A recombinant microorganism and its application in fermentation production of decarboxylated carnosine

Abstract

The present invention relates to the field of microbial technology, and specifically discloses a recombinant microorganism and its application in the fermentation production of decarboxylated carnosine. The recombinant microorganism of the present invention has enhanced mdtK The starting strain is Escherichia coli capable of producing decarboxylated carnosine. Fermentation production using the recombinant microorganism of the present invention can increase the yield of decarboxylated carnosine without adding precursors such as L-histidine, histamine, or β-alanine during the production process, thereby providing an effective new method for the industrial production of decarboxylated carnosine.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, in particular to a recombinant microorganism and application thereof in fermentation production of decarboxylated carnosine. Background Art

[0002] Decarboxylated carnosine is a dipeptide composed of β-alanine and histamine. It was first discovered in crustaceans and has also been found in mammalian tissues such as the heart, kidney, and gastrointestinal tract. Decarboxylated carnosine exhibits anti-glycation, antioxidant, anti-inflammatory, and reparative properties, and is widely used in cosmetics. Furthermore, decarboxylated carnosine exhibits pharmacological activities such as neuronal activation, and has application value in the treatment of conditions such as epilepsy and motor or cognitive impairment. Decarboxylated carnosine can be prepared by chemical synthesis or enzymatic methods. Compared to these two methods, the microbial fermentation method uses glucose as a raw material and does not require the addition of precursors such as L-histidine, histamine, or β-alanine. It offers advantages such as low cost, mild reaction conditions, high production efficiency, and environmental friendliness, making it suitable for large-scale industrial production.

[0003] Decarboxylated carnosine is synthesized by microbial fermentation in Escherichia coli. The process is as follows: glucose is used to synthesize L-histidine and L-aspartic acid. L-histidine is synthesized by hdc Genetically encoded histidine decarboxylase catalyzes the production of histamine, and L-aspartate is converted to panD Gene-encoded aspartate-α-decarboxylase catalyzes the production of β-alanine. Histamine and β-alanine are then ebony Genes encoding nonribosomal peptide synthetases and sfp Genetically encoded phosphopantetheinyltransferase catalyzes the production of decarboxylated carnosine. Transport is a key factor influencing the yield of microbial fermentation products. Enhancing product transport outside the cell can avoid the metabolic burden and feedback inhibition caused by intracellular accumulation of the product, thereby maximizing yield. However, the effectiveness of the transporter protein expressed in Escherichia coli for the transport of decarboxylated carnosine is unknown, necessitating further research to improve the yield of the target product. Summary of the Invention

[0004] One of the purposes of the present invention is to provide a new recombinant microorganism that can increase the production of decarboxylated carnosine.

[0005] The present invention provides a recombinant microorganism, which has enhanced mdtK Gene expression; the starting strain is Escherichia coli that can produce decarboxylated carnosine.

[0006] The present invention provides a novel recombinant microorganism capable of increasing the production of decarboxylated carnosine. By overexpressing a specific transporter protein, the microorganism effectively promotes the excretion of decarboxylated carnosine outside the cell without negatively impacting decarboxylated carnosine production, thereby increasing decarboxylated carnosine production. Furthermore, the recombinant microorganism of the present invention eliminates the need for the addition of precursors such as L-histidine, histamine, or β-alanine during the production process, thereby reducing production costs.

[0007] In the recombinant microorganism of the present invention, the overexpression mdtK The gene is expressed by making the starting strain contain mdtK This can be achieved by inserting the gene into the plasmid mdtK The gene is integrated into the genome of the starting strain.

[0008] Those skilled in the art can realize mdtK Overexpression of genes, regardless of additional integration into the genome mdtK Whether expressing the gene or expressing it through a plasmid, the recombinant microorganism can achieve the effect of increasing the fermentation yield of decarboxylated carnosine.

[0009] In the recombinant microorganism of the present invention, the enhanced mdtK The gene expression method is selected from any one of the following 1) to 6), or any combination thereof:

[0010] 1) By importing with mdtK plasmids containing genes;

[0011] 2) By increasing the amount of mdtK Gene copy number;

[0012] 3) By changing the E. coli chromosome mdtK promoter sequence of the gene;

[0013] 4) By combining a strong promoter with the mdtK The genes are operably linked;

[0014] 5) By importing mdtK enhancers of genes;

[0015] 6) By using genes encoding high-activity corresponding enzymes or proteins or mdtK Homologous genes are enhanced.

[0016] In the recombinant microorganism of the present invention, the gene encoding the high-activity corresponding enzyme or protein is codon-optimized. mdtK Gene.

[0017] In the recombinant microorganism of the present invention, the starting strain overexpresses hisGDCBHAFI Gene fragments, expressing exogenous panD Gene, hdc Gene, sfp Genes and ebony Gene.

[0018] In the recombinant microorganism of the present invention, the hisGDCBHAFI Genes from Escherichia coli ; panD Genes from Bacillus subtilis or Corynebacterium g lutamicum ; hdc Genes from Photobacterium phosphoreum ; sfp Genes from Bacillus subtilis ; ebony Genes from Drosophila melanogaster or Zeugodacus cucurbitae .

[0019] Preferably, in the recombinant microorganism of the present invention, the hisGDCBHAFI The gene fragment is shown in SEQ ID NO: 1.

[0020] The recombinant E. coli capable of producing decarboxylated carnosine in the present invention can be different, in which the transporter gene is overexpressed. mdtK Afterwards, the production of decarboxylated carnosine can be increased.

[0021] The present invention also provides the use of the recombinant microorganism in the fermentation production of decarboxylated carnosine.

[0022] The present invention also provides the use of the recombinant microorganism in transforming microorganisms for producing decarboxylated carnosine or improving the yield of decarboxylated carnosine synthesized by biological methods.

[0023] The present invention also provides a method for producing decarboxylated carnosine by fermentation, which comprises the step of culturing the above-mentioned recombinant microorganism.

[0024] The present invention also provides a method for constructing a recombinant microorganism for producing decarboxylated carnosine, which comprises enhancing the mdtK The step of gene expression; the starting strain is Escherichia coli that can produce decarboxylated carnosine.

[0025] In the method of the present invention, the starting strain overexpresses hisGDCBHAFI Gene fragments, expressing exogenous panD Gene, hdc Gene, sfp Genes and ebony Gene;

[0026] and / or, enhance mdtK The gene expression method is selected from any one of the following 1) to 6), or any combination thereof:

[0027] 1) By importing with mdtK plasmids containing genes;

[0028] 2) By increasing the amount of mdtK Gene copy number;

[0029] 3) By changing the E. coli chromosome mdtK Gene promoter sequence;

[0030] 4) By combining a strong promoter with the mdtK The genes are operably linked;

[0031] 5) By importing mdtK enhancers of genes;

[0032] 6) By using genes encoding high-activity corresponding enzymes or proteins or mdtK Homologous genes are enhanced.

[0033] The beneficial effects of the present invention are at least:

[0034] The present invention provides a new recombinant microorganism, which can produce decarboxylated carnosine, thereby obtaining a higher yield and eliminating the need to add precursors such as L-histidine, histamine or beta-alanine during the production process, thereby saving production costs. DETAILED DESCRIPTION

[0035] The preferred embodiments of the present invention will be described in detail below with reference to the examples. It should be understood that the following examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0036] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following examples are all commercially available or prepared according to conventional methods in the art.

[0037] Example 1: Construction and transformation of decarboxylated carnosine production strains

[0038] 1. Construction of decarboxylated carnosine production strain:

[0039] The gene fragment was amplified using the Escherichia coli MG1655 genome as a template using primers hisG-F (atgacagacaacactcgtttacgcatag, SEQ ID NO: 7) and hisI-R (tcactgatgccgtttacgcagg, SEQ ID NO: 8). hisGDCBHAFI (sequence as shown in SEQ ID NO: 1), hisGDCBHAFI The fragment was ligated to the pTrc99a plasmid (purchased from Addgene plasmid, plasmid catalog number 155179) backbone to obtain the recombinant plasmid pTrc99a-hisGDCBHAFI.

[0040] use Bacillus subtilis Source BspanD gene (sequence shown in GenBank: 939033) and Photobacterium phosphoreum Source Pphdc Gene (sequence shown in GenBank: AAO65983.1), artificially synthesized Ptrc promoter controlled BspanD Genes and Pphdc The gene expression module Ptrc-BspanD-Pphdc has a sequence as shown in SEQ ID NO: 2. The Ptrc-BspanD-Pphdc fragment was ligated into the pCDFDuet-1 plasmid (purchased from Addgene plasmid, plasmid catalog number 172718) backbone to obtain the recombinant plasmid pCDF-BspanD-Pphdc.

[0041] use Bacillus subtilis Source sfp gene (sequence shown in GenBank: BAA09125.1) and Drosophila melanogaster Source Dmebony gene (sequence shown in GenBank: CAA11962.1), and Dmebony The gene sequence was optimized for E. coli codons and the Ptrc promoter was artificially synthesized. sfp Genes and Dmebony The gene expression module Ptrc-sfp-Dmebony has a sequence shown in SEQ ID NO: 3. The Ptrc-sfp-Dmebony fragment was ligated to the pBbA1k plasmid (purchased from Addgene plasmid, plasmid catalog number 35336) backbone to obtain the recombinant plasmid pBbA1k-sfp-Dmebony.

[0042] The recombinant plasmids pTrc99a-hisGDCBHAFI, pCDF-BspanD-Pphdc and pBbA1k-sfp-Dmebony were transformed into MG1655 by electroporation to obtain the recombinant strain STR01.

[0043] 2. Construction of a decarboxylated carnosine production strain expressing the transporter gene using a plasmid:

[0044] Select 10 specific Escherichia coli genomes for efflux-related transporter genes acrD , acrF , fsr , emrD , emrE , mdfA , mdtG , mdtK , bcr and kefG The corresponding NCBI numbers are AAC75523.1, AAC76298.1, AAC73581.1, AAC76696.2, AAC73644.1, AAC73929.1, AAC74137.1, AAT48136.1, AAC75243.1, and AAC76376.1. The gene sequences were amplified from the Escherichia coli genome as templates and constructed on the plasmid pBbA1k-sfp-Dmebony by Gibson assembly, respectively. The plasmids pBbA1k-sfp-Dmebony-acrD, pBbA1k-sfp-Dmebony-acrF, pBbA1k-sfp-Dmebony-fsr, pBbA1k-sfp-Dmebony-emrD, and pBbA1k-sfp-Dmebony-emrD expressing the 10 transporter genes were obtained. pBbA1k-sfp-Dmebony-emrE, pBbA1k-sfp-Dmebony-mdfA, pBbA1k-sfp-Dmebony-mdtG, pBbA1k-sfp-Dmebony-mdtK, pBbA1k-sfp-Dmebony-bcr and pBbA1k-sfp-Dmebony-kefG.

[0045] The transporter gene expression plasmid pBbA1k-sfp-Dmebony-acrD and the recombinant plasmids pTrc99a-hisGDCBHAFI and pCDF-BspanD-Pphdc were transformed into MG1655 by electroporation to obtain the transporter gene expressed by the plasmid. acrD Similarly, the remaining nine transporter gene expression plasmids were transformed into MG1655 with the recombinant plasmids pTrc99a-hisGDCBHAFI and pCDF-BspanD-Pphdc by electroporation to obtain decarboxylated carnosine-producing strains STR03 to STR11, respectively, expressing the transporter genes in these plasmids.

[0046] The recombinant strains STR01 to STR11 were cultured overnight on LB plates, and single colonies were picked and inoculated into test tubes containing 5 mL of LB medium. The cultures were cultured at 37°C and 200 rpm for 12 hours. The inoculum size was then inoculated into a 500 mL baffled shake flask containing 50 mL of fermentation medium. The cultures were cultured at 37°C and 200 rpm until the OD600 reached 0.6. 0.1 mM IPTG was then added, and the culture temperature was lowered to 25°C. The cultures were then cultured for 48 hours. The fermentation medium formula (1 L) included: 20 g glucose, 0.8 g magnesium sulfate heptahydrate, 4 g diammonium phosphate, 6.67 g potassium dihydrogen phosphate, 1.35 g potassium citrate, 20.9 g 3-morpholinopropanesulfonic acid, 2.5 g yeast extract, 50 mg ferrous sulfate heptahydrate, 10 mg calcium chloride dihydrate, 11 mg zinc sulfate heptahydrate, 2.5 mg manganese sulfate tetrahydrate, 5 mg copper sulfate pentahydrate, 0.5 mg ammonium molybdate, and 0.1 mg sodium borate decahydrate. Samples fermented for 48 h were analyzed for product concentration by high-performance liquid chromatography, and strain growth was monitored by spectrophotometry. The results are shown in Table 1.

[0047] Table 1

[0048]

[0049] The above results show that the transporter gene expressed by plasmid mdtK The strain STR09, which was not expressed with a plasmid for transporter gene, showed a 51.22% increase in the production of decarboxylated carnosine, and the OD 600 Basically the same, indicating that the transporter gene is expressed by plasmid mdtK It can significantly increase the production of decarboxylated carnosine without affecting the accumulation of bacteria.

[0050] Example 2: Integration and expression in Escherichia coli mdtK Effects of genes on decarboxylated carnosine production

[0051] 1. Use the Ptrc promoter in the Escherichia coli genome lacZ Site-integrated expression mdtK Gene:

[0052] Escherichia coli-derived mdtK Gene, artificially synthesized under the control of Ptrc promoter mdtK The gene expression module Ptrc-mdtK (sequence number 4) was amplified using the Escherichia coli MG1655 (ATCC 700926) genome as a template using primers lacZ-UF (gctggttgccaacgatcagatgg, SEQ ID NO:9) and lacZ-UR (gccggatgattaattgtcaaagcctggggtgcctaatgagt, SEQ ID NO:10) to generate the upstream homology arm lacZ-U. The downstream homology arm lacZ-D was amplified using primers lacZ-DF (tgcaacgagcatcccgctaataataaccgggcaggccatgtc, SEQ ID NO:11) and lacZ-DR (aaattcgaaattactgcgacggctg, SEQ ID NO:12). Overlap extension PCR was performed on the lacZ-U, Ptrc-mdtK, and lacZ-D fragments to generate the target fragment lacZ-Donor. Plasmid pTargeF (purchased from Addgene plasmid, plasmid catalog number 62226) was used as a template and primers pTarget-lacZ-F (gcgctgggtcggttacggccgttttagagctagaaatagcaagttaaaataaggctag, SEQ ID NO: 13) and pTarget-lacZ-R (ggccgtaaccgacccagcgcactagtattatacctaggactgagctagctg, SEQ ID NO: 14) were used to amplify the plasmid pTarget-lacZ. The targeting fragment lacZ-Donor, plasmid pTarget-lacZ, and plasmid pCas (purchased from Addgene plasmid, plasmid catalog number 62225) were transformed into Escherichia coli MG1655 by electroporation to obtain the target gene in the E. coli genome. lacZ Site-integrated expression mdtK The recombinant plasmids pTrc99a-hisGDCBHAFI, pCDF-BspanD-Pphdc and pBbA1k-sfp-Dmebony were transformed into STR12 by electroporation to obtain the recombinant strain STR13.

[0053] 2. Integrated expression mdtK Effects of genes on decarboxylated carnosine production:

[0054] According to the fermentation method in Example 1, the recombinant strains STR01 and STR13 were fermented. The 48h detection results showed that the decarboxylated carnosine production in the fermentation broth of the STR01 and STR13 strains was 0.79 g / L and 1.08 g / L, respectively, indicating that the integrated expression mdtK The gene can increase the production of decarboxylated carnosine by 36.71%.

[0055] Example 3: Verification of decarboxylated carnosine production strains constructed using genes from different sources mdtK The effect of genes

[0056] 1. Construction of decarboxylated carnosine production strain:

[0057] use Corynebacterium g lutamicum Source CgpanD gene (sequence shown in GenBank: 1021120) and Photobacterium phosphoreum Source Pphdc Gene, artificially synthesized under the control of Ptrc promoter CgpanD Genes and Pphdc The gene expression module Ptrc-CgpanD-Pphdc has a sequence as shown in SEQ ID NO: 5. The Ptrc-CgpanD-Pphdc fragment was ligated into the pCDFDuet-1 plasmid (purchased from Addgene plasmid, plasmid catalog number 172718) backbone to obtain the recombinant plasmid pCDF-CgpanD-Pphdc.

[0058] use Bacillus subtilis Source sfp Genes and Zeugodacus cucurbitae Source Zcebony gene (sequence shown in NCBI: XP_011180928.2), and Zcebony The gene sequence was optimized for E. coli codons and the Ptrc promoter was artificially synthesized. sfp Genes and Zcebony The gene expression module Ptrc-sfp-Zcebony (SEQ ID NO:6) was ligated into the pBbA1k plasmid (Addgene plasmid, Catalog No. 35336) to generate the recombinant plasmid pBbA1k-sfp-Zcebony. The recombinant plasmids pTrc99a-hisGDCBHAFI, pCDF-CgpanD-Pphdc, and pBbA1k-sfp-Zcebony were then electroporated into MG1655 to generate the recombinant strain STR14.

[0059] 2. Expression using plasmid mdtK Construction of decarboxylated carnosine producing strain:

[0060] Amplification using the Escherichia coli genome as a template mdtK The gene sequence was constructed on the plasmid pBbA1k-sfp-Zcebony by Gibson assembly to obtain the recombinant plasmid pBbA1k-sfp-Zcebony-mdtK. The recombinant plasmid pBbA1k-sfp-Zcebony-mdtK, pTrc99a-hisGDCBHAFI, pCDF-CgpanD-Pphdc were transformed into MG1655 by electroporation to obtain the expression of plasmids. mdtK Gene of the decarboxylated carnosine-producing strain STR15.

[0061] 3. Verification of decarboxylated carnosine production strains constructed from genes from different sources mdtK Effects of genes:

[0062] According to the fermentation method in Example 1, the recombinant strains STR14 and STR15 were fermented. The 48h detection results showed that the decarboxylated carnosine production in the fermentation broth of STR14 and STR15 strains was 0.24g / L and 0.37g / L, respectively. mdtK The gene can increase the production of decarboxylated carnosine by 54.17%, indicating that the expression of decarboxylated carnosine in the decarboxylated carnosine production strains constructed by genes from different sources is mdtK The effects of genetically increasing decarboxylated carnosine production are consistent.

[0063] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. A recombinant microorganism, characterized in that Compared with the starting strain, the recombinant microorganism has enhanced mxDV Gene expression; The starting strain is an Escherichia coli that can produce decarboxylated carnosine; The starting strain overexpresses hisGDCBHAFI Gene fragments, expressing exogenous panD Gene, hdc Gene, sfp Genes and ebony Gene; described hisGDCBHAFI Genes from Escherichia coli ; panD Genes from Bacillus subtilis or Corynebacterium glutamicum ; hdc Genes from Photobacterium phosphoreum ; described sfp Genes from Bacillus subtilis ; ebony Genes from Drosophila melanogaster or Zeugodacus cucurbitae ; described mxDV The NCBI accession number of the gene is AAT48136.1; described hisGDCBHAFI The nucleotide sequence of the gene is shown in SEQ ID NO: 1; described panD The NCBI accession number of the gene is 939033 or 1021120; described hdc The NCBI accession number of the gene is AAO65983.1; described sfp The NCBI accession number of the gene is BAA09125.1; described ebony The NCBI accession number of the gene is CAA11962.1 or XP_011180928.

2.

2. The recombinant microorganism according to claim 1, characterized in that The enhancement mxDV The gene expression method is selected from any one of the following 1) to 2), or an optional combination: 1) By importing with mxDV plasmids containing genes; 2) By increasing the amount of mxDV The copy number of the gene.

3. the application of the recombinant microorganism described in any one of claim 1-2 in fermentative production of decarboxylated carnosine.

4. the application of the recombinant microorganism described in any one of claim 1-2 in the microbial transformation for the production of decarboxylated carnosine or in improving the output of biological synthesis of decarboxylated carnosine.

5. A method for producing decarboxylated carnosine by fermentation, characterized in that: The method comprises the step of culturing the recombinant microorganism according to any one of claims 1 to 2.

6. A method for constructing a recombinant microorganism for producing decarboxylated carnosine, characterized in that: Including enhanced starting strains mxDV The step of gene expression; the starting strain is Escherichia coli that can produce decarboxylated carnosine; The starting strain overexpresses hisGDCBHAFI Gene fragments, expressing exogenous panD Gene, hdc Gene, sfp Genes and ebony Gene; described hisGDCBHAFI Genes from Escherichia coli ; panD Genes from Bacillus subtilis or Corynebacterium glutamicum ; described hdc Genes from Photobacterium phosphoreum ; described sfp Genes from Bacillus subtilis ; ebony Genes from Drosophila melanogaster or Zeugodacus cucurbitae ; described mxDV The NCBI accession number of the gene is AAT48136.1; described hisGDCBHAFI The nucleotide sequence of the gene is shown in SEQ ID NO: 1; described panD The NCBI accession number of the gene is 939033 or 1021120; described hdc The NCBI accession number of the gene is AAO65983.1; described sfp The NCBI accession number of the gene is BAA09125.1; described ebony The NCBI accession number of the gene is CAA11962.1 or XP_011180928.

2.

7. The method according to claim 6, characterized in that Enhancement mxDV The gene expression method is selected from any one of the following 1) to 2), or an optional combination: 1) By importing with mxDV plasmids containing genes; 2) By increasing the amount of mxDV The copy number of the gene.

Images