Construction method of multi-gene overexpressed streptomyces diastatochromogenes strain and application of multi-gene overexpressed streptomyces diastatochromogenes strain in production of epsilon-polylysine

By simultaneously overexpressing the malate dehydrogenase gene MDH and the α-ketoglutarate decarboxylase gene OGDH on the ε-Polysine chassis strain, the high-yield engineering strain S.diastatochromogenes MDH-OGDH was constructed, which solved the problem of low production of ε-Polysine and achieved a significant improvement in yield and production intensity.

CN120290446APending Publication Date: 2025-07-11TIANJIN UNIV OF SCI & TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510505118.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-22
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

In the prior art, the yield of ε-polylysine-producing strains is relatively low, and the effect of single gene modification is not ideal, making it difficult to meet industrial needs.

Method used

The malate dehydrogenase gene MDH and the α-ketoglutarate decarboxylase gene OGDH in the tricarboxylic acid cycle were simultaneously overexpressed on the ε-polystreptimidae chassis strain to construct the high-yield engineering strain S.diastatochromogenes MDH-OGDH.

Benefits of technology

It significantly improves the yield, production intensity and sugar acid conversion rate of ε-polylysine, reduces production costs, and provides excellent bacterial strains for the industrial production of ε-polylysine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290446A_ABST
    Figure CN120290446A_ABST
Patent Text Reader

Abstract

The invention discloses a method for obtaining a high-yield epsilon-polylysine streptomyces diastatochromogenes engineering strain S.diastatochromogenes MDH-OGDH by overexpressing a key enzyme malic dehydrogenase gene MDH and an alpha-ketoglutaric acid decarboxylase gene OGDH in a TCA (Trichoderma Carboxygenase) pathway, the epsilon-polylysine is produced by fed-batch fermentation in a 5L fermentation tank, and the yield (g / L) of the epsilon-polylysine is 137.18% of that of a chassis strain S.diastatochromogenes 6 #-7, and the yield (g / L) of the epsilon-polylysine is 37.18% of that of the chassis strain S.diastatochromogenes 6 #-7. The production intensity (g / L.h) of the strain is 133.68% of that of a chassis strain S.diastatochromogenes 6 #-7; the saccharic acid conversion rate of the strain is 116.04% of that of a chassis strain S.diastatochromogenes 6 #-7, the production cost is remarkably reduced, and an excellent strain is provided for industrial production of epsilon-polylysine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular, constructs a Streptomyces diastatochromogenes strain with overexpression of multiple genes and applies it to improve the production of ε-polylysine. Background Art

[0002] ε-poly-L-lysine (ε-PL) is a natural lysine homopolymer. Due to its broad antibacterial spectrum, strong thermal stability, good water solubility and other characteristics, it has been widely used in the fields of food preservation, medical hygiene and biological materials. At present, the production of polylysine by production strains is relatively low, and the market demand continues to grow. Based on the above situation, the purpose of this study is to construct a high-yield ε-PL strain by genetic engineering technology to reduce its production cost.

[0003] In 1977, researchers detected the natural antibacterial substance ε-PL through chemical screening. ε-PL is a poly-polypeptide formed by lysine residues through amide bonds between α-carboxyl and ε-amino groups. The ε-PL produced by wild strains during fermentation is usually at a low level and difficult to meet the requirements of industrial production. Therefore, researchers have turned their attention to the strain breeding and transformation of ε-PL-producing strains. At present, the strain breeding mainly focuses on two aspects: mutagenesis breeding and genetic engineering breeding. There are relatively few studies on using genetic engineering means to strengthen multiple genes to construct engineering strains to improve the production of ε-PL, and there are almost no reports on overexpressing key enzyme genes in multiple TCA pathways.

[0004] Through retrieval, the following several public literatures related to the present invention patent application are found:

[0005] 1. A method for constructing a genetically engineered Streptomyces diastatochromogenes and improving the production of ε-polylysine and its application (CN114231474A) discloses a genetically engineered high-yield ε-polylysine strain Streptomyces diastatochromogenes MDH (Streptomyces diastatochromogenes MDH), which overexpresses malate dehydrogenase Mdh derived from the genome of S. diastatochromogenes. The ability of this genetically engineered strain to produce ε-polylysine is increased by 17.96% compared with the original strain Streptomyces diastatochromogenes TUST (CGMCC No. 3145) under the same culture conditions. This method provides an excellent strain for the high-value conversion of L-lysine to produce ε-polylysine. However, only one gene is overexpressed, and there is still room for improvement in the production level of ε-PL.

[0006] 2. A genetically engineered strain of Streptomyces albulus with high ε-polylysine production, its construction method and application (CN116622606A) disclose a genetically engineered strain of Streptomyces albulus with high ε-polylysine production, its construction method and application. A recombinant plasmid overexpressing the ε-polylysine synthase Pls gene and heterologously expressing the L-lysine permease LysP gene was transferred into Streptomyces albulus GS114 to obtain a genetically engineered strain. Through experimental verification, the ε-polylysine synthesis ability, L-lysine utilization ability and carbon source conversion rate of the genetically engineered strain were increased by 21.2%, 19.7% and 60.0% respectively compared with the original strain under the same conditions. It shows that this gene plays an important role in improving the ε-polylysine production ability, but only a single gene was overexpressed, and there is still room for improvement in the ε-PL production level.

[0007] 3. Wang et al. analyzed the metabolome of Streptomyces diastatochromogenes and revealed the metabolic network mechanism for ε-PL synthesis: Changes in the levels of key metabolites in the TCA cycle and glycolysis pathway indicate that carbon metabolism is introduced into L-lysine biosynthesis and ε-PL production; The identification of differential metabolites such as acetyl-CoA and α-ketoglutaric acid provides targets for metabolic engineering transformation and a theoretical basis for optimizing fermentation processes and industrial production (Frontiers in Microbiology, 2023, 14: 1123050).

[0008] At present, although there are reports on using genetic engineering technology to transform ε-polylysine-producing strains, most of them are limited to the transformation of a single gene in the metabolic pathway, and the overexpression effect of some genes is not ideal. Therefore, how to further improve the production level of ε-polylysine and its hydrochloride by overexpressing multiple genes is still a key technical problem that urgently needs to be solved at present.

[0009] By comparison, this invention patent application is essentially different from the above-mentioned patent disclosure documents. Summary of the Invention

[0010] The purpose of the present invention is to overcome the deficiencies of the prior art, carry out genetic engineering transformation on the basis of the ε-polylysine-producing Streptomyces chassis strain, and simultaneously overexpress the malate dehydrogenase gene MDH and the α-ketoglutarate decarboxylase gene OGDH that affect ε-polylysine synthesis in the tricarboxylic acid cycle (TCA). Obtain a high-yield Streptomyces engineering strain of ε-polylysine and use the high-yield engineering strain to ferment and produce ε-polylysine and its hydrochloride.

[0011] The technical solution adopted by the present invention to solve the technical problem is:

[0012] The engineered Streptomyces strain provided by the present invention uses Streptomyces sp. producing ε-polylysine as the chassis strain and is modified as follows:

[0013] Overexpress the malate dehydrogenase gene MDH and the α-ketoglutarate decarboxylase gene OGDH in the tricarboxylic acid cycle (TCA) simultaneously.

[0014] Among them, the chassis strain can be Streptomyces diastatochromogenes 6#-7, a Streptomyces strain producing ε-polylysine. Streptomyces diastatochromogenes 6#-7 has been deposited in the General Microbiology Center of the China Committee for Culture Collection of Microorganisms, with the deposit number CGMCC NO.22261, the deposit date being April 30, 2021, and the address: Institute of Microbiology, Chinese Academy of Sciences.

[0015] The present invention has no special limitation on the method for obtaining the gene, which can be by PCR amplification technology or direct synthesis technology.

[0016] In some specific embodiments, the high-yield engineered strain that overexpresses the malate dehydrogenase gene MDH and the α-ketoglutarate decarboxylase gene OGDH using the chassis strain Streptomyces diastatochromogenes 6#-7 is named S.diastatochromogenes 6#-7MDH-OGDH.

[0017] Furthermore, the overexpression vector plasmid used for constructing the high-yield engineered strain is pIMEP.

[0018] Furthermore, the nucleotide sequence of the overexpressed malate dehydrogenase gene MDH is SEQ ID No.1.

[0019] Furthermore, the nucleotide sequence of the overexpressed α-ketoglutarate decarboxylase gene OGDH is SEQ ID No.2.

[0020] Furthermore, in some specific embodiments, the steps for constructing the high-yield ε-polylysine engineered strain are as follows:

[0021] (1) Obtaining the target fragment gene:

[0022] Primer sequences MDH-F and MDH-R (SEQ ID No.3 and SEQ ID No.4) were designed based on the malate dehydrogenase gene MDH. The genomic DNA of S. diastatochromogenes 6#-7 (accession number CGMCC No.22261) was extracted using a kit or conventional method and used as a template for PCR amplification to obtain the MDH gene with homologous arms, which is 990 bp in length. The detailed MDH gene sequence is shown in SEQ ID No.1 of the sequence listing.

[0023] Primer sequences OGDH-F and OGDH-R (SEQ ID No.5 and SEQ ID No.6) were designed based on the α-ketoglutarate decarboxylase gene OGDH and used as upstream and downstream primers. The genomic DNA of S. diastatochromogenes 6#-7 (accession number CGMCC No.22261) was extracted using a kit or conventional method and used as a template for PCR amplification to obtain the OGDH gene with homologous arms, which is 3468 bp in length. The detailed OGDH gene sequence is shown in SEQ ID No.2 of the sequence.

[0024] The gene sequences and the primer sequences used are as follows:

[0025] The nucleotide sequence of the endogenous malate dehydrogenase gene MDH of Streptomyces diastatochromogenes is SEQ ID No.1;

[0026] Primer MDH-F: 5’- GAGATATCGGATCCGGTACC GAATTCATGACCCGCACTCCCGT CAACG-3’ where the underlined part is the upstream homologous arm and the bold part is the EcoRΙ restriction site, SEQ ID No.3;

[0027] Primer MDH-R: 5’- TTCCATCGCCGCTTCATGATGAATTC TCAGATCAGGCCGAGCG CGC-3’ where the underlined part is the upstream homologous arm and the bold part is the EcoRΙ restriction site, SEQ ID No.4;

[0028] The nucleotide sequence of the α-ketoglutarate decarboxylase gene OGDH of Streptomyces diastatochromogenes is SEQ ID No.2;

[0029] Primer OGDH-F: 5’- GAGATATCGGATCCGGTACCGAATTC GTGAAGCCCGCTGCCA GCG-3’ where the underlined part is the upstream homologous arm and the bold part is the EcoRΙ restriction site, SEQ ID No.5;

[0030] Primer OGDH-R: 5’- TTCCATCGCCGCTTCATGATGAATTCTCACGCGTCGAAGACC TCGGC-3’, where the underlined part is the upstream homologous arm, the bold part is the EcoRΙ restriction site, SEQ ID No.6;

[0031] (2) Construction of recombinant plasmid:

[0032] The PCR-amplified MDH gene fragment was ligated with the linear plasmid pIMEP carrying the strong erythromycin promoter ermE* (SEQ ID No.7) to obtain the ligation product, the recombinant plasmid pIMEP-MDH. The PCR-amplified OGDH gene fragment was ligated with the ermE* fragment carrying the strong erythromycin promoter to obtain the ermE*-OGDH fragment; the ermE*-OGDH fragment was homologously recombined with the linear plasmid pIMEP-MDH to obtain the plasmid pIMEP-MDH-OGDH. The constructed recombinant vector was transformed into Escherichia coli DH5α competent cells by the chemical method, and Escherichia coli DH5α positive transformants were screened by apramycin resistance. The Escherichia coli DH5α positive transformants were cultured, and the recombinant plasmid pIMEP-MDH-OGDH in the transformants was extracted for standby.

[0033] (3) Construction of engineering strain

[0034] The recombinant plasmid pIMEP-MDH-OGDH was transformed into Escherichia coli ET12567 (PUZ8002) and spread on an LB plate containing 12.5 - 25 μg / mL kanamycin, 25 - 50 μg / mL apramycin and 12.5 - 25 μg / mL chloramphenicol. The Escherichia coli ET12567 (PUZ8002) positive transformants were selected and cultured in an LB liquid medium containing the same concentrations of the three antibiotics, kanamycin, apramycin and chloramphenicol, at 37 °C with shaking until the OD 600 reached between 0.4 and 0.6. The cells were collected by centrifugation, and the cells were washed with fresh LB liquid medium to remove the residual antibiotics, resuspended in the LB liquid medium and placed on ice for standby; TES buffer at pH 8.0 was added to the plate of the chassis strain cultured on the Bennett medium, and the Streptomyces chassis strain spores were scraped off and poured into a container containing glass beads. The spore chains were broken by shaking at 30 °C and 180 - 200 r / min. The mycelia were removed by filtration, and the spore suspension was collected. The spore suspension was heat shocked in a water bath at 50 °C for 10 min. Immediately after cooling the spore suspension to room temperature, M3G medium was added, and the spores were cultured with shaking at 37 °C for 2 - 3 h to germinate. The germinated spores were collected by centrifugation at 5000 r / min for 5 min and resuspended in TES buffer for standby;

[0035] The prepared positive transformant cells of Escherichia coli ET12567 (pUZ8002) and the germinated spores of Streptomyces chassis strains were mixed at a volume ratio of 1:1. After repeated pipetting and mixing, they were evenly spread on the SFM medium containing 5 mM MgCl2. After incubating at 30 °C in an inverted position for 14 - 18 h, the surface of the plate was evenly covered with 1 ml of sterile water containing 12.5 - 25 μL of nalidixic acid (concentration: 25 mg / mL) and 12.5 - 25 μL of apramycin (concentration: 25 mg / mL). After drying the plate, it was continued to be incubated in an inverted position for 3 - 5 days, and positive conjugant monoclonal colonies were selected to obtain a high-yield Streptomyces ε-polylysine engineering strain.

[0036] Further, the composition of each 1 L of M3G medium is as follows:

[0037] (NH4)2SO4 10 g, KH2PO4 1.36 g, K2HPO4 0.8 g, yeast extract 5 g. Adjust the pH to 7.2 with ammonia water, make up the volume to 900 mL with distilled water, and then sterilize it alone at 121 °C for 20 min. Before use, add 10 mL of 10× glucose mother liquor to every 100 mL of M3G medium; 10× glucose mother liquor: Weigh 100 g of glucose, add 2 mL of 20 g / L ZnSO4·7H2O, add 2 mL of 10 g / L MgSO4·7H2O and 1 mL of 20 g / L FeSO4·7H2O, make up the volume to 100 mL with distilled water, and then sterilize it alone at 115 °C for 30 min.

[0038] Alternatively, the composition of each 1 L of Bennett medium is as follows:

[0039] Glucose 10 g, peptone 2 g, yeast powder 1 g, beef extract 1 g, agar 15 - 20 g, add water to make up to 1 L, adjust the pH to 7.7 with NaOH;

[0040] Alternatively, the composition of the 1 L of SFM medium is as follows:

[0041] Soybean cake powder 30 g, mannitol 20 g, agar powder 20 g, add water to make up to 1 L, adjust the pH with NaOH to 7.2 - 7.4;

[0042] Among them, the soybean cake powder is used after the following treatment:

[0043] Add 900 mL of tap water, boil for half an hour, and then filter with eight layers of gauze.

[0044] Further, the present invention also provides the application of the above-mentioned high-yield Streptomyces ε-polylysine engineering bacteria in the fermentation production of ε-polylysine. The production method of the fermentation is as follows:

[0045] Inoculate the engineered strain of Streptomyces albulus with high ε-polylysine productivity on a Bennett medium plate and culture it at 30°C until spores are produced; then, inoculate the spores into a shake flask of M3G medium containing glucose and culture at 28 - 30°C and 180 - 220 r / min for 30 h. Transfer the cultured seed culture medium to M3G medium containing glucose for fed-batch fermentation in a fermenter to obtain ε-polylysine fermentation broth. Subsequently, ε-polylysine or ε-polylysine hydrochloride can be further purified by centrifugation, adsorption, elution, decolorization, and drying.

[0046] The advantages and positive effects achieved by this invention are as follows:

[0047] This invention focuses on the modification of multiple key genes. By co-expressing the key malate dehydrogenase gene MDH and α-ketoglutarate decarboxylase gene OGDH in the TCA pathway, the engineered strain S. diastatochromogenes MDH-OGDH is obtained. Fed-batch fermentation is carried out to produce ε-polylysine, and its ε-polylysine yield (g / L) is 137.18% of that of the chassis strain S. diastatochromogenes 6#-7; the production intensity (g / L·h) is 133.68% of that of the chassis strain S. diastatochromogenes 6#-7; the sugar-acid conversion rate is 116.04% of that of the chassis strain S. diastatochromogenes 6#-7, significantly reducing the production cost and providing an excellent strain for the industrial production of ε-polylysine. Description of the Drawings

[0048] Figure 1 It is the construction flow chart of constructing the recombinant plasmid pIMEP-MDH-OGDH based on the plasmid pIMEP in this invention;

[0049] Figure 2 It is the verification diagram of the recombinant plasmid pIMEP-MDH-OGDH in this invention; among them, lane M: 10Kb marker; lane 1: EcoRV digestion of the recombinant plasmid pIMEP-MDH-OGDH;

[0050] Figure 3 It is the verification diagram of the genetic engineering strain S. diastatochromogenes MDH-OGDH in this invention; among them, lane M: 10Kb marker; lane 1: amplification diagram of the integrated MDH-OGDH gene fragment in S. diastatochromogenes MDH-OGDH; lane 2: there is no corresponding MDH-OGDH gene fragment in the S. diastatochromogenes control 6#-7;

[0051] Figure 4 This is the relative yield graph of ε-polylysine fermentation production by strain in a 5L fermenter in the present invention; among them, 6#-7 is the chassis strain S. diastatochromogenes 6#-7, and MDH-OGDH is the high-yield engineered strain S. diastatochromogenes MDH-OGDH that overexpresses the malate dehydrogenase gene MDH and the α-ketoglutarate decarboxylase gene OGDH with S. diastatochromogenes 6#-7 as the chassis strain.

[0052] Figure 5 This is the relative production intensity graph of ε-polylysine fermentation production by strain in a 5L fermenter in the present invention; among them, 6#-7 is the chassis strain S. diastatochromogenes 6#-7, and MDH-OGDH is the high-yield engineered strain S. diastatochromogenes MDH-OGDH that overexpresses the malate dehydrogenase gene MDH and the α-ketoglutarate decarboxylase gene OGDH with S. diastatochromogenes 6#-7 as the chassis strain.

[0053] Figure 6 This is the relative sugar-acid conversion rate graph of ε-polylysine fermentation production by strain in a 5L fermenter in the present invention; among them, 6#-7 is the chassis strain S. diastatochromogenes 6#-7, and MDH-OGDH is the high-yield engineered strain S. diastatochromogenes MDH-OGDH that overexpresses the malate dehydrogenase gene MDH and the α-ketoglutarate decarboxylase gene OGDH with S. diastatochromogenes 6#-7 as the chassis strain. Detailed implementation manners

[0054] The following examples and drawings of the present invention only illustrate the specific implementation schemes for realizing the present invention. These schemes and drawings cannot be construed as limitations on the present invention. Any changes made without departing from the principles and essence of the present invention fall within the protection scope of the present invention.

[0055] The raw materials used in the present invention are all conventional commercially available products without special instructions. The methods used in the present invention are all conventional methods in the art without special instructions. The masses of various substances used in the present invention are all conventional usage masses.

[0056] Specifically, the relevant preparations and detections are as follows:

[0057] A genetically engineered high-yield ε-polylysine strain, Streptomyces diastatochromogenes MDH-OGDH with amylase production, and its construction method. By constructing a multi-gene recombinant plasmid pIMEP-MDH-OGDH overexpressing the malate dehydrogenase gene MDH and the α-ketoglutarate decarboxylase gene OGDH, and transferring the recombinant plasmid pIMEP-MDH-OGDH into Streptomyces diastatochromogenes 6#-7, a genetically engineered strain Streptomyces diastatochromogenes MDH-OGDH is obtained. The gene sequences of the multi-gene expressed malate dehydrogenase gene MDH and α-ketoglutarate decarboxylase gene OGDH are SEQ ID No.1 and SEQ ID No.2 respectively.

[0058] The Streptomyces diastatochromogenes 6#-7 is the strain with the deposit number CGMCC No.22261.

[0059] Since the same amino acid can be determined by several different codons, the same amino acid can correspond to different nucleotide sequences. Therefore, the nucleotide sequences in this application include the nucleotide sequences of codon synonymous mutations obtained by substituting one or several nucleotides in the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID No.2. Those skilled in the art can obtain the MDH and OGDH genes of this application according to the nucleotide sequences disclosed in this application and the existing molecular biology techniques, such as PCR, gene synthesis or other suitable methods. Therefore, the nucleotide sequences encoding the above MDH and OGDH genes are not limited to the nucleotide sequences shown in SEQ ID No.1 and SEQ ID No.2. If the proteins encoded by the MDH and OGDH genes obtained by encoding do not have obvious functional differences, they are also included within the scope of the present invention.

[0060] The present invention will be described more specifically below with reference to the examples:

[0061] Example 1 Extraction of genomic DNA of Streptomyces diastatochromogenes 6#-7 with amylase production

[0062] Use the MiniBEST Bacteria Genomic DNA Extraction Kit Ver.3.0 genomic extraction kit of TaKaRa Company to extract the genomic DNA of Streptomyces diastatochromogenes 6#-7 (deposit number CGMCC No.22261):

[0063] (1) Inoculate S. diastatochromogenes 6#-7 spores into M3G liquid medium and culture at 30 °C with 180 r / min for 30 h;

[0064] (2) Collect 1 mL of the culture solution with a 1.5 mL centrifuge tube, centrifuge at 12,000 r / min for 2 min, and discard the supernatant; add 500 μL of Buffer BS to resuspend the cells, add 50 μL of Lysozyme (20 mg / mL), mix well by pipetting, and incubate in a water bath at 37 °C for 60 min; centrifuge at 12,000 r / min for 5 min, and discard the supernatant; add 180 μL of Buffer GL, 20 μL of Proteinase K (20 mg / mL), and 10 μL of RNaseA (10 mg / mL), mix well by pipetting, and incubate in a water bath at 56 °C for 10 min; add 200 μL of Buffer GB and 200 μL of absolute ethanol, and mix well; install the Spin Column on the Collection Tube, transfer the mixed solution to the Spin Column, centrifuge at 12,000 r / min for 2 min, and discard the filtrate; add 500 μL of Buffer WA to the Spin Column, centrifuge at 12,000 r / min for 1 min, and discard the filtrate; add 700 μL of Buffer WB to the Spin Column, centrifuge at 12,000 r / min for 1 min, and discard the filtrate, repeat the washing with Buffer WB once; install the Spin Column on the Collection Tube, centrifuge at 12,000 r / min for 2 min; install the Spin Column on a new 1.5 mL centrifuge tube, add 50 - 200 μL of sterile water or Elution Buffer to the center of the Spin Column membrane, let stand at room temperature for 5 min, and centrifuge at 12,000 r / min for 2 min to elute genomic DNA.

[0065] (3) Determine the concentration of the extracted genomic DNA by agarose gel electrophoresis or measuring absorbance.

[0066] Example 2 Cloning of co-expressed genes and construction of recombinant plasmid MDH-OGDH

[0067] (1) Cloning of co-expressed genes

[0068] Design upstream and downstream primer sequences MDH-F and MDH-R (SEQ ID No.3 and SEQ ID No.4) according to the malate dehydrogenase gene MDH. Add the restriction enzyme cleavage site of EcoR I and 15 - 20 bp bases complementary to the 5'-end of the front end of pIMEP to the nucleic acid sequence at the 5'-end of the MDH-F primer to form a homologous fragment. Add the restriction enzyme cleavage site of EcoR I and 15 - 20 bp bases complementary to the 5'-end of the front end of pIMEP to the nucleic acid sequence at the 5'-end of the MDH-R primer to form a homologous fragment. Use the genomic DNA extracted in Example 1 as a template for PCR reaction to amplify the MDH gene with homologous arms, with a full length of 1002 bp. The detailed MDH gene sequence is shown in Sequence Listing SEQ ID No.1.

[0069] Design upstream and downstream primer sequences OGDH-F and OGDH-R (SEQ ID No.5 and SEQ ID No.6) according to the α-ketoglutarate decarboxylase gene OGDH. Add the restriction enzyme cleavage site of EcoR V and 15 - 20 bp bases complementary to the 5'-end of the front end of the ermE* gene to the nucleic acid sequence at the 5'-end of the OGDH-F primer to form a homologous fragment. Use the genomic DNA extracted in Example 1 as a template for PCR reaction to amplify the OGDH gene with homologous arms, with a full length of 3531 bp. The detailed OGDH gene sequence is shown in Sequence Listing SEQ ID No.2.

[0070] Design upstream and downstream primer sequences ermE-F and ermE-R (SEQ ID No.8 and SEQ ID No.9) according to the ermE* gene. Add 15 - 20 bp bases complementary to the 5'-end of the end of the OGDH gene to the nucleic acid sequence at the 5'-end of the ermE-R primer to form an overlapping strand. Use the pIMEP plasmid (SEQ ID No.10) as a template for PCR reaction to amplify the ermE* gene with an overlapping strand, with a full length of 216 bp. The detailed ermE* gene sequence is shown in Sequence Listing SEQ ID No.7.

[0071] PCR reaction system: 2×phanta max buffer 25 μL, dNTP mixture (10 mM) 1 μL, template (20 μg / mL) 1 μL, upstream and downstream primers ((10 μM)) 2 μL each, DMSO 2 μL, phanta max × Super-Fidelity DNA Polymerase 1 μL, supplement with ultrapure water to 50 μL.

[0072] PCR reaction conditions: Pre-denature at 95°C for 5 min; denature at 95°C for 15 s, anneal at 55 - 65°C for 15 s, extend at 72°C for 30 - 90 s, for a total of 25 - 35 cycles, extend thoroughly at 72°C for 5 min, and end the reaction at 4°C.

[0073] (2) Construction of recombinant plasmid pIMEP-MDH.

[0074] The MDH gene with homologous arms amplified by PCR was ligated with the linear plasmid pIMEP integrated with the strong promoter erythromycin promoter ermE* by single digestion with EcoR I using a homologous recombinase to obtain the ligation product recombinant plasmid pIMEP-MDH.

[0075] Among them, the homologous recombination system was: 50 - 200 ng of linearized vector pIMEP, 50 - 200 ng of inserted MDH gene fragment, 4 μL of 5×CEⅡ Buffer, 2 μL of ExnaseⅡ, and supplemented with ultrapure water to 20 μL.

[0076] Homologous recombination conditions: React at 37 °C for 30 min and cool to 4 °C.

[0077] (3) Obtaining of OGDH and ermE* fusion gene

[0078] According to the OGDH gene with overlapping strands and the ermE* gene with overlapping strands, the upstream and downstream primer sequences OGDH’-F and OGDH’-R (SEQ ID No.11 / SEQ ID No.12) were designed. Restriction enzyme cleavage sites of EcoRⅤ were added to both ends of the fusion gene. Among them, a restriction enzyme cleavage site of EcoRⅤ and 15 - 20 nucleotides identical to the upstream of the EcoRⅤ cleavage site of the starting vector pIMEP were added to the 5’ end of the upstream primer of the ermE* gene nucleotide sequence to form an upstream homologous arm (primer sequence OGDH’-F). Among them, a restriction enzyme cleavage site of EcoRⅤ and 15 - 20 nucleotides identical to the downstream of the EcoRⅤ cleavage site of the starting vector pIMEP were added to the 5’ end of the downstream primer of the OGDH gene nucleotide sequence to form a downstream homologous arm (primer sequence OGDH’-R). Using SEQ ID No.10 and SEQ ID No.11 in the sequence list as the upstream and downstream primers respectively, PCR reaction was carried out to amplify the OGDH and ermE* fusion gene with homologous arms.

[0079] PCR reaction system: 25 μL of 2×phanta max buffer, 1 μL of dNTP mixture (10 mM), 1 μL of template OGDH gene (20 μg / mL), 1 μL of template ermE* gene (20 μg / mL), 2 μL each of upstream and downstream primers ((10 μM)), 2 μL of DMSO, 1 μL of phanta max×Super-Fidelity DNA Polymerase, and supplemented with ultrapure water to 50 μL.

[0080] PCR reaction conditions: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 55 - 65°C for 15 s, extension at 72°C for 30 - 90 s, with a total of 25 - 35 cycles, final extension at 72°C for 5 min, and reaction ending at 4°C. The OGDH and ermE* fusion gene with homologous arms was obtained.

[0081] (4) Construction of the multi-gene recombinant plasmid pIMEP-MDH-OGDH containing MDH and OGDH genes

[0082] The OGDH and ermE* fusion gene fragment with homologous arms amplified by PCR was ligated with the linear plasmid pIMEP-MDH integrated with the strong promoter ermE* of erythromycin after single digestion with EcoRⅤ using homologous recombinase to obtain the recombinant plasmid pIMEP-MDH-OGDH as the ligation product.

[0083] Among them, the homologous recombination system is: 50 - 200 ng of linearized pIMEP-MDH vector plasmid, 50 - 200 ng of the inserted OGDH and ermE* fusion gene fragment, 4 μL of 5×CEⅡ Buffer, 2 μL of ExnaseⅡ, and supplemented with ultrapure water to 20 μL.

[0084] Homologous recombination conditions: react at 37°C for 30 min and then cool down to 4°C.

[0085] (5) Transformation and verification of the recombinant plasmid pIMEP-MDH-OGDH

[0086] Take 10 μL of the ligation product recombinant plasmid pIMEP-MDH-OGDH and add it to a centrifuge tube containing 100 μL of Escherichia coli DH5α competent cells in an ice bath. Slowly pipette and mix well, then place it in the ice bath and repeat tapping the tube wall every 15 min to ensure thorough mixing of the bacterial solution. After the ice bath, heat it in a metal bath at 42 °C for 80 s, and then perform an ice bath again for 5 min. After the ice bath, add 1 mL of LB medium preheated at 37 °C and sterilized to the centrifuge tube in a laminar flow hood, and repeat tapping the tube wall to mix well. Transfer the sample to a shaker at 37 °C and 200 r / min for shaking culture for 50 - 80 min. After the shaking is completed, centrifuge at 5000 r / min for 10 min and discard approximately 800 μL of the supernatant. Pipette the remaining liquid to mix well. Finally, appropriately aspirate 150 μL of the mixed bacterial solution according to the antibiotic concentration and quantity, and evenly spread it on the surface of an LB solid plate containing apramycin resistance using a spreading rod. Incubate the spread plate upside down in an incubator at 37 °C for 14 - 18 h until single colonies can be clearly observed. Pick a single colony of the transformant into an LB liquid medium containing 25 - 50 μg / mL apramycin, and shake it overnight at 37 °C and 180 - 200 r / min. Extract the plasmid of the transformant using a plasmid extraction kit (MiniBEST Plasmid Purification Kit Ver.4.0) or the conventional alkaline lysis method, and perform EcoRⅤ digestion verification on the extracted plasmid. Preserve the verified recombinant plasmid pIMEP-MDH-OGDH and the Escherichia coli DH5α positive transformant.

[0087] The results are as Figure 2 shown, Figure 2 verified whether the recombinant plasmid pIMEP-MDH-OGDH in the present invention was successfully constructed; among them, lane M: 10Kb marker; lane 1: EcoRV digestion of the recombinant plasmid pIMEP-MDH-OGDH; it can be seen from the figure that the overexpressed MDH-OGDH gene fragment was successfully integrated into the recombinant plasmid pIMEP-MDH-OGDH.

[0088] Example 3 Construction of the engineering strain S. diastatochromogenes MDH-OGDH

[0089] Integrate the recombinant plasmid pIMEP-MDH-OGDH into the S. diastatochromogenes 6#-7 genome using the method of plasmid conjugation transfer.

[0090] (1) First, culture the Escherichia coli DH5α positive transformant overnight with shaking at 37°C in an LB liquid medium containing 25 - 50 μg / mL apramycin. Then, extract the recombinant plasmid pIMEP - MDH - OGDH from the Escherichia coli DH5α positive transformant using the plasmid extraction kit (MiniBEST Plasmid Purification Kit Ver.4.0). Transform the recombinant plasmid into the helper strain Escherichia coli ET12567(pUZ8002) by chemical method, and spread the transformants on an LB plate containing 12.5 - 25 μg / mL kanamycin, 25 - 50 μg / mL apramycin, and 12.5 - 25 μg / mL chloramphenicol. Incubate the plate upside - down at 37°C for 24 h to obtain the Escherichia coli ET12567(pUZ8002) positive transformant.

[0091] (2) Pick a single colony of the Escherichia coli ET12567(pUZ8002) positive transformant containing the recombinant plasmid pIMEP - MDH - OGDH into 5 mL LB (containing three antibiotics with the same concentrations as in the previous step), and culture it overnight with shaking at 37°C. Then, transfer it to a fresh 50 mL LB liquid medium containing three antibiotics (antibiotic concentrations are the same as in the previous step) at an inoculation amount of 1%, and culture it with shaking at 180 r / min at 37°C until the OD 600 is between 0.4 - 0.6. Take 40 mL of the bacterial solution, centrifuge it at 8000 r / min for 5 min, discard the supernatant, wash the cells with fresh LB liquid medium 2 - 3 times to remove residual antibiotics, resuspend them in 1 mL of LB liquid medium, and place it on ice for later use to obtain the treated Escherichia coli ET12567(pUZ8002) positive transformant cell suspension. Add 10 mL of TES buffer with pH 8.0 to the plate where the spores of S. diastatochromogenes 6# - 7 grow well, scrape the spores with a sterile inoculation loop, pour them into a 250 mL Erlenmeyer flask containing glass beads, shake at 30°C and 180 r / min for 2 h to break the spore chains, then filter with sterile absorbent cotton to remove the mycelium, and collect the spore suspension. Heat - shock the spore suspension in a water bath at 50°C for 10 min and then immediately cool it to room temperature. Then add 10 mL of M3G liquid medium, culture it with shaking at 37°C for 2 - 3 h to germinate the spores, centrifuge at 5000 r / min for 5 min to collect the spores, and resuspend the germinated spore suspension of Streptomyces diastatochromogenes 6# - 7 in 1 mL of TES buffer with pH 8.0 for later use.

[0092] (3) Mix the prepared positive transformant cells of Escherichia coli ET12567 (pUZ8002) and the germinated spore suspension of S. diastatochromogenes 6#-7 in equal volumes, and evenly spread them on the SFM solid medium containing 5 mM MgCl2. After incubating at 30 °C in an inverted position for 14-18 h, cover the plate with 1 mL of sterile water containing 12.5-25 μL of nalidixic acid (concentration: 25 mg / mL) and 12.5-25 μL of apramycin (concentration: 25 mg / mL). After air-drying the plate, continue to incubate at 30 °C in an inverted position for 3-5 days to obtain the high-yield engineering strain Streptomyces diastatochromogenes MDH-OGDH.

[0093] The results are as Figure 3 shown, Figure 3 verified whether the genetic engineering strain S. diastatochromogenes MDH-OGDH in the present invention was successfully constructed; among them, lane M: 10Kb marker; lane 1: amplification map of the MDH-OGDH gene fragment integrated in S. diastatochromogenes MDH-OGDH; lane 2: no corresponding MDH-OGDH gene fragment in the S. diastatochromogenes control 6#-7; it can be seen from the figure that the overexpressed MDH-OGDH gene fragment was successfully integrated into the constructed high-yield engineering strain S. diastatochromogenes MDH-OGDH.

[0094] Example 4 Evaluation of the ε-polylysine production ability of the S. diastatochromogenes MDH-OGDH engineering strain

[0095] The method for batch-fed fermentation production of polylysine by using the high-yield engineering strain S. diastatochromogenes MDH-OGDH gene engineering strain constructed in Example 1 in a 5 L fermenter is as follows:

[0096] The high-yield engineering strain S. diastatochromogenes MDH-OGDH and the chassis strain S. diastatochromogenes 6#-7 were respectively transferred onto Bennet culture plates and cultured at 30 °C for about 5-7 days until spores were produced; then, a loopful of fresh spores was scraped and inoculated into a 500 mL volumetric flask containing 100 mL of M3G medium, and cultured at 30 °C and 180-220 r / min for 28-32 h. The seed solutions were respectively inoculated into a 5 L fermenter containing 3 L of fermentation medium at an inoculation amount of 10% (v / v). The initial pH was 6.8 and was controlled in two stages: in the first stage, the pH was controlled at 6.0 to facilitate the proliferation of the cells; in the second stage, when the glucose concentration in the fermentation broth dropped to 10 g / L, the pH was allowed to naturally drop to 4.0, and then 12.5% ammonia water was automatically added dropwise to maintain the pH at about 4.0. At the same time, a mixed solution of glucose and ammonium sulfate (800 g / L, 80 g / L) was added dropwise to control the glucose concentration at about 10 g / L to facilitate product formation; during the fermentation process, the temperature was controlled at 30 °C, the dissolved oxygen was controlled at 30%, the ventilation ratio was maintained at 1-2 vvm, and the stirring speed was correlated with the dissolved oxygen. During the fermentation process, the ε-polylysine yield, pH value, residual sugar concentration in the fermentation broth, and biomass of the two strains were measured.

[0097] Measurement of pH value: The pH electrode immersed in 3 mol / L KCl solution was calibrated by the two-point calibration method. Each batch of samples was inserted into the standard buffer solution (pH 6.86) as a quality control sample. The electrode was rinsed with deionized water and the residual liquid droplets were blotted dry with filter paper. The electrode was immersed in the test solution, and the liquid level needed to completely cover the glass membrane. Wait for the reading to stabilize and record the final pH value (accurate to 0.01). After each measurement, the electrode was rinsed repeatedly to prevent cross-contamination.

[0098] Measurement of glucose concentration: Take 6.0 mL of the fermentation broth (accurately measured) and place it in a 10 mL centrifuge tube. Centrifuge at 8000 r / min for 10 min at 4 °C to ensure complete separation of the solid and liquid phases. Carefully aspirate the supernatant, avoiding disturbing the bottom precipitate. Preheat the biosensing analyzer and accurately aspirate 25 μL of the diluted sample with a micro-syringe. Three technical replicates were set for each batch of samples.

[0099] Measurement of biomass: The numbered and weighed centrifuge tubes were placed in an oven and dried to a constant weight. A high-speed refrigerated centrifuge was used, and the parameters were set as: 6000 r / min, 6 min, 4 °C. After centrifugation, the supernatant was carefully discarded, and the precipitate was retained. The centrifuge tube was repeatedly washed with deionized water. It was placed in a vacuum dryer and dried to the constant weight of the cells. The dry weight of the cells was calculated from the weight difference before and after drying. Three technical replicates were set for each sample.

[0100] Determination of ε-polylysine content: The ε-polylysine standard curve and the ε-polylysine content in the shake flask fermentation broth were determined by colorimetry.

[0101] Drawing of the ε-polylysine colorimetric standard curve:

[0102] (1) Dilution of the ε-polylysine standard solution: The 0.10 g / L ε-polylysine standard solution was diluted proportionally with a phosphate buffer solution at pH 6.6 to a series of ε-polylysine standard concentrations of 0.01 g / L, 0.02 g / L, 0.03 g / L, 0.04 g / L, 0.05 g / L, 0.06 g / L, 0.07 g / L, 0.08 g / L, 0.09 g / L, and 0.10 g / L.

[0103] (2) Reaction: 2 mL of the prepared ε-polylysine standard series concentration solutions were taken respectively, and then 2 mL of 1 mM methyl orange solution was added respectively, mixed, and reacted with shaking at 140 r / min in a water bath at 30 °C for 30 min.

[0104] (3) Centrifugation and dilution: The reacted ε-polylysine and methyl orange mixture was transferred to a centrifuge and centrifuged at 4000 r / min for 15 min. The supernatant was diluted 50-fold with a phosphate buffer solution at pH 6.6.

[0105] (4) Determination of OD by spectrophotometer 465 : The absorbance of the above-mentioned determination solution diluted 50-fold was measured at 465 nm, using a phosphate buffer solution at pH 6.6 as the blank, and the OD 465 values measured for ε-polylysine solutions at various concentrations were recorded.

[0106] (5) Using the OD 465 value of the 50-fold dilution as the abscissa and the corresponding ε-polylysine standard concentration as the ordinate, a standard curve was drawn to obtain a linear regression equation.

[0107] Y = (-1.1172X + 0.2505) * 0.7785R 2 = 0.9994

[0108] (6) Determination of ε-polylysine content:

[0109] Centrifuge the fermentation broth cultured for a certain period of time at 8000 r / min for 5 min to remove cells. Appropriately dilute the fermentation supernatant according to the fermentation time to prepare a sample to be measured. Take an appropriate amount of the fermentation supernatant at different time points, and appropriately dilute it with pH 6.6 sodium phosphate buffer as the sample to be measured; take 4 mL of the sample and mix it with an equal volume of 1 mM methyl orange solution, and oscillate and react at 30 °C and 140 r / min for 30 min; after the reaction, centrifuge at 6000 r / min for 15 min and discard the precipitate; place the diluted sample in a pre-cleaned quartz cuvette, set the detection parameter OD465 of the spectrophotometer, and perform baseline calibration with an equal volume of buffer as the blank reference. Continuously measure the absorbance value three times and take the arithmetic mean, substitute it into the standard curve equation for quantitative calculation, and obtain the ε-PL sample concentration value.

[0110] The present invention focuses on the modification of multiple key genes. By overexpressing the key enzymes malate dehydrogenase gene MDH and α-ketoglutarate decarboxylase gene OGDH in the TCA pathway, the engineered strain S. diastatochromogenes MDH-OGDH is obtained, and ε-polylysine is produced by fed-batch fermentation. The ε-polylysine yield (g / L) is 137.18% of that of the starting chassis strain S. diastatochromogenes 6#-7; the production intensity (g / L·h) is 133.68% of that of the starting chassis strain S. diastatochromogenes 6#-7; the sugar-acid conversion rate is 116.04% of that of the starting chassis strain S. diastatochromogenes 6#-7, significantly reducing the production cost and providing an excellent strain for the industrial production of ε-polylysine.

Claims

1. A multi-gene overexpression engineered strain with high ε-polylysine production, characterized in that: Overexpress the malate dehydrogenase gene MDH and the α-ketoglutarate decarboxylase gene OGDH in the tricarboxylic acid cycle (TCA) simultaneously.

2. The multi-gene overexpression engineered strain for highly producing ε-polylysine according to claim 1, characterized in that: The sequences of the malate dehydrogenase gene MDH and the α-ketoglutarate decarboxylase gene OGDH in the tricarboxylic acid cycle (TCA) of the strain are SEQ No.1 and SEQ No.2 respectively.

3. The multi-gene overexpression engineered strain for highly producing ε-polylysine according to claim 1, wherein: The starting strain of the multi-gene overexpression engineering strain with high yield of ε-polylysine is S. diastatochromogenes 6#-7, and the strain preservation number is CGMCC No. 22261.

4. The method for constructing a multi-gene overexpression engineering strain for high-yield ε-polylysine according to any one of claims 1 to 3, characterized in that: The construction steps are as follows: (1) Extract the recombinant plasmid pIMEP-MDH-OGDH from the positive transformant of Escherichia coli E. coli DH5α, and then transform the extracted recombinant plasmid pIMEP-MDH-OGDH into Escherichia coli E. coli ET12567 / PUZ8002 to prepare a positive transformant of Escherichia coli E. coli ET12567 / PUZ8002; (2) Prepare a spore suspension of S. diastatochromogenes 6#-7; (3) Mix the positive transformant of Escherichia coli E. coli ET12567 / PUZ8002 in step (1) and the spores of germinated S. diastatochromogenes in step (2) in a volume ratio of 1:1, and obtain a genetically engineered strain with high yield of ε-polylysine through conjugation transfer.

5. The construction method according to claim 5, characterized in that: The construction steps of the positive transformant of Escherichia coli E. coli DH5α are as follows: Obtaining the target gene MDH: Design primer sequences MDH-F and MDH-R (SEQ ID No.3 and SEQ ID No.4) according to the malate dehydrogenase gene MDH. Use a kit or a conventional method to extract the genome of S. diastatochromogenes 6#-7 (preservation number CGMCC No. 22261) as a template, and PCR amplify the MDH gene with homologous arms, with a full length of 990 bp. The detailed MDH gene sequence is shown in the sequence list SEQ ID No.1; Design primer sequences OGDH-F and OGDH-R (SEQ ID No.5 and SEQ ID No.6) as upstream and downstream primers according to the α-ketoglutarate decarboxylase gene OGDH. Use a kit or a conventional method to extract the genome of S. diastatochromogenes 6#-7 (preservation number CGMCC No. 22261) as a template, and PCR amplify the OGDH gene with homologous arms, with a full length of 3468 bp. The detailed OGDH gene sequence is shown in sequence SEQ ID No.

2. Design primer sequences ermE-F and ermE-R according to the ermE* gene, and add 15-20 bp bases complementary to the 5'-end of the OGDH gene terminal to the 5'-end nucleic acid sequence of the ermE-F primer to form an overlapping strand; Using the pIMEP plasmid as a template, and using the sequences in SEQ ID No.8 and SEQ ID No.9 in the sequence listing as the upstream and downstream primers respectively, perform a PCR reaction to amplify the ermE* gene with overlapping strands, with a full length of 216 bp, and its gene sequence is SEQ ID No.7; Obtaining the OGDH and ermE* fusion gene: Design primer sequences OGDH’-F and OGDH’-R based on the OGDH gene with overlapping strands and the ermE* gene with overlapping strands, and use the strategy of single-enzyme digestion homologous recombination to construct the recombinant vector pIMEP-MDH-OGDH; Add EcoRⅤ restriction enzyme sites at both ends of the fusion gene. Among them, add an EcoRⅤ restriction enzyme site and 15-20 nucleotides identical to the upstream of the EcoRⅤ restriction enzyme site of the recombinant vector pIMEP-MDH at the 5’ end of the upstream nucleotide sequence of the OGDH gene to form an upstream homologous arm, and add an EcoRⅤ restriction enzyme site and 15-20 nucleotides identical to the downstream of the EcoRⅤ restriction enzyme site of the recombinant vector pIMEP-MDH at the 5’ end of the downstream nucleotide sequence of the ermE* gene to form a downstream homologous arm. Respectively use SEQ ID No.11 and SEQ ID No.12 as the upstream and downstream primers to perform a PCR reaction to amplify the OGDH and ermE* fusion gene with homologous arms; Among them, the sequences of each gene and amplification primers are as follows: The sequence of MDH is SEQ No.1; MDH-F: SEQ No.3; MDH-R: SEQ No.4; The sequence of ermE*: SEQ ID No.7; ermE-F: SEQ ID No.8; ermE-R: SEQ ID No.9; The sequence of OGDH is SEQ ID No.3; OGDH’-F: SEQ ID No.11; OGDH’-R: SEQ ID No.12; Ligate the PCR-amplified OGDH and ermE* fusion gene fragment with homologous arms and the linear plasmid pIMEP-MDH integrated with the strong promoter erythromycin promoter ermE* after EcoRⅤ single-enzyme digestion using a homologous recombinase to obtain the ligation product recombinant plasmid pIMEP-MDH-OGDH; Use the chemical transformation method to transform the recombinant plasmid pIMEP-MDH-OGDH into E.coli DH5α competent cells, and screen for E.coli DH5α positive transformants through apramycin resistance; Among them, the construction steps of the recombinant plasmid pIMEP-MDH are as follows: Using the genome of strain S.diastatochromogenes 6#-7 as a template, the MDH gene with homologous arms was amplified by PCR. An EcoRΙ restriction site and 15 nucleotides identical to the upstream of EcoRΙ of the starting vector pIMEP were added to the 5' end of the upstream of the MDH gene nucleotide sequence to form an upstream homologous arm. An EcoRΙ restriction site and 15 nucleotides identical to the downstream of EcoRΙ of the starting vector pIMEP were added to the 5' end of the downstream of the MDH nucleotide sequence to form a downstream homologous arm. The plasmid pIMEP integrated with the strong promoter erythromycin promoter ermE* was digested with EcoRΙ alone. The amplified MDH gene fragment with homologous arms was ligated to the linear plasmid pIMEP digested with EcoRΙ alone using a homologous recombinase to obtain the recombinant plasmid pIMEP-MDH; Among them, the construction steps of the recombinant plasmid pIMEP-OGDH are as follows: Using the genome of strain S.diastatochromogenes 6#-7 as a template, the OGDH gene (SEQ ID No.2) with homologous arms was amplified by PCR. An EcoRΙ restriction site and 15 nucleotides identical to the upstream of EcoRΙ of the starting vector pIMEP were added to the 5' end of the upstream of the OGDH gene nucleotide sequence to form an upstream homologous arm. An EcoRΙ restriction site and 15 nucleotides identical to the downstream of EcoRΙ of the starting vector pIMEP were added to the 5' end of the downstream of the OGDH nucleotide sequence to form a downstream homologous arm. The plasmid pIMEP integrated with the strong promoter erythromycin promoter ermE* was digested with EcoRΙ alone. The amplified OGDH gene fragment with homologous arms was ligated to the linear plasmid pIMEP digested with EcoRΙ alone using a homologous recombinase to obtain the recombinant plasmid pIMEP-OGDH.

6. The construction method according to claim 4 or 5, characterized in that: The specific steps are as follows: (1)Extract the recombinant plasmid pIMEP-MDH-OGDH from the E. coli DH5α positive transformants, and then transform the extracted recombinant plasmid pIMEP-MDH-OGDH into E. coli ET12567 / PUZ8002. Spread it on the LB plate containing 12.5 - 25 μg / mL kanamycin, 25 - 50 μg / mL apramycin, and 12.5 - 25 μg / mL chloramphenicol. Select the E. coli ET12567 / PUZ8002 positive transformants in the LB liquid medium containing the same concentrations of kanamycin, apramycin, and chloramphenicol, and culture them at 37 °C with shaking at 200 rpm / min for 10 - 12 h. Then transfer them to the LB liquid medium containing the same concentrations of kanamycin, apramycin, and chloramphenicol, and culture them at 37 °C with shaking until 600 OD 600 = 0.4 - 0.

6. Centrifuge to collect the cells, wash the cells with fresh LB liquid medium to remove the residual antibiotics, resuspend them in the LB liquid medium, and place them on ice for later use; (2) Add 1×TES buffer at pH 8.0 to the plate of S.diastatochromogenes 6#-7 strain that produces spores on Bennet medium. Scrape the S.diastatochromogenes 6#-7 spores and pour them into a container containing glass beads. Shake at 30 °C and 180 r / min for 45 - 60 min to break the spore chains. Filter through sterile absorbent cotton to remove hyphae, collect the spore suspension, heat shock at 50 °C in a water bath for 10 min, immediately cool the spore suspension to room temperature and then add it to the M3G medium. Incubate with shaking at 37 °C for 2 - 3 h to germinate the spores. Centrifuge at 5000 r / min for 5 min to collect the germinated spores, and resuspend the germinated S.diastatochromogenes 6#-7 spores with TES buffer for standby; (3) Mix the E. coli ET12567 / PUZ8002 positive transformant from step (1) and the germinated spores of S. diastatochromogenes from step (2) in a volume ratio of 1:1, and evenly spread them on the SFM medium containing 5 mM MgCl2. After incubating at 30 °C in an inverted position for 14 - 18 h, cover the plate with sterile water containing 25 mg / mL of nalidixic acid and 25 mg / mL of apramycin. After drying the plate, continue to incubate in an inverted position for 3 - 5 days, and select positive conjugant monoclonal colonies to obtain the genetically engineered high-yield ε-polylysine strain Streptomyces diastatochromogenes MDH-OGDH with high amylase production.

7. Use of the multi-gene overexpression engineered strain with high yield of ε-polylysine according to any one of claims 1 to 3 in the production of ε-polylysine.

8. A method for increasing the production of ε-polylysine, characterized in that: The method constructs a genetically engineered high-yield strain Streptomyces diastatochromogenes MDH-OGDH that overexpresses the malate dehydrogenase gene MDH and the α-ketoglutarate decarboxylase gene OGDH that affect ε-polylysine synthesis in the tricarboxylic acid cycle (TCA), and improves the fermentation level of ε-polylysine through the fermentation of the high-yield strain.

9. The method for increasing the yield of ε-polylysine according to claim 9, wherein: The production method of the fermentation is as follows: The strain used is the genetically engineered strain S. diastatochromogenes MDH-OGDH. Inoculate the genetically engineered strain on a Bennett medium plate and incubate at 30 °C until gray conidia are produced; inoculate the spores into a shake flask of M3G medium containing glucose and incubate at 30 °C and 200 r / min for 28 - 32 h. Transfer the cultured seed liquid to a fermenter of M3G medium, and at the same time, feed a mixed carbon and nitrogen source for fermentation for 220 - 240 h to obtain a fermentation broth containing ε-polylysine.

Citation Information

Patent Citations

  • Method for constructing gene engineering streptomyces diastatochromogenes and improving yield of epsilon-polylysine and application

    CN114231474A

  • Streptomyces albidogensis genetic engineering strain with high yield of epsilon-polylysine as well as construction method and application of streptomyces albidogensis genetic engineering strain

    CN116622606A