Escherichia coli endogenous alcohol dehydrogenase EcYjgB mutant and application thereof

By performing site-directed mutation of E. coli endogenous alcohol dehydrogenase EcYjgB, a recombinant strain was constructed, and a sodium formate coenzyme regeneration system was used to solve the problems of high production costs and unfriendly environmental problems in the existing technology, and an efficient and economical synthesis of 2,5-furandimethanol and furfuryl alcohol were achieved.

CN120290502APending Publication Date: 2025-07-11SOUTH CHINA UNIV OF TECH
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510266590.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-07
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

In the prior art, when the synthesis of 2,5-furandimethanol and furfuryl alcohol is catalyzed by E. coli endogenous alcohol dehydrogenase EcYjgB, the coenzyme regeneration system depends on glucose, resulting in high production costs, unfriendly environment and many by-products.

Method used

By performing site-directed mutation of E. coli endogenous alcohol dehydrogenase EcYjgB, a recombinant strain can be constructed, so that it can use the more economical coupling of the cosubstrate sodium formate to be coupled with the formic dehydrogenase, to achieve efficient regeneration of coenzyme NADH and catalyze the reduction reaction of 5-hydroxymethylfurfural or furfural.

Benefits of technology

The efficient catalytic synthesis of 2,5-furandimethanol and furfuryl alcohol was achieved, reducing production costs and environmental impacts, and the by-product is CO2, which simplifies the product separation and purification process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290502A_ABST
    Figure CN120290502A_ABST
Patent Text Reader

Abstract

The invention discloses an Escherichia coli endogenous alcohol dehydrogenase EcYjgB mutant and application thereof. The mutant is obtained by performing any one of the following mutations (a) to (c) on Escherichia coli endogenous alcohol dehydrogenase EcYjgB as shown in SEQ ID NO.1: (a) mutating serine at the 200th site into arginine; (b) the serine at the 199th site is mutated into aspartic acid, and the serine at the 200th site is mutated into arginine; and (c) the serine at the 199th site is mutated into aspartic acid, the serine at the 200th site is mutated into arginine, and the asparagine at the 240th site is mutated into tryptophan. The mutant is used for efficiently catalyzing reduction of HMF or furfural to respectively synthesize BHMF and furfuryl alcohol, so that the purposes of improving the production efficiency, reducing the production cost and improving the environmental effect are achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomanufacturing, and relates to a mutant of Escherichia coli endogenous alcohol dehydrogenase EcYjgB and its application. Background Art

[0002] 2,5 - Furandimethanol (BHMF) is a structurally symmetric and stable furan diol, which can be used as a precursor for the production of bio - based polymers such as polyesters, polyurethanes, and polyethers. Furfural alcohol is an important raw material in the fields of polymers, food, and pharmaceuticals. Currently, there are many ways to chemically catalyze the synthesis of BHMF and furfural alcohol. Usually, hydrogen is used as a hydrogen donor, and metal catalysts are used to catalyze the reduction of 5 - hydroxymethylfurfural (HMF) or furfural to obtain them. In contrast, biocatalytic preparation of BHMF and furfural alcohol has the advantages of mild reaction conditions, high reaction selectivity, and environmentally friendly process. Selecting suitable enzymes / cells as biocatalysts for large - scale production of BHMF or furfural alcohol has important economic value and practical significance.

[0003] EcYjgB is an alcohol dehydrogenase from Escherichia coli, belonging to the cinnamyl alcohol dehydrogenase (CAD) subfamily in the medium - chain dehydrogenase / reductase (MDR) superfamily, and shows high catalytic activity towards aldehyde derivatives with aromatic rings or small aliphatic chains. Alcohol dehydrogenase (ADH) catalyzes reduction reactions that require the consumption of stoichiometric amounts of reduced coenzymes. Therefore, in addition to selecting highly active enzymes and suitable catalytic conditions for its catalytic application, it must also rely on an efficient coenzyme regeneration system. Wild - type EcYjgB shows an obvious coenzyme preference for nicotinamide adenine dinucleotide phosphate (NADPH), and has weak catalytic activity towards NADH. It has been reported that glucose dehydrogenase (GDH) / glucose is used as an NADPH regeneration system to drive wild - type EcYjgB to catalyze the reduction of 5 - hydroxymethylfurfural (HMF) or furfural to synthesize the corresponding BHMF and furfural alcohol. However, in industrial production, using glucose as a co - substrate to regenerate NADPH has the following disadvantages: 1) The price of glucose is relatively high, which will significantly increase the production cost of the target product; 2) After glucose is oxidized by GDH, by - product gluconolactone is produced, which then spontaneously hydrolyzes to gluconic acid, causing the pH of the reaction system to decrease. Therefore, during the synthesis of BHMF or furfural alcohol, alkali needs to be continuously added for neutralization, thus increasing the production cost; 3) The environmental factor of this process is relatively high. For example, theoretically, 1.7 kg of sodium gluconate is produced as a by - product (i.e., waste) for every 1 kg of BHMF synthesized. Therefore, there is an urgent need to develop an economical, mild - reaction - condition, efficient, and environmentally friendly synthesis method. Summary of the Invention

[0004] Aiming at the problems existing in the prior art, the purpose of the present invention is to provide a method for synthesizing BHMF and furfural alcohol with high efficiency, high selectivity, and high substrate concentration.

[0005] The object of the present invention is achieved by the following technical solutions:

[0006] A mutant of Escherichia coli endogenous alcohol dehydrogenase EcYjgB, wherein the mutant is any one of the following (a) to (c):

[0007] (a) Obtained by mutating serine at position 200 of Escherichia coli endogenous alcohol dehydrogenase EcYjgB shown in SEQ ID NO.1 to arginine, and its amino acid sequence is shown in SEQ ID NO.3;

[0008] (b) Obtained by mutating serine at position 199 of Escherichia coli endogenous alcohol dehydrogenase EcYjgB shown in SEQ ID NO.1 to aspartic acid and serine at position 200 to arginine, and its amino acid sequence is shown in SEQ ID NO.5;

[0009] (c) Obtained by mutating serine at position 199 of Escherichia coli endogenous alcohol dehydrogenase EcYjgB shown in SEQ ID NO.1 to aspartic acid, serine at position 200 to arginine, and asparagine at position 240 to tryptophan, and its amino acid sequence is shown in SEQ ID NO.7.

[0010] Preferably, the gene sequences are SEQ ID NO.4, SEQ ID NO.6 and SEQ ID NO.8.

[0011] A recombinant plasmid carrying the gene encoding the alcohol dehydrogenase EcYjgB mutant and the formate dehydrogenase gene.

[0012] Preferably, the recombinant plasmid is the pET-Duet-1 plasmid carrying the above two genes.

[0013] Preferably, the T7 promoter sequence upstream of the second multiple cloning site (MCS-2) in the pET-Duet-1 plasmid is mutated from the original TAATACGACTCACTATAGG to GAAATTAATACGACTCACTATAGGGAGACCACAAC (SEQ ID NO.9)

[0014] , and / or the ribosome binding site (RBS) sequence upstream of the second multiple cloning site (MCS-2) in the pET-Duet-1 plasmid is mutated from the original ATTAGTTAAGTATAAGAAGGAGA to AAAGAGGGGAAA (SEQ ID NO.10).

[0015] A recombinant bacterium, which is obtained by introducing the recombinant plasmid into a host bacterium. Preferably, the host bacterium is Escherichia coli E. coli BL21(DE3).

[0016] Use of the above mutant, gene, recombinant plasmid and recombinant bacterium in the synthesis of 2,5-furandimethanol or furfuryl alcohol.

[0017] Preferably, the wet cells obtained after the recombinant bacterium is induced to express are used as a catalyst, 5-hydroxymethylfurfural or furfural is used as a substrate, sodium formate is used as a co-substrate, and phosphate buffer is used as a reaction medium, and 2,5-furandimethanol or furfuryl alcohol is obtained after the reaction.

[0018] Preferably, the substrate concentration is 0.1 - 0.5 mol / L, and the co-substrate concentration is 1.2 - 2 times the equivalent of the substrate concentration.

[0019] Preferably, the reaction temperature is 20 - 40 °C, the pH of the phosphate buffer is 6 - 8, the cell concentration is 50 - 100 mg / mL, and the reaction time is 0.5 - 10 h.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention aims to modify the endogenous alcohol dehydrogenase EcYjgB of Escherichia coli by site-directed mutagenesis technology, and based on this mutant, a gene expression engineering strain that can use the more economical co-substrate sodium formate to achieve efficient coenzyme regeneration is constructed, enabling it to efficiently utilize the coenzyme nicotinamide adenine dinucleotide (NADH), so that it can be coupled with the formate dehydrogenase (FDH) / sodium formate regeneration system for efficient catalytic reduction of HMF or furfural to synthesize BHMF and furfuryl alcohol respectively, so as to achieve the purpose of improving production efficiency, reducing production costs and improving environmental effects. Compared with glucose, sodium formate as a co-substrate is not only cheaper, but also the pH of the system does not change during the reaction, and at the same time, CO2 is produced as the only by-product, which not only has a lower environmental impact, but also is conducive to the separation and purification of the product. Description of the Drawings

[0022] Figure 1 It is the agarose gel electrophoresis pattern of EcYjgB and its mutant gene; Lane M: Marker; Lanes 1 - 4: wild-type EcYjgB, mutant S, mutant D, mutant T.

[0023] Figure 2 It is the liquid chromatography diagram of HMF and BHMF sample analysis (the maximum absorption wavelength of HMF is 283 nm, and the retention time is 9.6 min; the maximum absorption wavelength of BHMF is 223 nm, and the retention time is 7.9 min).

[0024] Figure 3 Liquid chromatogram for the analysis of furfural and furfuryl alcohol samples (the maximum absorption wavelength of furfural is 277 nm, and the retention time is 6.3 min; the maximum absorption wavelength of furfuryl alcohol is 215 nm, and the retention time is 5.3 min).

[0025] Figure 4 Changes in the initial reaction rate of whole-cell catalysis after replacing different promoters.

[0026] Figure 5 Changes in the initial reaction rate of whole-cell catalysis after replacing different RBSs.

[0027] Figure 6 Changes in the initial reaction rate of whole-cell catalysis after optimizing the promoter and RBS.

[0028] Figure 7 Reaction process curve of the co-expressed recombinant bacterium for the enlarged synthesis of BHMF in Example 13.

[0029] Figure 8 1H NMR spectrum of BHMF prepared in the enlarged synthesis of Example 13. Detailed implementation manners

[0030] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it.

[0031] Example 1: Obtaining mutants of Escherichia coli endogenous alcohol dehydrogenase EcYjgB

[0032] The amino acid sequence of wild-type Escherichia coli alcohol dehydrogenase EcYjgB is shown in SEQ ID NO.1, and the gene sequence is shown in SEQ ID NO.2. The gene sequence of formate dehydrogenase is shown in SEQ ID NO.11.

[0033] The mutants of Escherichia coli endogenous alcohol dehydrogenase EcYjgB were constructed by the whole-plasmid PCR method. The primers containing the mutation sites are shown in Table 1. Primer synthesis and recombinant plasmid sequencing were completed by Sangon Biotech (Shanghai) Co., Ltd.

[0034] Table 1. Primer design for mutants of Escherichia coli endogenous alcohol dehydrogenase EcYjgB

[0035]

[0036] Using the recombinant vector pET-28a-EcYjgB carrying the endogenous alcohol dehydrogenase EcYjgB of wild-type Escherichia coli as a template, and S200R-F and S200R-R as the forward and reverse primers for the above PCR amplification. After the product was confirmed by agarose gel electrophoresis, it was purified using the SanPrep column PCR product purification kit (purchased from Sangon Biotech (Shanghai) Co., Ltd.), and then digested with Dpn I digestion enzyme (purchased from Thermo Fisher Scientific Inc.) to remove the template. After sequencing confirmation, the recombinant vector pET-28a-mutant S expressing the mutant S of the endogenous alcohol dehydrogenase EcYjgB of Escherichia coli was successfully obtained.

[0037] Similarly, in the same way as above, the difference is that S199D / S200R-F and S199D / S200R-R are used as the forward and reverse primers, and the recombinant vector pET-28a-mutant D expressing the mutant D of the endogenous alcohol dehydrogenase EcYjgB of Escherichia coli is successfully obtained.

[0038] Similarly, in the same way as above, the difference is that the recombinant vector pET-28a-mutant D of the mutant D of the endogenous alcohol dehydrogenase EcYjgB of Escherichia coli is used as a template, and N240W-F and N240W-R are used as primers, and the recombinant vector pET-28a-mutant T expressing the mutant T of the endogenous alcohol dehydrogenase EcYjgB of Escherichia coli is successfully obtained ( Figure 1 )

[0039] The above (1) recombinant vector pET-28a-EcYjgB containing the endogenous alcohol dehydrogenase EcYjgB of wild-type Escherichia coli; (2) recombinant vector pET-28a-mutant S containing mutant S; (3) recombinant vector pET-28a-mutant D containing mutant D; (4) recombinant vector pET-28a-mutant T containing mutant T were separately transformed into Escherichia coli E.coli BL21(DE3) for protein expression and purification.

[0040] Example 2: Enzyme activity assay of wild-type endogenous alcohol dehydrogenase EcYjgB of Escherichia coli and mutants

[0041] After the recombinant bacteria obtained in Example 1 were cultured, lysed, and protein purified, a pure enzyme solution was obtained.

[0042] Determination of enzyme solution concentration: The concentration of pure enzyme protein in the enzyme solution was determined by the BCA method protein concentration assay kit (purchased from Sangon Biotech (Shanghai) Co., Ltd.).

[0043] Reaction system for determining enzyme activity: Incubate 1 mL of 50 mM, pH 6.0 phosphate buffer containing 1 mM HMF (calculated based on the final concentration) and 0.2 mM NADH (calculated based on the final concentration) in a 30 °C water bath for 2 min, and then add an appropriate amount of enzyme solution. Measure the decrease in absorbance at 340 nm using an ultraviolet spectrophotometer (the absorbance of NADH at 340 nm is 6220 M -1 cm -1 ). The amount of enzyme required to consume 1 μmol of NADH per minute is defined as 1 enzyme activity unit. The measurement results are shown in Table 2.

[0044] Calculation formula for enzyme activity: Enzyme activity (U) = E w *V*10 3 / (6220*L)

[0045] E w : The change in absorbance per minute at 340 nm; V: The volume of the reaction solution, mL; L: The optical path distance, cm.

[0046] Table 2. Results of enzyme activity determination of the endogenous alcohol dehydrogenase EcYjgB mutants of Escherichia coli

[0047]

[0048] Example 3: Construction of recombinant vectors co-expressing EcYjgB mutants and formate dehydrogenase

[0049] Using pET-28a-EcYjgB, pET-28a-mutant S, pET-28a-mutant D, and pET-28a-mutant T in Example 1 as templates respectively, target gene fragments with sticky ends were obtained by PCR fragment amplification. The primers used were Cut-F and Cut-R (Table 3). Using the empty pET-Duet-1 plasmid as a template, a linearized vector fragment was obtained by PCR fragment amplification. The primers used were Linear1-F and Linear1-R. The seamless cloning kit (purchased from Sangon Biotech (Shanghai) Co., Ltd.) was used to assemble the above-mentioned target gene fragments with sticky ends and the linearized vector fragments respectively. The gene fragments of the endogenous alcohol dehydrogenase EcYjgB of Escherichia coli or its mutants were inserted into the first multiple cloning site (MCS-1) of the empty pET-Duet-1 plasmid to obtain pET-Duet-EcYjgB, pET-Duet-mutant S, pET-Duet-mutant D, and pET-Duet-mutant T.

[0050] Using the plasmid pET-28a-FDH (GenBank accession number: O13437.1) containing Candida boidinii FDH as a template, a target gene fragment with sticky ends was obtained by PCR fragment amplification. The primers used were FDH-F and FDH-R. Respectively, using pET-Duet-EcYjgB, pET-Duet-mutant S, pET-Duet-mutant D, and pET-Duet-mutant T as templates, linearized vector fragments were obtained by PCR fragment amplification. The primers used were Linear2-F and Linear2-R. The seamless cloning kit (purchased from Sangon Biotech (Shanghai) Co., Ltd.) was used to assemble the above-mentioned target FDH gene fragment with sticky ends and the linearized vector fragment. The gene fragment of FDH was inserted into the second multiple cloning site (MCS-2) of the plasmids pET-Duet-EcYjgB, pET-Duet-mutant S, pET-Duet-mutant D, and pET-Duet-mutant T, respectively, to obtain pET-Duet-EcYjgB-FDH, pET-Duet-mutant S-FDH, pET-Duet-mutant D-FDH, and pET-Duet-mutant T-FDH.

[0051] Table 3. Primer Design for Constructing Recombinant Vectors

[0052]

[0053] Example 4: Construction of Recombinant Vector pET-Duet-1 (Z0251 / B64)

[0054] Using pET-Duet-mutant D-FDH in Example 3 as a template, through whole plasmid PCR amplification, the plasmid pET-Duet-mutant D-FDH (Z0251) was obtained, in which the T7 promoter sequence upstream of the second multiple cloning site (MCS-2) was mutated from the original TAATACGACTCACTATAGG to GAAATTAATACGACTCACTATAGGGAGACCACAAC. The primers used were Z0251-F and Z0251-R (Table 4).

[0055] Using the pET-Duet-mutant D-FDH in Example 3 or the pET-Duet-mutant D-FDH (Z0251) in this example as a template, the plasmid pET-Duet-mutant D-FDH (B64) or pET-Duet-mutant D-FDH (Z0251 / B64) was obtained by whole plasmid PCR amplification, in which the ribosome binding site (RBS) sequence upstream of the second multiple cloning site (MCS-2) was mutated from the original ATTAGTTAAGTATAAGAAGGAGA to AAAGAGGGGAAA. The primers were B64-F and B64-R (Table 4).

[0056] Table 4. Primer design for constructing preferred recombinant vectors

[0057]

[0058] Example 5: Construction of co-expression strains and induced expression

[0059] The above recombinant vectors pET-Duet-EcYjgB-FDH, pET-Duet-mutant S-FDH, pET-Duet-mutant D-FDH, pET-Duet-mutant T-FDH, and pET-Duet-mutant D-FDH (Z0251 / B64) were respectively transformed into the gene expression strain Escherichia coli BL21(DE3) by standard transformation procedures to obtain the corresponding co-expression recombinant bacteria.

[0060] The co-expression recombinant bacteria E. coli BL21(DE3) were inoculated into 20 mL of LB liquid medium containing 100 μg / mL and cultured overnight. 1 mL was taken and inoculated into 100 mL of LB liquid medium with Amp resistance and cultured at 37 °C and 210 rpm for 2 - 3 h until the OD 600 value was between 0.6 and 0.8, then 0.5 mM isopropyl-β-D-thiogalactoside (IPTG) was added for induced expression for 20 h. The wet bacterial cells were collected by centrifugation at 8000 rpm for 10 min, washed twice with 0.85% (w / v) normal saline, and stored in a refrigerator at 4 °C for standby.

[0061] Example 6: Whole-cell catalysis of mutant mutant S for the synthesis of BHMF

[0062] In a 20 mL serum bottle, add 4 mL of 200 mM phosphate buffer with pH 6.0, add 100 mM of HMF, add 200 mM of sodium formate, and finally add 50 mg / mL of the co-expressed recombinant bacterium E. coli / pET-Duet-mutant S-FDH wet cells. React at 30 °C and 150 rpm. During the reaction process, take a small amount of the reaction solution at regular intervals, inactivate it in a boiling water bath, centrifuge at 12,000 rpm for 2 min, take the supernatant, filter it with a 0.22 μm filter membrane, and detect the yield of product B HMF by HPLC( Figure 2 ). After reacting for 8 h, the yield of BHMF is 95%.

[0063] Example 7: Whole-cell catalysis of mutant mutant D for the synthesis of BHMF

[0064] In a 20 mL serum bottle, add 4 mL of 200 mM phosphate buffer with pH 6.0, add 100 mM of HMF, add 200 mM of sodium formate, and finally add 50 mg / mL of the co-expressed recombinant bacterium E. coli / pET-Duet-mutant D-FDH wet cells. React at 30 °C and 150 rpm. After reacting for 2 h, the yield of BHMF is 98%.

[0065] Example 8: Whole-cell catalysis of mutant mutant T for the synthesis of BHMF

[0066] In a 20 mL serum bottle, add 4 mL of 200 mM phosphate buffer with pH 6.0, add 100 mM of HMF, add 200 mM of sodium formate, and finally add 50 mg / mL of the co-expressed recombinant bacterium E. coli / pET-Duet-mutant T-FDH wet cells. React at 30 °C and 150 rpm. After reacting for 4 h, the yield of BHMF is 97%.

[0067] Example 9: Whole-cell catalysis of mutant mutant D for the synthesis of furfuryl alcohol

[0068] In a 20 mL serum bottle, add 4 mL of 200 mM phosphate buffer with pH 6.0, add 100 mM of furfural, add 200 mM of sodium formate, and finally add 50 mg / mL of E. coli / pET-Duet-mutant D wet cells. React at 30 °C and 150 rpm. Monitor the formation of the product furfuryl alcohol by HPLC during the reaction process and quantify it( Figure 3 ). After reacting for 3 h, the yield of furfuryl alcohol > 99%.

[0069] Example 10: Catalytic synthesis of BHMF by the strain carrying the recombinant vector pET-Duet-mutant D-FDH(Z0251) with promoter modification

[0070] In a 20 mL serum bottle, add 4 mL of 200 mM phosphate buffer with pH 6.0, 100 mM of HMF, 200 mM of sodium formate, and finally add 50 mg / mL of wet cells of E. coli / pET-Duet-mutant D-FDH or E. coli / pET-Duet-mutant D-FDH(Z0251), and react at 30 °C and 150 rpm. After reacting for 0.5 h, the initial reaction rates of BHMF synthesis catalyzed by E. coli / pET-Duet-mutant D-FDH(control) and E. coli / pET-Duet-mutant D-FDH(Z0251) cells are 44.4 mM / h and 50.1 mM / h( Figure 4 ). After reacting for 2 h, the yields of BHMF synthesis catalyzed by E. coli / pET-Duet-mutant D-FDH(control) and E. coli / pET-Duet-mutant D-FDH(Z0251) cells are 96% and 97% respectively.

[0071] Example 11: Catalytic synthesis of BHMF by the strain carrying the recombinant vector pET-Duet-mutant D-FDH(B64) with RBS modification

[0072] In a 20 mL serum bottle, add 4 mL of 200 mM phosphate buffer with pH 6.0, 100 mM of HMF, 200 mM of sodium formate, and finally add 50 mg / mL of wet cells of E. coli / pET-Duet-mutant D-FDH or E. coli / pET-Duet-mutant D-FDH(B64), and react at 30 °C and 150 rpm. After reacting for 0.5 h, the initial reaction rates of BHMF synthesis catalyzed by E. coli / pET-Duet-mutant D-FDH(control) and E. coli / pET-Duet-mutant D-FDH(B64) cells are 44.4 mM / h and 52.6 mM / h( Figure 5 ). After reacting for 2 h, the yields of BHMF synthesis catalyzed by E. coli / pET-Duet-mutant D-FDH and E. coli / pET-Duet-mutant D-FDH(B64) cells are 96% and 98% respectively.

[0073] Example 12: Catalytic synthesis of BHMF by the strain carrying the recombinant vector pET-Duet-mutant D-FDH (Z0251 / B64) with modified promoter and RBS

[0074] In a 20 mL serum bottle, 4 mL of 200 mM phosphate buffer with pH 6.0 was added, 200 mM of HMF was added, 400 mM of sodium formate was added, and finally 50 mg / mL of wet cells of E. coli / pET-Duet-mutant D-FD H or E. coli / pET-Duet-mutant D-FDH (Z0251 / B64) was added. The reaction was carried out at 30 °C and 150 rpm. After 3.5 h of reaction, the yields of BHMF catalyzed by E. coli / pET-Duet-mutant D-FDH and E. coli / pET-Duet-mutant D-FDH (Z0251 / B64) cells were 87% and 96% respectively ( Figure 6 ).

[0075] Example 13: Method for the enlarged synthesis of BHMF by whole-cell catalysis of HMF

[0076] In a 100 mL conical flask, 50 mL of 200 mM phosphate buffer with pH 6.0 was added, 500 mM of HMF was added, 1000 mM of sodium formate was added, and finally 100 mg / mL of wet cells of E. coli / pET-Duet-mutant D-FDH was added. The reaction was carried out at 30 °C and 150 rpm. After 6.5 h of reaction, the yield of BHMF was 99% ( Figure 7 ). The reaction solution was collected and placed in a separatory funnel, and extracted 3 times with an equal volume of ethyl acetate. The organic phase was collected. Ethyl acetate was removed by rotary evaporation to obtain 2.05 g of BHMF crystals, and the separation yield was 64%. Detection by nuclear magnetic resonance hydrogen spectrum showed that the obtained BHMF crystals had a high purity ( Figure 8 ).

[0077] Control Example 1: Whole-cell catalysis of E. coli / pET-Duet-EcYjgB-FDH for the synthesis of BHMF

[0078] In a 20 mL serum bottle, 4 mL of 200 mM phosphate buffer with pH 6.0 was added, 100 mM of HMF was added, 200 mM of sodium formate was added, and finally 50 mg / mL of wet cells of the co-expressing recombinant bacterium E. coli / pET-Duet-EcYjgB-FDH was added. The reaction was carried out at 30 °C and 150 rpm. After 10 h of reaction, the yield of BHMF was 92%.

[0079] Comparative Example 2: Whole-cell catalysis of E. coli / pET-Duet-EcYjgB-FDH for the synthesis of BHMF

[0080] The difference between this example and Example 13 is that the strain used is the wet cells of the co-expressing recombinant bacterium E. coli / pET-Duet-EcYjgB-FDH, and the result is that almost no reaction occurs.

Claims

1. An endogenous alcohol dehydrogenase EcYjgB mutant of Escherichia coli, characterized in that, The mutant is any one of the following (a) to (c): (a) Obtained by mutating the serine at position 200 of the endogenous alcohol dehydrogenase EcYjgB of Escherichia coli shown in SEQ ID NO.1 to arginine, and its amino acid sequence is shown in SEQ ID NO.3; (b) Obtained by mutating the serine at position 199 of the endogenous alcohol dehydrogenase EcYjgB of Escherichia coli shown in SEQ ID NO.1 to aspartic acid and the serine at position 200 to arginine, and its amino acid sequence is shown in SEQ ID NO.5; (c) Obtained by mutating the serine at position 199 of the endogenous alcohol dehydrogenase EcYjgB of Escherichia coli shown in SEQ ID NO.1 to aspartic acid, the serine at position 200 to arginine, and the asparagine at position 240 to tryptophan, and its amino acid sequence is shown in SEQ ID NO.

7.

2. A gene encoding the alcohol dehydrogenase EcYjgB mutant according to claim 1, characterized in that, The gene sequences are SEQ ID NO.4, SEQ ID NO.6 and SEQ ID NO.

8.

3. A recombinant plasmid, characterized in that, Carrying the gene encoding the mutant of alcohol dehydrogenase EcYjgB described in claim 1 and the formate dehydrogenase gene.

4. The recombinant plasmid according to claim 3, wherein The recombinant plasmid is the pET-Duet-1 plasmid carrying the above two genes.

5. The recombinant plasmid according to claim 4, wherein Mutating the T7 promoter sequence upstream of the second multiple cloning site in the pET-Duet-1 plasmid from the original TAATACGACTCACTATAGG to GAAATTAATACGACTCACTATAGGGAGACCACAAC, and / or mutating the ribosome binding site sequence upstream of the second multiple cloning site in the pET-Duet-1 plasmid from the original ATTAGTTAAGTATAAGAAGGAGA to AAAGAGGGGAAA.

6. A recombinant bacterium, characterized in that, The recombinant bacterium is obtained by introducing the recombinant plasmid described in claim 3 or 4 or 5 into a host bacterium.

7. The recombinant bacterium according to claim 6, wherein The host bacterium is Escherichia coli E.coli BL21(DE3).

8. Use of the mutant described in claim 1, the gene described in claim 2, the recombinant plasmid described in claim 3 or 4 or 5, and the recombinant bacterium described in claim 6 or 7 in the synthesis of 2,5-furandimethanol or furfuryl alcohol.

9. The application according to claim 8, characterized in that, Using the wet bacterial cells obtained after induced expression of the recombinant bacterium as a catalyst, using 5-hydroxymethylfurfural or furfural as a substrate, using sodium formate as a co-substrate, and using phosphate buffer as a reaction medium, 2,5-furandimethanol or furfuryl alcohol is obtained after the reaction.

10. The application according to claim 9, characterized in that, The substrate concentration is 0.1 - 0.5 mol / L, the co-substrate concentration is 1.2 - 2 times the equivalent of the substrate concentration; the reaction temperature is 20 - 40 °C, the pH of the phosphate buffer is 6 - 8, the cell concentration is 50 - 100 mg / mL, and the reaction time is 0.5 - 10 h.

Citation Information

Cited By

  • Preparation method of pyridazine compound

    CN122256452A