Actinobacillus pleuropneumoniae delta nrdG gene deleted strain as well as construction and application thereof
By constructing the ΔnrdG gene deletion strain of Actiobacter pleuropneumoniae, the problems of antibiotic resistance and high vaccine cost in the prior art were solved, and a high safety and low-cost vaccine development was achieved, which could stimulate an effective immune response in a low-oxygen environment.
Patent Information
- Application Number
- CN202510461597.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-14
- Publication Date
- 2025-07-11
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
In the prior art, antibiotics have increased drug resistance to treating infectious pleuropneumonia in pigs, the cross-protection effect of inactivated vaccines is poor, the cost of subunit vaccines is high, and the development of gene deletion vaccines has not yet fully utilized the key factors of Actinobacter pleuropneumonia in a hypoxic environment.
The ΔnrdG gene deletion strain of Actiobacter pleuropneumoniae was constructed, and the homologous recombinant arm was amplified by designing primers, the recombinant plasmid was constructed and engaging and transferring were performed to obtain the ΔnrdG gene deletion strain for vaccine preparation.
It achieves a balance of safety and effectiveness, can stimulate immune responses in a hypoxic environment, distinguish between natural infection and vaccine infection, and has the advantages of high safety, low cost and ease of use.
Smart Images

Figure CN120290444A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a method for constructing an Actinobacillus pleuropneumoniae ΔnrdG gene deletion strain and its application. Background Art
[0002] Porcine Contagious Pleuropneumonia (PCP) is an acute and highly contagious respiratory disease caused by Actinobacillus pleuropneumoniae (APP). During an acute outbreak, the incidence rate can reach 80 - 100%, and the mortality rate can be as high as 20 - 100%. Chronic infection will lead to slow growth and a decline in feed conversion rate, and it is susceptible to all age groups. With the popularization of intensive farming models, PCP has shown a global epidemic trend. The direct economic losses caused by it include acute death, chronic growth retardation, and a significant increase in treatment and prevention costs, posing a serious threat to the sustainable development of the pig industry.
[0003] APP belongs to the genus Actinobacillus of the family Pasteurellaceae. It is a Gram-negative, non-spore-forming, capsulated pleomorphic coccobacillus. APP is a facultative anaerobe that can grow under aerobic and microaerophilic conditions, which enables it to adapt to different microenvironments within the host.
[0004] Currently, the prevention and control of PCP mainly rely on antibiotic treatment and vaccination. In terms of antibiotic treatment, the resistance rate of APP to commonly used antibiotics shows a significant upward trend, and the drug resistance situation is particularly severe. In terms of vaccination, commonly used vaccines include inactivated vaccines, subunit vaccines, and gene deletion vaccines, etc. Inactivated vaccines are simple to prepare, but have poor cross-protection effects. Subunit vaccines mainly target specific virulence factors (such as Apx toxins), but have high production costs. Gene deletion vaccines have received extensive attention due to their good safety and immune effects.
[0005] The nrdG gene encodes anaerobic ribonucleotide reductase activating enzyme (NrdG), which together with NrdD constitutes the anaerobic ribonucleotide reductase (RNR) system. This system catalyzes the reduction of ribonucleoside diphosphates (NDPs) to deoxyribonucleoside diphosphates (dNDPs) under strictly anaerobic conditions, providing essential precursors for bacterial DNA synthesis. Although APP is a facultative anaerobe, its nrdG gene plays a key role in the hypoxic microenvironment of lung infection foci. In the necrotic core area of lung lesions, the oxygen concentration is extremely low (O2 < 1%), and APP relies on the NrdG-NrdD system to maintain DNA synthesis and proliferation. Therefore, the nrdG gene is a key factor for adapting to the host hypoxic microenvironment. Existing studies have shown that the growth rate of the ΔnrdG deletion strain is significantly reduced by about 60% under hypoxic conditions, and its colonization ability in vivo is significantly weakened, confirming the importance of the NrdG-NrdD system in the pathogenic process of APP.
[0006] The ΔnrdG gene deletion vaccine strain of Actinobacillus pleuropneumoniae has limited replication ability under aerobic conditions in normal lung tissue, ensuring vaccine safety; while it can survive briefly in the hypoxic area of the lesion, which is sufficient to stimulate an effective immune response. Achieving a balance between safety and effectiveness. This characteristic makes it an ideal target for vaccine development.
[0007] Compared with traditional inactivated vaccines, gene deletion vaccines can induce more comprehensive immune protection and are not restricted by serotypes. Compared with subunit vaccines, their production costs are lower and they are more suitable for large-scale application.
[0008] Therefore, knocking out the nrdG gene, establishing a genomic ΔnrdG gene deletion strain, and using it to prepare the ΔnrdG gene deletion strain vaccine of Actinobacillus pleuropneumoniae provide reference value for preventing and treating Actinobacillus pleuropneumoniae and have great application prospects. Summary of the Invention
[0009] The present invention aims to provide the construction of the ΔnrdG deletion strain of Actinobacillus pleuropneumoniae to solve the problems existing in the above-mentioned prior art.
[0010] To achieve the above object, the present invention adopts the following technical solutions:
[0011] One of the technical solutions of the present invention is to amplify the upstream homologous recombination arm from the genome of Actinobacillus pleuropneumoniae S4074 using primers SEQ ID NO.1 and SEQ ID NO.2, amplify the downstream homologous recombination arm using primers SEQ ID NO.3 and SEQ ID NO.4, and connect the upstream and downstream homologous recombination arms of the nrdG gene through fusion PCR technology using primers SEQ ID NO.1 and SEQ ID NO.4 to obtain a complete upstream and downstream fusion fragment.
[0012] In the second technical solution of the present invention, the upstream and downstream homologous arm fusion fragments are cloned into the suicide plasmid pEMOC2::Cm to obtain the targeting plasmid pEMOC2::Cm-ΔnrdG.
[0013] In the third technical solution of the present invention, the targeting plasmid pEMOC2::Cm-ΔnrdG is transformed into the Escherichia coli strain β2155 by calcium transformation and cultured until monoclonal formation, thus obtaining the donor strain β2155 / pEMOC2::Cm-ΔnrdG.
[0014] In the fourth technical solution of the present invention, the donor strain β2155 / pEMOC2::Cm-ΔnrdG is conjugated with the recipient bacterium Actinobacillus pleuropneumoniae S4074, and the conjugated bacterial liquid is continuously passaged and cultured until a gene-deleted monoclonal strain is formed, obtaining the target strain Actinobacillus pleuropneumoniae ΔnrdG deletion strain.
[0015] Based on the above technical solutions, the present invention has the following technical effects:
[0016] The Actinobacillus pleuropneumoniae ΔnrdG gene deletion strain provided by the present invention is used to prepare the Actinobacillus pleuropneumoniae ΔnrdG gene deletion strain vaccine, which can distinguish natural infection and vaccine infection. It has multiple advantages such as high safety, low cost, and easy use, and has good application prospects. The nrdG gene of the gene deletion strain of the present invention is a key factor for adapting to the hypoxic microenvironment of the host. The Actinobacillus pleuropneumoniae ΔnrdG gene deletion strain vaccine achieves a balance between safety and effectiveness and can effectively protect against Actinobacillus pleuropneumoniae. Description of the Drawings
[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0018] Figure 1 It is the electrophoresis result diagram of the nrdG upstream homologous recombination arm and downstream homologous recombination arm of the present invention.
[0019] Figure 2 It is the electrophoresis result diagram of the upstream and downstream homologous arm fusion fragments amplified by the primers SEQ ID NO.1 and SEQ ID NO.4 of the present invention.
[0020] Figure 3 It is the electrophoresis result diagram of the conjugation transfer monoclonal amplified by SEQ ID NO.7 and SEQ ID NO.8 of the present invention.
[0021] Figure 4This is the electrophoresis result diagram of the amplification products of the external primer and internal primer of the present invention. Detailed implementation manners
[0022] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.
[0023] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0024] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0025] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the present invention specification, which are obvious to those skilled in the art. Other implementation manners obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of this application are only exemplary.
[0026] Regarding the terms "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.
[0027] The technical solutions of the present invention, unless otherwise specified, are all conventional solutions in the art. The reagents or raw materials used, unless otherwise specified, are all purchased from commercial channels or have been made public.
[0028] The embodiments of the present invention provide an upstream homologous recombination arm and a downstream homologous recombination arm of nrdG.
[0029] The embodiments of the present invention also provide a fusion fragment of the upstream and downstream homologous arms of nrdG.
[0030] The embodiments of the present invention also provide a recombinant vector comprising the DNA molecule.
[0031] The embodiment of the present invention also provides the target strain Actinobacillus pleuropneumoniae ΔnrdG deletion strain.
[0032] The present invention creatively conducts in-depth analysis on the genome of APP through bioinformatics methods, screens out the key factors for APP to adapt to the host hypoxic microenvironment, and successfully constructs the ΔnrdG gene deletion strain, providing new ideas for the subsequent development of vaccines.
[0033] The present invention constructs the target strain Actinobacillus pleuropneumoniae ΔnrdG deletion strain based on the nrdG gene fragment through literature search and bioinformatics analysis and gene engineering technology. Using it to prepare the Actinobacillus pleuropneumoniae ΔnrdG gene deletion strain vaccine can distinguish natural infection and vaccine infection. It has multiple advantages such as high safety, low cost, and easy use, and has good application prospects.
[0034] The specific steps are as follows:
[0035] (1): Screened out the key factors responsible for APP to adapt to the host hypoxic microenvironment in the genome of Actinobacillus pleuropneumoniae suis according to literature search;
[0036] (2) Through screening and analysis, the anaerobic nucleotide reductase activating enzyme protein nrdG was selected as the target gene;
[0037] (3) Designed primers according to the nrdG gene and its upstream and downstream sequences in the NCBI database. The primer names and sequences are as follows:
[0038] SEQ ID NO.1: nrdG-S-F: CTGTCGACTACGGTGGGTTGTTAAATAGTTATCGC
[0039] SEQ ID NO.2: nrdG-S-R: GAACAAATTGTTTGGCAAGAAGTGCTCAACGTTTTATCGATTTACGCACC
[0040] SEQ ID NO.3: nrdG-X-F: GGTGCGTAAATCGATAAAACGTTGAGCACTTCTTGCCAAACAATTTGTTC
[0041] SEQ ID NO.4: nrdG-X-R: ATGCGGCCGCTCACGGCAATCGCAATCAGGATATA
[0042] SEQ ID NO.5: nrdG-N-F: AACGCCCTGTTTTTAGGTAGGTTAA
[0043] SEQ ID NO.6: nrdG-N-R: CATAGTACAGAAAGCTGGAAGGTCG
[0044] SEQ ID NO.7: nrdG-W-F: GTTTTGGTGCTTTAGATTCGCCGCC
[0045] SEQ ID NO.8: nrdG-W-R: TTTTAGACACCCCCATAAACGGACA
[0046] (4) Amplify the upstream and downstream homologous arm fusion fragments of nrdG using primers, and construct the recombinant plasmid pEMOC 2::Cm-ΔnrdG;
[0047] (5) Transform the constructed recombinant plasmid into Escherichia coli β2155, and obtain the donor strain β2155 / pEMOC2::Cm-ΔnrdG for conjugation experiment through culture and screening;
[0048] (6) Conduct a conjugation experiment, and continuously subculture the conjugated bacterial solution until a gene deletion monoclonal strain is formed.
[0049] (7) Identify the monoclonal by PCR, and screen to obtain the ΔnrdG gene knockout strain.
[0050] Example 1
[0051] Amplification method and steps of the upstream and downstream homologous recombination arms of Actinobacillus pleuropneumoniae nrdG:
[0052] Amplify the upstream homologous recombination arm from the Actinobacillus pleuropneumoniae genome using primers SEQ ID NO.1 and SEQ ID NO.2, and amplify the downstream homologous recombination arm using primers SEQ ID NO.3 and SEQ ID NO.4, as Figure 1 shown.
[0053] The primer sequences are as follows:
[0054] SEQ ID NO.1: nrdG-S-F: CTGTCGACTACGGTGGGTTGTTAAATAGTTATCGC
[0055] SEQ ID NO.2: nrdG-S-R: GAACAAATTGTTTGGCAAGAAGTGCTCAACGTTTTATCGATTTACGCACC
[0056] SEQ ID NO.3: nrdG-X-F: GGTGCGTAAATCGATAAAACGTTGAGCACTTCTTGCCAAACAATTTGTTC
[0057] SEQ ID NO.4: nrdG-X-R: ATGCGGCCGCTCACGGCAATCGCAATCAGGATATA
[0058] PCR amplification system for the amplification of the upstream homologous recombination arm: 1 μL of S4074 bacterial solution, 1.5 μL of SEQ ID NO.1 / SEQ ID NO.2, 21 μL of ddH2O, 25 μL of 2×KOD I PCR Master Mix, Total 50 μL.
[0059] Procedure: 98 degree 5 min, 98 degree 10 sec, 60 degree 30 sec, 68 degree 10 sec, 45 cycles, 72 degree 10 min.
[0060] PCR amplification system for the amplification of the downstream homologous recombination arm: 1 μL of S4074 bacterial solution, 1.5 μL of SEQ ID NO.3 / SEQ ID NO.4, 21 μL of ddH2O, 25 μL of 2×KOD I PCR Master Mix, Total 50 μL.
[0061] Procedure: 98 degree 5 min, 98 degree 10 sec, 65 degree 30 sec, 68 degree 10 sec, 45 cycles, 72 degree 10 min.
[0062] Example 2
[0063] Amplification method and steps of the nrdG upstream and downstream homologous arm fusion fragment:
[0064] Use primers SEQ ID NO.1 and SEQ ID NO.4 to connect the upstream and downstream homologous recombination arms through fusion PCR technology to obtain the complete upstream and downstream homologous arm fusion fragment as Figure 2 shown.
[0065] Fusion PCR amplification system: 1 μL of upstream and downstream homologous recombination arm DNA, 1.5 μL of SEQ ID NO.1 / SEQ ID NO.4, 21 μL of ddH2O, 25 μL of 2×KOD I PCR Master Mix, Total 50 μL.
[0066] Procedure: 98 degrees 5 minutes, 98 degrees 10 seconds, 63 degrees 30 seconds, 68 degrees 20 seconds, 45 cycles, 72 degrees 10 minutes.
[0067] Example 3
[0068] Construction of the targeting plasmid pEMOC2::Cm-ΔnrdG:
[0069] Using the restriction enzymes Not I and Sal I, double digest the suicide plasmid pEMOC2::Cm and the upstream and downstream homologous arm fusion fragments respectively. After gel extraction of the digested targeting plasmid pEMOC2::Cm, purify the digested targeting fragment. pEMOC2::Cm (~100 ng / μL) 16 μL, Sal I 1 μL (10 U / μL), Not I 1 μL (10 U / μL), 10×Cute one Buffer 2 μL, Total 20 μL. React at 37°C for 2 hours. After the digestion reaction, the vector and the targeting fragment are separated by 1% agarose electrophoresis respectively, purified by column centrifugation, and eluted in 10 μL of deionized water.
[0070] Ligation: pEMOC2::Cm / Not I, Sal I (~50 ng / μL) 2 μL, upstream and downstream homologous arm fusion fragment / Not I, Sal I (~50 ng / μL) 6 μL, 10×T4 buffer 1 μL, T4 DNA ligase (5 U / μL), Total 10 μL, react overnight at 4°C.
[0071] Transformation: Transfer the ligation product into DH5α competent cells by the calcium transformation method, and culture on an LB plate (chloramphenicol 25 mg / mL) at 37°C until monoclonal formation.
[0072] Preparation of positive clones and targeting plasmids: Monoclonal colonies growing on the chloramphenicol-resistant plate contain the targeting plasmid. Randomly select a monoclonal colony for subsequent experiments and name it pEMOC2::Cm-ΔnrdG. Inoculate the clone into 5 mL of LB (containing chloramphenicol 25 mg / mL), culture at 37°C for 14 - 16 h, and then purify the plasmid DNA by column centrifugation.
[0073] Transform the targeting plasmid into Escherichia coli β2155 by calcium transformation, coat it on LB (chloramphenicol 25 mg / mL), 0.5 mM DAP (diaminopimelic acid), and culture at 37°C until monoclonal formation. This monoclonal is used as the donor strain β2155 / pEMOC2::Cm-ΔnrdG for the conjugation transfer experiment.
[0074] Conjugation transfer experiment:
[0075] (1) Streak inoculate the recipient bacterium Actinobacillus pleuropneumoniae S4074 on TSA plates and culture at 37 °C until monoclonal colonies form. Pick a single colony and inoculate it into 5 mL of TSB containing 10% newborn bovine serum and 0.1% NAD, and culture at 37 °C with 180 rpm until the logarithmic growth phase.
[0076] (2) Pick a single colony of β2155 / pEMOC2::Cm-ΔnrdG and inoculate it into 5 mL of LB (containing 25 mg / mL chloramphenicol and 0.5 mM DAP), and culture at 37 °C with 180 rpm until the logarithmic growth phase.
[0077] (3) Mix the β2155 / pEMOC2::Cm-ΔnrdG bacterial solution with 500 μL of the recipient bacterium bacterial solution for a conjugation experiment.
[0078] (4) Spread an appropriate amount of the conjugated bacterial solution on TSA plates containing 1 mg / mL chloramphenicol and culture at 37 °C until monoclonal colonies form.
[0079] Example 4
[0080] Screening of ΔnrdG gene knockout strains:
[0081] (1) On the resistant plates, randomly pick 3 monoclonal colonies and inoculate them into 1 mL of TSB medium containing 10% newborn bovine serum and 0.1% NAD. Culture at 37 °C with 180 rpm until turbid. Take a small amount of the bacterial solution and perform PCR identification using the external and internal primers of the nrdG gene. The amplification length of the external primer for the S4074 original strain is 1323 bp, and for the target strain, it is 970 bp. The amplification length of the internal primer for the S4074 original strain is 256 bp, and for the target strain, there is no band. The results are as Figure 4 shown. The results indicate that the nrdG gene of this monoclonal colony has been deleted.
[0082] The sequences of the above-mentioned internal and external primers are as follows
[0083] SEQ ID NO.5: nrdG-N-F: AACGCCCTGTTTTTAGGTAGGTTAA
[0084] SEQ ID NO.6: nrdG-N-R: CATAGTACAGAAAGCTGGAAGGTCG
[0085] SEQ ID NO.7: nrdG-W-F: GTTTTGGTGCTTTAGATTCGCCGCC
[0086] SEQ ID NO.8: nrdG-W-R: TTTTAGACACCCCCATAAACGGACA
[0087] External primer identification PCR reaction system: 1 μL of bacterial solution, 1 μL of nrdG-W-F / nrdG-W-R, 7 μL of dd H2O, 10 μL of 2×Magic Green Taq SuperMix, Total 20 μL.
[0088] Procedure: 95 degree 3 min, 95 degree 10 sec, 52 degree 10 sec, 72 degree 60 sec, 35 cycles, 72 degree 10 min.
[0089] Internal primer identification PCR reaction system: 1 μL of bacterial solution, 1 μL of nrdG-N-F / nrdG-N-R, 7 μL of dd H2O, 10 μL of 2×Magic Green Taq SuperMix, Total 20 μL.
[0090] Procedure: 95 degree 3 min, 95 degree 10 sec, 51 degree 10 sec, 72 degree 60 sec, 35 cycles, 72 degree 10 min.
[0091] (2) After successful identification, remove the monoclonal of the intermediate state of the previous recombination on the genome. There is no nrdG gene in the simple secondary recombination positive clone, and the internal primer amplification result is negative. Inoculate the single exchange monoclonal strain into TSB liquid medium containing 10% newborn bovine serum and 0.1% NAD, and culture it by subculture on a shaker at 37°C. Absorb an appropriate amount of bacterial solution from each generation of the strain and dilute it to an appropriate dilution, and spread it on TSA solid medium containing 10% newborn bovine serum and 0.1% NAD. Transfer the grown single colonies to TSA solid medium containing chloramphenicol resistance and 10% newborn bovine serum without resistance respectively, and culture them in a constant temperature incubator at 37°C. The strain that does not grow in the medium with resistance and grows in the medium without resistance is the suspected Actinobacillus pleuropneumoniae ΔnrdG gene deletion strain. Inoculate this strain into TSB liquid medium containing 10% newborn bovine serum and 0.1% NAD, and culture it on a shaker at 37°C until the bacterial solution becomes turbid. After the bacterial solution becomes turbid, use the internal and external primers to identify the sample with the bacterial solution as the template, and the results are as Figure 4 shown.
[0092] Strain preservation: Take 700 μL of fresh culture bacterial solution of Actinobacillus pleuropneumoniae ΔnrdG gene deletion strain, add 300 μL of 80% sterile glycerol as the strain, and store it at -80°C for long-term preservation.
[0093] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, rather than limiting the implementation manners of the present invention. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to enumerate all implementation manners here. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the claims of the present invention.
Claims
1. An Actinobacillus pleuropneumoniae ΔnrdG gene deletion strain, characterized in that, It is constructed and obtained by the following methods: (1) Using primers SEQ ID NO.1 / SEQ ID NO.2 and SEQ ID NO.3 / SEQ ID NO.4, amplify the upstream and downstream homologous recombination arms from the Actinobacillus pleuropneumoniae genome respectively; (2) Using the product of step (1) as a template, obtain the homologous arm fusion fragment by fusion PCR with primers SEQ ID NO.1 / SEQ ID NO.4; (3) Use Not I and Sal I to double-digest the fusion fragment and the suicide plasmid pEMOC2::Cm, and ligate them with T4 DNA ligase to construct the recombinant targeting plasmid pEMOC2::Cm-ΔnrdG; (4) Transform the recombinant plasmid into Escherichia coli DH5α, screen by chloramphenicol resistance and verify by PCR with primers SEQ ID NO.5 / SEQ ID NO.6 and SEQ ID NO.7 / SEQ ID NO.8 to obtain the engineered strain DH5α / pEMOC2::Cm-ΔnrdG; (5) Transform the verified plasmid into Escherichia coli β2155 to obtain the donor strain β2155 / pEMOC2::Cm-Δnrd G; (6) Through the conjugative transfer of the donor strain and Actinobacillus pleuropneumoniae S4074, screen to obtain the ΔnrdG gene deletion strain.
2. The method according to claim 1, wherein The PCR conditions for step (2) are: 98°C for 5 min, 98°C for 10 sec, 63°C for 30 sec, 68°C for 20 sec, 45 cycles, 72°C for 10 min.
3. The homologous recombination DNA fragment for constructing the ΔnrdG gene deletion strain according to claim 1, characterized in that, Its primer sequences are as shown in SEQ ID NO.1 / SEQ ID NO.
4.
4. A recombinant suicide plasmid, characterized in that, It contains the DNA fragment described in claim 3, and the plasmid is pEMOC2::Cm-ΔnrdG.
5. A plasmid amplification host bacterium, characterized in that, It carries the recombinant suicide plasmid described in claim 4.
6. The plasmid amplification host bacterium according to claim 5, wherein The host bacterium for plasmid amplification is DH5α-pEMOC2::Cm-ΔnrdG.
7. A conjugative transfer donor bacterium, characterized in that, It carries the recombinant suicide plasmid described in claim 4.
8. The plasmid amplification host bacterium according to claim 7, wherein The conjugative transfer donor strain is β2155-pEMOC2::Cm-ΔnrdG.
9. The application of the ΔnrdG gene deletion strain as described in claim 1 in the preparation of an attenuated live vaccine against Actinobacillus pleuropneumoniae.
10. An Actinobacillus pleuropneumoniae attenuated vaccine, characterized in that, It contains the ΔnrdG gene deletion described in claim 1.