Lactobacillus reuteri ShuiMian with sleep aiding effect and application of lactobacillus reuteri ShuiMian

Abstract

The invention belongs to the technical field of probiotics, and particularly relates to lactobacillus reuteri ShuiMian with a sleep aiding effect and application of the lactobacillus reuteri ShuiMian. A new ShuiMian strain is separated from feces of a healthy infant in Guangzhou city, Guangdong province, PTZ is adopted to construct a zebra fish insomnia model, and research finds that the strain can inhibit eye movement frequency, inhibit brain discharge, reduce dopamine secretion, promote GABA secretion and promote Gabra gene expression, and the zebra fish insomnia model can be used for treating insomnia. The effect of promoting sleep is achieved. Therefore, the strain has a unique sleep-promoting mechanism, can assist in developing novel sleep-promoting medicines in the field of medicines, and provides a safer and more effective treatment scheme for insomnia patients. In the health care industry, a nutritional supplement can be prepared, the mass sleep quality is improved, and the development of sleep health related industries is promoted.

Description

Technical Field

[0001] The present invention belongs to the technical field of probiotics, and particularly relates to a Lactobacillus mucosae Royae ShuiMian with sleep-promoting efficacy and its application. Background Art

[0002] The term "probiotics" originated from Greek. With the in-depth understanding of probiotics, keywords such as regulating the intestinal flora, indigenous bacteria, live microorganisms, and viable cell count have been incorporated into the concept of probiotics. Currently, the widely accepted definition of probiotics by the Food and Agriculture Organization of the United Nations / World Health Organization is that when administered in sufficient amounts, they are live microorganisms that are beneficial to the host. In recent years, probiotic cells and their lysates have also been proven to provide beneficial effects to the human body.

[0003] With the continuous development and progress of society, the phenomenon of insomnia caused by irregular lifestyles and various pressures in life, study, and work is increasing. Insomnia can affect an individual's work and study efficiency and quality of life. In severe cases, symptoms such as anxiety and depression may also occur. Therefore, high-quality sleep plays an extremely important role in the physical and mental health of the human body. Currently, drugs such as sedative-hypnotics and melatonin used to treat insomnia are likely to have an impact on the body when taken for a long time and have a certain degree of dependence. Most probiotics are beneficial microorganisms isolated from the human body or nature, do not cause drug dependence, have a small burden on the body, and are suitable for a wide range of people. Accordingly, in recent years, researchers have also started to explore the use of probiotics to improve insomnia. The main ways for probiotics to improve insomnia include: (1) directly changing the abundance and species diversity of the intestinal microbiota, restoring the disorder of the intestinal microbiota caused by insomnia disorder, and then playing a biological role in regulating insomnia by restoring the intestinal flora homeostasis; (3) indirectly regulating the function of the gut-brain axis by regulating the functions of certain special flora in the intestine, such as secreting SCFAs and metabolizing bile salts, thereby improving the symptoms of insomnia patients. However, probiotics have strain specificity. Not all probiotic strains have the effect of promoting sleep, and different probiotic strains may also have different sleep-promoting mechanisms.

[0004] Limosilactobacillus reuteri belongs to the family Lactobacillaceae and is a Gram-positive bacterium that widely exists in nature, such as in the human gastrointestinal tract, oral cavity, breast milk, and various fermented foods. In recent years, the research on Limosilactobacillus reuteri has gradually increased, and it has been found to have various unique biological characteristics and probiotic functions. For example, Limosilactobacillus reuteri can produce a unique antibacterial substance - reuterin, which has broad-spectrum antibacterial activity and can inhibit various pathogenic bacteria such as Escherichia coli and Staphylococcus aureus, helping to maintain the balance of the intestinal microecology. At the same time, studies have shown that Limosilactobacillus reuteri also has potential probiotic effects in regulating the immune system, improving intestinal barrier function, and reducing cholesterol levels. However, the current research on Limosilactobacillus reuteri is still in a relatively preliminary stage, and there are relatively few studies on the application of Limosilactobacillus reuteri in promoting sleep. It is necessary to further explore more Limosilactobacillus reuteri strains that are helpful for sleep to enrich the application of this bacterium in this field.

[0005] In summary, based on the problems of the widespread insomnia phenomenon and the lack of safe treatment methods, combined with the fact that the probiotic characteristics of probiotics vary at the strain level, and there are differences in the efficacy and action mechanisms of different strains of the same species of probiotics, screening and obtaining probiotic strains with outstanding sleep-promoting effects and clear action mechanisms is still the difficulty and focus of current research. Summary of the Invention

[0006] In order to overcome the above deficiencies of the prior art, the present invention isolated a new strain of Limosilactobacillus reuteri ShuiMian from the feces of a healthy infant in Guangzhou City, Guangdong Province. This strain can promote sleep through multiple pathways and can be used to develop new sleep-aid products, improve the quality of life of patients with sleep disorders, and has great application value in the fields of medical care and sleep research.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] The first aspect of the present invention provides a strain of Limosilactobacillus reuteri ShuiMian, which is isolated from the feces of a healthy infant in Guangzhou City, Guangdong Province, and its preservation number is CCTCC NO: M 20242206.

[0009] Preferably, the 16S rDNA of Limosilactobacillus reuteri strain ShuiMian is as shown in SEQ ID No: 1.

[0010] In a second aspect of the present invention, there is provided the use of the Limosilactobacillus reuteri strain ShuiMian in the preparation of a sleep aid product.

[0011] Preferably, the sleep aid product is suitable for relieving acute insomnia.

[0012] Preferably, the Limosilactobacillus reuteri strain ShuiMian exerts a sleep-promoting effect by inhibiting the eye movement frequency, inhibiting brain discharges, reducing dopamine secretion, promoting GABA secretion, and promoting Gabra gene expression.

[0013] Preferably, the product comprises a drug or a nutritional supplement.

[0014] In a third aspect of the present invention, there is provided a probiotic agent, which uses the Limosilactobacillus reuteri strain ShuiMian as the main active ingredient.

[0015] Preferably, in the agent, the number of strain ShuiMian is not less than 10 5 CFU / mL.

[0016] Preferably, the agent further comprises excipients acceptable in the pharmaceutical or nutritional field.

[0017] Preferably, the agent of the present invention can be a liquid agent or a solid agent, and can be prepared by adding excipients permitted in the field of microbial preparations by conventional technical means.

[0018] Compared with the prior art, the beneficial effects of the present invention are:

[0019] A new Limosilactobacillus reuteri ShuiMian strain was isolated from the feces of a healthy infant in Guangzhou, Guangdong Province. Through the study of constructing a zebrafish insomnia model using PTZ, it was found that this bacterium can inhibit the eye movement frequency, inhibit brain electrical discharge, reduce dopamine secretion, promote GABA secretion, and promote Gabra gene expression, and has the effect of promoting sleep. It shows that the ShuiMian strain can promote sleep through multiple aspects. First, inhibiting the eye movement frequency can reduce the transmission of external visual stimuli to the brain and make the brain tend to be calm; inhibiting brain electrical discharge can stabilize brain nerve activities and avoid overexcitation; reducing dopamine secretion can reduce the excitatory feeling of the body and make people more likely to enter a relaxed state; as an inhibitory neurotransmitter, promoting GABA secretion and Gabra gene expression can enhance the effect of GABA, further inhibit the nerve activities of the brain, reduce the signal transmission between neurons, make the brain in a quiet state, and help the body enter a good sleep state. It can be seen that this strain has a unique sleep-promoting mechanism, which can help develop new sleep-aid drugs in the medical field and provide a safer and more effective treatment plan for insomnia patients. In the health care industry, it can be made into nutritional supplements to improve the sleep quality of the public and promote the development of the sleep health-related industry. Description of the Drawings

[0020] Figure 1 Phylogenetic tree of Limosilactobacillus reuteri ShuiMian strain (the strains for tree construction are from the Genome database of NCBI);

[0021] Figure 2 Effect of Limosilactobacillus reuteri ShuiMian strain on the tail swing trajectory of zebrafish insomnia model;

[0022] Figure 3 Effect of Limosilactobacillus reuteri ShuiMian strain on the angular velocity of tail swing of zebrafish insomnia model;

[0023] Figure 4 Effect of Limosilactobacillus reuteri ShuiMian strain on the eye movement frequency of zebrafish insomnia model;

[0024] Figure 5 Effect of Limosilactobacillus reuteri ShuiMian strain on PTZ-induced brain electrical discharge in zebrafish;

[0025] Figure 6 Effect of Limosilactobacillus reuteri ShuiMian strain on the contents of dopamine (A) and GABA (B) in zebrafish;

[0026] Figure 7Statistical chart of the effect of Limosilactobacillus reuteri strain Shuimian on the relative content expression of Gabra in zebrafish (n = 3). Detailed implementation manners

[0027] The following further describes the detailed implementation manners of the present invention. It should be noted here that the description of these implementation manners is used to help understand the present invention, but does not constitute a limitation on the present invention. In addition, the technical features involved in the various implementation manners of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0028] The experimental methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples are all available through conventional commercial channels unless otherwise specified.

[0029] In the following examples, the E3 culture water is prepared as follows: Weigh 11.7 g of sodium chloride, 0.506 g of potassium chloride, 1.465 g of anhydrous magnesium sulfate, and 1.584 g of anhydrous calcium chloride, mix them, add an appropriate amount of pure water and stir evenly, then add an appropriate amount of pure water to dilute to 4 L to obtain 10×E3 culture water. Store at room temperature for no more than 7 days (the reagents used for preparation are all analytical pure reagents, all purchased from Macklin, and the conductivity of pure water should be less than or equal to 10 us / cm). When in use, measure 400 mL of the 10×E3 culture water prepared in the previous step into a suitable container, and add 3.6 L of pure water and stir evenly.

[0030] In the following examples, the bacterial solution, the drugs used in the positive group, and the drugs used for establishing the model are all diluted to the corresponding concentrations with E3 culture water.

[0031] Example 1: Limosilactobacillus reuteri strain Shuimian

[0032] The Limosilactobacillus reuteri strain Shuimian was isolated from the feces of a healthy infant in Guangzhou, Guangdong Province. The specific method is as follows:

[0033] Collect fresh feces using a 50 mL sterile centrifuge tube, transport it to the laboratory under cold chain, and after surface disinfection, transfer the sample to a biosafety cabinet. Add an appropriate amount of sterile water according to the fecal mass for full dissolution (usually 100 mg of feces plus 800 μL - 1 mL of sterile water), take an appropriate amount of the sample and spread it on an MRS culture plate, and culture it at 37 °C in an anaerobic workstation. After 48 h, pick a single colony and inoculate it onto a new MRS culture plate, and culture it in the anaerobic workstation for 24 h. Refer to the "Bergey's Manual of Determinative Bacteriology" (8th Edition) and the "Manual of Fungal Taxonomy and Identification", and observe the growth status of the colonies. Name the purified and isolated strain, numbered ShuiMian. The growth status of this strain is that the colony is round, with a smooth surface, regular edges, and is milky white and opaque.

[0034] Expand the culture of the isolated ShuiMian strain. After molecular identification of the ShuiMian strain using the 16S rDNA universal primers (27F: AGAGTTTGATCCTGGCTCAG; 1492R: TACGGCTACCTTGTTACGACTT), 16S sequencing was performed by Genewiz Biotechnology Co., Ltd., and the obtained 16S rDNA sequence (SEQ ID No: 1) was subjected to BLAST alignment in the Genome database of NCBI. The results showed that the homology of the ShuiMian strain with the known 16S rDNA sequence of Limosilactobacillus reuteri > 99%, and a phylogenetic tree was constructed with homologous strains for analysis ( Figure 1 ), confirming that the ShuiMian strain is a different strain of the same species of Limosilactobacillus reuteri.

[0035] Finally, preserve the ShuiMian strain. The preservation information is as follows: Preservation time: October 14, 2024; Name of the preservation unit: China Center for Type Culture Collection (CCTCC); Preservation number: CCTCC NO: M 20242206; Address of the preservation unit: Wuhan University, Wuhan, China; Taxonomic name: Limosilactobacillus reuteri.

[0036] Limosilactobacillus reuteri ShuiMian 16S rDNA sequence (1457 bp, SEQ IDNo: 1):

[0037]

[0038] Example 2: Study on the probiotic function of Limosilactobacillus reuteri ShuiMian strain

[0039] Zebrafish have a similar nervous system to mammals. Most of the molecules and cell populations (monoaminergic, cholinergic, hypocretinergic) that play a role in sleep regulation in mammals are similar in zebrafish. Gamma-aminobutyric acid (GABA) is a naturally occurring non-protein amino acid and an important inhibitory neurotransmitter in the mammalian central nervous system, which has a sleep-promoting effect. Pentylenetetrazol (PTZ) is a GABA inhibitor. A small dose of PTZ can induce bipolar disorder with both mania and depression, thus causing insomnia. Therefore, in this test, PTZ was used to construct an insomnia model (acute insomnia model), and the sleep-promoting effect of Limosilactobacillus reuteri ShuiMian strain was evaluated by detecting the behavioral changes and brain electrical activity of zebrafish.

[0040] 1. Experimental materials

[0041] 1.1 Test system

[0042] The zebrafish used in this test were AB strain zebrafish and zebrafish embryos labeled with Elavl3:H2B-GCaMP6f, purchased from Nanjing Yishulihua Biotechnology Co., Ltd.

[0043] 1.2 Reagents and materials

[0044] Table 1 Reagents and materials

[0045]

[0046] 1.3 Main equipment

[0047] Table 2 Instrument equipment

[0048]

[0049] 1.4 Information of test samples

[0050] In this test, there was a total of 1 test sample, and the details are shown in Table 3.

[0051] Table 3 Information of test samples

[0052]

[0053] 2. Experimental methods

[0054] 2.1 Detection of behavior

[0055] Select healthy zebrafish embryos (AB strain) at 3 dpf (days post fertilization) after fertilization and randomly place them in a cell culture plate. The experiment sets up a normal group, a model group (PTZ), a positive control group (melatonin), a 1×10 4 CFU / mL Lactobacillus mucosae ShuiMian group, a 1×10 5 CFU / mL Lactobacillus mucosae ShuiMian group, a 1×10 6 CFU / mL Lactobacillus mucosae ShuiMian group; 5 fish in each group.

[0056] Add zebrafish E3 culture water to the normal group and the model group (PTZ); add 1 μM melatonin solution (the solvent is DMSO) to the positive control group; add 1×10 4 CFU / mL Lactobacillus mucosae ShuiMian group to 1×10 4 CFU / mL Lactobacillus mucosae ShuiMian solution; add 1×10 5 CFU / mL Lactobacillus mucosae ShuiMian group to 1×10 5 CFU / mL Lactobacillus mucosae ShuiMian solution; add 1×10 6 CFU / mL Lactobacillus mucosae ShuiMian group to 1×10 6 CFU / mL Lactobacillus mucosae ShuiMian solution; add 5 mL of solution to each well; replace the new solution every 24 h; incubate at 28.5 °C for 4 days.

[0057] After the incubation, place the zebrafish in a microfluidic chip. Inject zebrafish E3 culture water into the normal group; inject 3 mM PTZ solution into the remaining groups. After incubating for 10 min, place it under a microscope to record the tail swing movement trajectory of the zebrafish within 10 min, and calculate the tail swing angular velocity and eye movement frequency of the zebrafish.

[0058] 2.2. Detection of brain discharge

[0059] Select healthy zebrafish embryos (Elavl3:H2B-GCaMP6f) at 3 dpf after fertilization and randomly place them in a cell culture plate. The experiment sets up a normal group, a model group (PTZ), a positive control group (melatonin), a 1×10 4 CFU / mL Lactobacillus mucosae ShuiMian group, a 1×10 5 CFU / mL Lactobacillus mucosae ShuiMian group, a 1×10 6 CFU / mL Lactobacillus mucosae ShuiMian group. 5 fish in each group.

[0060] The normal group and the model group (PTZ) were added with zebrafish E3 culture water; the positive control group was added with 1 μM melatonin solution; 1×10 4 CFU / mL Lactobacillus mucosae ShuiMian group was added with 1×10 4 CFU / mL Lactobacillus mucosae ShuiMian solution; 1×10 5 CFU / mL Lactobacillus mucosae ShuiMian group was added with 1×10 5 CFU / mL Lactobacillus mucosae ShuiMian solution; 1×10 6 CFU / mL Lactobacillus mucosae ShuiMian group was added with 1×10 6 CFU / mL Lactobacillus mucosae ShuiMian solution; 5 mL of solution was added to each well; the fresh solution was replaced every 24 h; and it was incubated at 28.5 °C for 4 days.

[0061] After incubation, the zebrafish were placed in a microfluidic chip. The normal group was injected with zebrafish E3 culture water; the remaining groups were injected with 3 mM PTZ solution (incubated for 10 min), and then placed under a fluorescence microscope to record the brain discharge of zebrafish before and after PTZ solution intervention. The difference in calcium transient counts before and after PTZ intervention was calculated and projected onto a two-dimensional surface (by summing along the Z-axis) to construct a brain activity map (BAM) of zebrafish. BAMs were obtained from five individual zebrafish, and then the T-score brain activity map (T-score BAM) of zebrafish in each group was calculated.

[0062] 2.3. Effects on dopamine and γ-aminobutyric acid (GABA) in zebrafish

[0063] (1) Experimental grouping: control group, model group, positive control group (melatonin), 10 4 CFU / mL, 10 5 CFU / mL, 10 6 CFU / mL Lactobacillus mucosae ShuiMian group.

[0064] (2) Model construction and intervention: Wild-type zebrafish at 3 dpf were randomly selected and placed in a 6-well cell culture plate. 4 mL of the corresponding solution of each group was added to each well and marked. The normal group was added with E3 culture water, the model group was added with 2 mM PTZ solution, the positive group was added with 1 μM melatonin solution, and the ShuiMian group was added with the ShuiMian bacterial solution of the corresponding concentration, and incubated in an incubator at 28.5 °C for 96 h.

[0065] (3) Detection of dopamine and GABA contents: After the intervention, the zebrafish were collected into centrifuge tubes and homogenized with PBS. After homogenization, the supernatant was obtained by centrifugation, and the dopamine and GABA contents were detected by LC-MS / MS method.

[0066] 2.4. Effects on the relative content of Gabra in zebrafish

[0067] (1) Experimental grouping: control group, model group, positive control group (melatonin), 10 4 CFU / mL, 10 5 CFU / mL, 10 6 CFU / mL Lactobacillus reuteri ShuiMian group.

[0068] (2) Model construction and intervention: Randomly select wild-type zebrafish at 3 dpf and place them in 6-well cell culture plates. Add 4 mL of the corresponding solution for each group to each well and make marks. Add E3 culture water to the normal group, 2 mM PTZ solution to the model group, 1 μM melatonin solution to the positive group, and the corresponding concentration of ShuiMian bacterial solution to the ShuiMian group. Incubate in an incubator at 28.5 °C for 96 h.

[0069] (3) qPCR detection: After the intervention, the zebrafish were collected into centrifuge tubes, ground, RNA was extracted, and after reverse transcription into cDNA, qPCR detection was carried out. The gene primer sequences are shown in Table 4:

[0070] Table 4 Gene sequence primers

[0071]

[0072] 2.5. Data statistics

[0073] The experimental data are all expressed as mean ± SEM, and analyzed by t-test. Compared with the normal group: # P < 0.05, ## P < 0.01, ### P < 0.001; compared with the model group: & P < 0.05, && P < 0.01, &&& P < 0.001. Analyzed by one-way ANOVA, compared with the model group: * P < 0.05, ** P < 0.01, *** P < 0.001.

[0074] 3. Experimental results: The sleep improvement effect of Lactobacillus reuteri ShuiMian strain on the zebrafish insomnia model

[0075] As Figure 2 ,Figure 3 , Figure 4 As shown in Table 5 and Table 6, the green and red areas are the areas covered by the tail swing trajectories of zebrafish; compared with the normal group, the area of the tail swing trajectory of zebrafish in the model group increased, indicating an increase in the activity level of zebrafish in the model group. At the same time, compared with the normal group (tail swing angular velocity: 0.196±0.013 rad / s, eye movement frequency: 9.717±1.006 times / min), the tail swing angular velocity (0.337±0.023 rad / s) and eye movement frequency (19.817±1.130 times / min) of zebrafish in the model group were both significantly increased (p<0.001), indicating that the zebrafish insomnia model was successfully established this time.

[0076] Compared with the model group, the area of the tail swing trajectory of zebrafish in the positive control group (melatonin) decreased, indicating that melatonin can reduce the activity level of zebrafish in the PTZ-induced zebrafish insomnia model. At the same time, the tail swing angular velocity and eye movement frequency of zebrafish in the positive control group were 0.205±0.011 rad / s and 12.017±0.867 times / min respectively, and there were significant differences compared with the model group (tail swing angular velocity: 0.337±0.023 rad / s, eye movement frequency: 19.817±1.130 times / min) (P<0.001). Therefore, melatonin has a sleep-promoting effect, indicating that the evaluation of sleep promotion this time is effective.

[0077] Compared with the model group, the 1×10 5 CFU / mL Limosilactobacillus reuteri ShuiMian group and the 1×10 6 CFU / mL Limosilactobacillus reuteri ShuiMian group both had a reduced area of the tail swing trajectory of zebrafish, indicating that Limosilactobacillus reuteri ShuiMian can reduce the activity level of zebrafish in the PTZ-induced zebrafish insomnia model. At the same time, compared with the model group (tail swing angular velocity: 0.337±0.023 rad / s, eye movement frequency: 19.817±1.130 times / min), the 1×10 5 CFU / mL Limosilactobacillus reuteri ShuiMian group (tail swing angular velocity: 0.252±0.010 rad / s, eye movement frequency: 14.367±0.919 times / min) and the 1×10 6 CFU / mL Limosilactobacillus reuteri ShuiMian group (tail swing angular velocity: 0.226±0.013 rad / s, eye movement frequency: 12.683±0.498 times / min) had significant decreases in both the tail swing angular velocity and eye movement frequency of zebrafish (p<0.05), indicating that Limosilactobacillus reuteri ShuiMian strain has a sleep-promoting effect.

[0078] Further, Tg(Elavl3:H2B-GCaMP6f) zebrafish were used to investigate the effect of Lactobacillus johnsonii ShuiMian strain on the brain discharge of zebrafish. As Figure 5 shown, the blue area is the area where there is no brain discharge in zebrafish, and the yellow area is the area where there is brain discharge in zebrafish. Compared with the normal group, the area of the brain discharge region of zebrafish in the model group (PTZ) increased significantly, indicating that PTZ can promote brain discharge in zebrafish, that is, induce zebrafish excitement. Compared with the model group, the area of the brain discharge region of zebrafish in the positive control group (melatonin) decreased significantly, indicating that melatonin can inhibit PTZ-induced brain discharge in zebrafish, that is, it has a sleep-promoting effect. Compared with the model group, the area of the brain discharge region of zebrafish in the 1×10 5 CFU / mL Lactobacillus reuteri ShuiMian group and 1×10 6 CFU / mL Lactobacillus reuteri ShuiMian group decreased significantly, indicating that Lactobacillus reuteri ShuiMian strain can also inhibit PTZ-induced brain discharge in zebrafish, that is, it has a sleep-promoting effect.

[0079] Further investigate the effect of ShuiMian strain on dopamine and γ-aminobutyric acid (GABA) in zebrafish. As Figure 6 shown in and Table 7, compared with the normal group, the dopamine content in zebrafish in the model group increased extremely significantly, and the GABA content decreased extremely significantly (P<0.001). Compared with the model group, the dopamine content in zebrafish in the positive group decreased significantly (P<0.01), and the GABA content increased extremely significantly (P<0.001). Compared with the model group, the dopamine content in zebrafish in the 10 5 CFU / mL and 10 6 CFU / mL Lactobacillus reuteri ShuiMian groups decreased and had statistical differences (P<0.001). The GABA content in the 10 4 CFU / mL, 10 5 CFU / mL and 10 6 CFU / mL Lactobacillus reuteri ShuiMian groups increased extremely significantly (P<0.001).

[0080] Further investigate the effect of ShuiMian strain on the relative content of Gabra in zebrafish. As Figure 7 shown in and Table 8, compared with the normal group, the relative content of Gabra in zebrafish in the model group decreased extremely significantly (P<0.001). Compared with the model group, the relative content of Gabra in zebrafish in the positive group increased extremely significantly (P<0.001), and the relative content of Gabra in zebrafish in the 10 4 CFU / mL, 10 5 CFU / mL and 10 6The relative content of Gabra in zebrafish in the Lactobacillus casei paracasei MY01 group at CFU / mL was extremely significantly increased (P<0.001).

[0081] Table 5 Statistical table of the effect of Lactobacillus mucosae ShuiMian strain on the tail swing angular velocity of the zebrafish insomnia model (n = 6)

[0082]

[0083]

[0084] Table 6 Statistical table of the effect of Lactobacillus mucosae ShuiMian strain on the eye movement frequency of the zebrafish insomnia model (n = 6)

[0085]

[0086] Table 7 Statistical table of the effect of Lactobacillus mucosae ShuiMian strain on the contents of dopamine (A) and GABA (B) in zebrafish

[0087]

[0088] Table 8 Statistical table of the effect of Lactobacillus mucosae ShuiMian strain on the relative content of Gabra in zebrafish (n = 3)

[0089]

[0090] In summary, it can be seen that the Lactobacillus mucosae ShuiMian group can inhibit the tail swing angular velocity and eye movement frequency of zebrafish, inhibit brain discharge, reduce dopamine secretion, promote GABA secretion, and promote the expression of the Gabra gene at concentrations of 10 5 CFU / mL and 10 6 CFU / mL. The above results indicate that the Lactobacillus mucosae ShuiMian strain has the effect of promoting sleep.

[0091] The above has described the embodiments of the present invention in detail, but the present invention is not limited to the described embodiments. For those skilled in the art, without departing from the principle and spirit of the present invention, various changes, modifications, substitutions, and variations made to these embodiments still fall within the protection scope of the present invention.

Claims

1. A Limosilactobacillus reuteri ShuiMian strain, characterized in that, The Limosilactobacillus reuteri strain ShuiMian was isolated from the feces of a healthy infant in Guangzhou, Guangdong Province, and its preservation number is CCTCC NO: M 20242206.

2. A Limosilactobacillus reuteri ShuiMian strain according to claim 1, characterized in that, The 16S rDNA of the Limosilactobacillus reuteri strain ShuiMian is as shown in SEQ ID No:

1.

3. Use of the Limosilactobacillus reuteri strain ShuiMian according to claim 1 or 2 in the preparation of a sleep-aid product.

4. The application according to claim 3, characterized in that, The sleep-aid product is suitable for relieving acute insomnia.

5. The application according to claim 3, characterized in that, The Limosilactobacillus reuteri strain ShuiMian exerts a sleep-promoting effect by inhibiting the eye movement frequency, inhibiting brain electrical discharge, reducing dopamine secretion, promoting GABA secretion, and promoting Gabra gene expression.

6. The application according to claim 3, characterized in that The product includes a drug or a nutritional supplement.

7. A probiotic agent, characterized in that, The bacterial agent uses the Limosilactobacillus reuteri strain ShuiMian according to claim 1 or 2 as the main active ingredient.

8. A probiotic agent according to claim 7, wherein In the said microbial agent, the number of ShuiMian strains is not less than 10 5 CFU / mL.

9. A probiotic agent according to claim 7, characterized in that, The bacterial agent also includes excipients acceptable in the pharmaceutical or nutritional field.

Images