A probiotic agent according to claim 7, characterized in that, In the said microbial agent, the number of ZX03 strain is not less than 10 5 CFU / mL.

9. A probiotic agent according to claim 7, characterized in that, The bacterial agent also includes excipients acceptable in the pharmaceutical or feed field.

Images