Pyrroline-5-carboxylic acid reductase mutant and application thereof in production of L-piperidine acid

Abstract

The invention relates to a pyrroline-5-carboxylic acid reductase mutant and application of the pyrroline-5-carboxylic acid reductase mutant in production of L-piperidine acid, and belongs to the technical field of enzyme engineering. According to the invention, lysine at the 261st site of wild-type pyrroline-5-carboxylic acid reductase with an amino acid sequence as shown in SEQ ID NO.1 is mutated into tryptophan, tyrosine or phenylalanine, and the enzyme activity of the mutant is up to 3.2 U / mg, which is increased by 88% compared with that of the wild-type pyrroline-5-carboxylic acid reductase. The obtained mutant is added into a reaction system, L-lysine is taken as a substrate and is subjected to concerted catalysis with lysine dehydrogenase to produce L-piperidine acid, the highest yield reaches 83% and is increased by 66% compared with wild pyrroline-5-carboxylic acid reductase, the problem that in the prior art, the catalytic efficiency of pyrroline-5-carboxylic acid reductase is low is solved, and the L-piperidine acid is obtained. The industrial process of producing the L-piperidine acid through enzyme catalysis is promoted.

Description

Technical Field

[0001] The present invention relates to the technical field of enzyme engineering, and in particular to a pyrroline-5-carboxylic acid reductase mutant and its application in the production of L-pipecolic acid. Background Art

[0002] L-pipecolic acid, as a six-carbon cyclic non-proteinogenic α-amino acid, plays a crucial role in the field of organic synthesis and is an important precursor for the synthesis of various bioactive compounds. Especially in the pharmaceutical industry, as an important chiral drug intermediate, it is widely used in the synthesis of key drugs such as immunosuppressants (such as rapamycin, tacrolimus), anticancer agents (such as VX-710), and local anesthetics (such as ropivacaine, bupivacaine), which is of great significance to human health.

[0003] Currently, the methods for producing L-pipecolic acid mainly rely on chemical methods. One is to use DL-pipecolic acid and L-tartaric acid as raw materials, and under the action of a catalyst and salicylaldehyde, L-pipecolic acid is obtained through specific reaction conditions. See "Li Chuanrun, Wang Dan, Hu Haixia. Resolution method for preparing L-2-pipecolic acid [J]. Anhui Chemical Industry, 2002, 28(6): 20-21" and Chinese invention patent CN104402803A, a method for preparing L-homoproline; the other is to carry out catalytic reductive intramolecular amination by adding pyruvic acid, a series of ketones, and the aldol of (S)-isoserine, achieving a short synthesis of pipecolic acid derivatives. See " Sebastian, Kusy, Pasternak-Suder, Monika, Nicolas, Cyril, Mlynarski, Jacek, Martin, Olivier R. Total synthesis of pipecolic acid and 1-C-alkyl 1,5-iminopentitol derivatives by way of stereoselective aldol reactions from (S)-isoserine Org. Biomol. Chem., 2018, 16, 1118-1125". However, the chemical method has obvious drawbacks. The reagents used are expensive, the reaction requires complex conditions, and the optical purity of the synthesized product is low, which not only limits its large-scale industrial production but also makes it difficult to meet the strict requirements of drugs for optical purity.

[0004] Compared with the chemical method, the enzyme-catalyzed method uses L-lysine as the raw material and uses enzymes as catalysts to carry out reduction reactions to produce L-pipecolic acid, showing unique advantages. The enzyme-catalyzed method has mild reaction conditions, relatively low costs, and high optical purity of the synthesized products, fully meeting the modern industrial development concepts such as "sustainable development", "green chemistry", and "environmentally friendly manufacturing". Therefore, the production of L-pipecolic acid by the enzyme-catalyzed method is of crucial significance for promoting the large-scale industrial production of L-pipecolic acid and its wide application in the pharmaceutical field.

[0005] In the existing enzyme-catalyzed methods, lysine dehydrogenase and pyrroline-5-carboxylate reductase (abbreviated as P5CR, EC 1.5.1.2) are usually used in combination to produce L-pipecolic acid from L-lysine. Among them, lysine dehydrogenase first catalyzes L-lysine to form the intermediate D-1-piperidin-6-carboxylic acid (P6C), and then pyrroline-5-carboxylate reductase reduces P6C to L-pipecolic acid. Unfortunately, however, the pipecolic acid yields of most pyrroline-5-carboxylate reductases are relatively low, which is described in "F. It is reflected in the literature such as "J.Max Risse, K.Friehs, V.F.Wendisch, Fermentative production of L-pipecolic acid from glucose and alternative carbon sources, Biotechnol J 12(2017)" and "T.Fujii, M.Mukaihara, H.Agematsu, H.Tsunekawa, Biotransformation of L-lysine to L-pipecolic acid catalyzed by L-lysine 6-aminotransferase and pyrroline-5-carboxylate reductase, Biosci Biotechnol Biochem 66(2002):622-627." The low yield leads to low efficiency in industrial production and cannot meet the requirements of large-scale industrial production, which is also clearly described in the article "D.Roura Padrosa, A.I.Benítez-Mateos, L.Calvey, F.Paradisi, Cell-free biocatalytic syntheses of l-pipecolic acid: a dual strategy approach and process intensification in flow, Green Chem 22(2020)5310-5316.", thus seriously hindering the industrialization process of producing L-pipecolic acid by enzymatic catalysis.

[0006] In summary, it has become an urgent task to find a pyrroline-5-carboxylate reductase with high yield for the combined production of L-pipecolic acid with L-lysine dehydrogenase. This breakthrough will lay a solid foundation for the early realization of large-scale industrial production of L-pipecolic acid and its wide application in the medical field. Summary of the Invention

[0007] To solve the above technical problems, the present invention provides a wild-type pyrroline-5-carboxylate reductase with the lysine at position 261 mutated to tryptophan, tyrosine or phenylalanine in the amino acid sequence shown in SEQ ID NO.1, adding the obtained mutant to the reaction system, using L-lysine as a substrate, and co-catalyzing the production of L-pipecolic acid with lysine dehydrogenase.

[0008] The first object of the present invention is to provide a pyrroline-5-carboxylic acid reductase mutant, wherein the lysine at position 261 of the starting sequence with the amino acid sequence shown in SEQ ID NO.1 is mutated to tryptophan, tyrosine or phenylalanine.

[0009] Furthermore, the nucleotide sequence of the pyrroline-5-carboxylic acid reductase is shown in SEQ ID NO.2.

[0010] The second object of the present invention is to provide a gene encoding the above pyrroline-5-carboxylic acid reductase mutant.

[0011] The third object of the present invention is to provide an expression vector containing the above gene.

[0012] Furthermore, the expression vector is the pET-28a(+) plasmid.

[0013] The fourth object of the present invention is to provide a host cell containing the above pyrroline-5-carboxylic acid reductase mutant or the above expression vector.

[0014] Furthermore, the host cell is a non-plant cell.

[0015] Furthermore, the host cell is a bacterium.

[0016] Furthermore, the host cell is Escherichia coli.

[0017] Furthermore, the host cell is Escherichia coli E.coli BL21(DE3).

[0018] The fifth object of the present invention is to provide the application of the above pyrroline-5-carboxylic acid reductase mutant, the above gene, the above expression vector or the above host cell in the production of L-pipecolic acid.

[0019] The sixth object of the present invention is to provide a method for producing L-pipecolic acid, adding the above pyrroline-5-carboxylic acid reductase mutant or an expression system containing the mutant to a reaction system containing a substrate and lysine dehydrogenase for reaction, and the substrate is L-lysine.

[0020] Furthermore, the concentration of the pyrroline-5-carboxylic acid reductase mutant in the reaction system is 1-10 mg / mL.

[0021] Furthermore, the concentration of the L-lysine is 100-500 mmol / L.

[0022] Furthermore, the concentration of the lysine dehydrogenase is 1-10 mg / mL.

[0023] Furthermore, the reaction system also contains a coenzyme.

[0024] Further, the coenzyme is NAD + and / or NADH.

[0025] Further, the concentration of the coenzyme is 0.1 - 1 mmol / L.

[0026] Advantages of the present invention:

[0027] By mutating the lysine at position 261 of pyrroline - 5 - carboxylate reductase to tryptophan, tyrosine, or phenylalanine, the present invention significantly improves the catalytic efficiency of the enzyme, enabling it to more efficiently catalyze the conversion of L - lysine to L - pipecolic acid. Through genetic engineering means, the high - level expression and purification of the mutant enzyme are achieved. The highest enzyme activity of the mutant reaches 3.2 U / mg, which is 88% higher than that of the wild - type pyrroline - 5 - carboxylate reductase. Combining with the dual - enzyme co - catalytic system of lysine dehydrogenase, the synthesis efficiency of L - pipecolic acid is improved, the production process is simplified, and the yield reaches up to 83%, which is 66% higher than that of the wild - type pyrroline - 5 - carboxylate reductase. It is applicable to fields such as medicine and chemical industry, solving the problems of low product purity in traditional chemical synthesis methods and low efficiency in enzyme - catalyzed methods. Brief Description of the Drawings

[0028] In order to make the content of the present invention easier to be clearly understood, the following further details the present invention according to specific embodiments of the present invention in combination with the drawings, where:

[0029] Figure 1 It is the PCR amplification electrophoresis pattern of the recombinant plasmid in Example 1 of the present invention. M is Marker, and lanes 1 - 3 are the PCR products of the recombinant plasmids pET28a - P5CR - K261W, pET28a - P5CR - K261Y, and pET28a - P5CR - K261F.

[0030] Figure 2 It is the SDS - PAGE electrophoresis analysis result of the expression product obtained by shake - flask induced fermentation of recombinant Escherichia coli in Example 1 of the present invention. M is the standard protein Maker, and lanes 1 - 3 are the pure enzymes of the mutants K261W, K261Y, and K261F obtained by shake - flask induced culture of the recombinant Escherichia coli E.coli BL21 / pET28a - P5CR - K261W, E.coli BL21 / pET28a - P5CR - K261Y, and E.coli BL21 / pET28a - P5CR - K261F. Detailed Embodiments

[0031] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the embodiments cited are not intended to limit the present invention.

[0032] The pET-28a(+) plasmid and NADH involved in the following embodiments were purchased from Novagen.

[0033] L-Lysine and L-pipecolic acid involved in the following embodiments were purchased from Sinopharm Group Co., Ltd.

[0034] The culture media involved in the following embodiments are as follows:

[0035] LB liquid medium: Yeast extract 5.0 g / L, Tryptone 10.0 g / L, NaCl 10.0 g / L, Kanamycin 100 mg / L.

[0036] LB solid medium: Yeast extract 5.0 g / L, Tryptone 10.0 g / L, NaCl 10.0 g / L, Agar powder 15 g / L, Kanamycin 50 mg / L.

[0037] The detection methods involved in the following embodiments are as follows:

[0038] The reaction was carried out in PBS buffer (100 mM, pH 8.0) at 37 °C for 12 h. The reaction system consisted of 500 mM L-lysine, 0.5 mM NAD + and 5 mg / mL lysine dehydrogenase, 10 mg / mL pure enzyme of pyrroline-5-carboxylate reductase. The reaction was detected by HPLC, and the FMOC derivatization method was used to detect the substrate and product. 50 μL of the reaction sample was mixed with 0.2 mL of 20 mM FMOC solution and 0.1 mL of borate buffer (pH = 8.0). The mixture was sonicated for 1 minute and heated at 30 °C for 30 minutes. Subsequently, 0.1 mL of the derivatization solution was added to a mixture of 0.7 mL of acetonitrile and 0.3 mL of 0.1% HCl. The analysis was carried out on Diamonsil C18 (250×4.6 mm, 5 μm), and the detection wavelength was 254 nm. The gradient elution method was used, and it was transitioned from 30:70 to 0:100 (H2O: acetonitrile plus 0.1% trifluoroacetic acid) within 10 minutes, and the flow rate was 0.8 mL / min. It was determined that the retention time of L-lysine-FMOC was 8.0 minutes, and the retention time of L-pipecolic acid-FMOC was 6.3 minutes.

[0039] Example 1: Preparation, expression and purification of pyrroline-5-carboxylate reductase mutant

[0040] The gene of pyrroline-5-carboxylate reductase with a chemically synthesized coding amino acid sequence as shown in SEQ ID NO.1, and the gene sequence is as shown in SEQ ID NO.2; the obtained gene and the pET-28a(+) plasmid were ligated after double digestion (NdeⅠ and XhoⅠ), and the ligation product was transformed into Escherichia coli E. coli BL21(DE3). The transformed product was spread on an LB solid medium and cultured at 37°C for 8-10 h. Five transformants were picked from the LB solid medium, inoculated into an LB liquid medium for culture, and after culturing at 37°C for 10 h, the plasmid was extracted. The extracted plasmid was verified by enzyme digestion and sequencing. If the verification was correct, the recombinant plasmid pET28a-P5CR containing the gene encoding wild-type pyrroline-5-carboxylate reductase and the recombinant bacterium E. coli BL21 / pET28a-P5CR containing the gene encoding wild-type pyrroline-5-carboxylate reductase were obtained.

[0041] Using the whole plasmid PCR technique, site-directed mutagenesis was carried out with the obtained recombinant plasmid pET28a-P5CR as the template to obtain mutants of pyrroline-5-carboxylate reductase S171C (serine at position 171 was mutated to cysteine), R227C (arginine at position 227 was mutated to cysteine), R227T (arginine at position 227 was mutated to threonine), S230F (serine at position 230 was mutated to phenylalanine), S230P (serine at position 230 was mutated to proline), S230V (serine at position 230 was mutated to valine), K261A (lysine at position 261 was mutated to alanine), K261V (lysine at position 261 was mutated to valine), K261F (lysine at position 261 was mutated to phenylalanine), K261W (lysine at position 261 was mutated to tryptophan), and K261Y (lysine at position 261 was mutated to tyrosine), and the primer sequences are shown in Table 1.

[0042] The PCR reaction system (50 μL) was: KOD enzyme (2.5 U / mL) 1.0 μL, template (5-50 ng) 1.0 μL, dNTP 4.0 μL, 10× reaction buffer 5.0 μL, 1.0 μL each of upstream and downstream primers, and ddH2O was added to make up to 50 μL.

[0043] The amplification conditions of the PCR product were all: (1) denaturation at 94°C for 3 min, (2) denaturation at 94°C for 30 sec, (3) annealing at 54°C for 30 sec, (4) extension at 72°C for 150 sec. Steps (2)-(4) were repeated for 10-15 cycles, and finally, the PCR amplification product was extended at 72°C for 10 min and stored at 4°C.

[0044] The PCR amplification products were detected by 1% agarose gel electrophoresis. After the detection, 0.5 μL of methylation template digestion enzyme (Dpn I) was added to 10 μL of the amplification products. The mixture was pipetted up and down to mix well and reacted at 37 °C for 1 h. The amplification products treated with Dpn I were transformed into Escherichia coli E. coli BL21(DE3). The transformation products were spread on LB solid medium and cultured at 37 °C for 8 - 10 h. Five transformants were picked from the LB solid medium and inoculated into LB liquid medium for culture. After culturing at 37 °C for 10 h, plasmids were extracted. The extracted plasmids were verified by enzyme digestion and sequencing. If the verification was correct, the recombinant plasmids pET28a-P5CR-S171C, pET28a-P5CR-R227C, pET28a-P5CR-R227T, pET28a-P5CR-S230F, pET28a-P5CR-S230P, pET28a-P5CR-S230V, pET28a-P5CR-K261A, pET28a-P5CR-K261V, pET28a-P5CR-K261W, pET28a-P5CR-K261Y, pET28a-P5CR-K261F, which respectively contained genes encoding pyrroline-5-carboxylate reductase mutants S171C, R227C, R227T, S230F, S230P, S230V, K261A, K261V, K261W, K261Y, K261F, were obtained, as well as the recombinant bacteria E. coli BL21 / pET28a-P5CR-S171C, E. coli BL21 / pET28a-P5CR-R227C, E. coli BL21 / pET28a-P5CR-R227T, E. coli BL21 / pET28a-P5CR-S230F, E. coli BL21 / pET28a-P5CR-S230P, E. coli BL21 / pET28a-P5CR-S230V, E. coli BL21 / pET28a-P5CR-K261A, E. coli BL21 / pET28a-P5CR-K261V, E. coli BL21 / pET28a-P5CR-K261W, E. coli BL21 / pET28a-P5CR-K261Y, E. coli BL21 / pET28a-P5CR-K261F, which respectively contained the above recombinant plasmids.

[0045] Table 1 Mutants and Primer Sequences

[0046] Mutant Forward primer (5’-3’) Reverse primer (5’-3’) S171C GTTATTGGTGTTTGTGGCAGT CGGACTACTGCCACAAACACC R227C GTCTTGAAGGACTGTGTTTCC CGGTGAGGAAACACAGTCCTT R227T GTCTTGAAGGACACTGTTTCC CGGTGAGGAAACAGTGTCCTT S230F GACCGTGTTTCCTTTCCGGGA AGTGCCTCCCGGAAAGGAAAC S230P GACCGTGTTTCCCCGCCGGGA AGTGCCTCCCGGCGGGGAAAC S230V GACCGTGTTTCCGTTCCGGGA AGTGCCTCCCGGAACGGAAAC K261A GCCGCTGCTGATGCCAGCCGC GCCGCTGCTGATGGCAGCCGC K261V GCCGCTGCTGATGTAAGCCGC GCCGCTGCTGATTACAGCCGC K261F GCCGCTGCTGATTTTAGCCGC CATCTCGCGGCTAAAATCAGC K261W GCCGCTGCTGATTGGAGCCGC CATCTCGCGGCTCCAATCAGC K261Y GCCGCTGCTGATTACAGCCGC CATCTCGCGGCGTATATCAGC

[0047] Pick a single colony of the above recombinant strain and inoculate it into LB liquid medium to obtain cell lysate supernatants of pyrroline-5-carboxylate reductase mutants S171C, R227C, R227T, S230F, S230P, S230V, K261A, K261V, K261W, K261Y, and K261F. The cultivation and expression process of recombinant Escherichia coli is as follows:

[0048] Spread the obtained recombinant bacteria on LB solid medium and culture at 37 °C for 8 - 10 h to obtain single colonies; pick single colonies and inoculate them into 40 mL of LB medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride), and culture at 37 °C and 180 rpm until OD 600 reaches 0.7 - 0.9. Add 0.2 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) to induce protein expression, and culture the culture at 16 °C and 160 rpm for 16 hours. Resuspend the obtained cells in lysis buffer (100 mM phosphate buffer, pH 8.0, 0.5 M NaCl, 5% glycerol), and centrifuge at 10,000 g for 20 minutes at 4 °C using ultrasonic waves (Sonics Vibra-Cell, Sonics & Materials, Inc.) on ice to obtain a crude enzyme extract. The clarified supernatant is filtered through a 0.45 μm filter membrane and loaded onto a 5 mL His Trap FF chromatography column (GE Healthcare, Co., Ltd.), which is pre-equilibrated with the same lysis buffer. The crude enzyme extract is eluted with an imidazole gradient (50 - 400 mM) at a flow rate of 5 mL / min in the lysis buffer. Elute the recombinant protein bound to the nickel column to obtain pure enzyme solutions of wild-type pyrroline-5-carboxylate reductase, pyrroline-5-carboxylate reductase mutants S171C, R227C, R227T, S230F, S230P, S230V, K261A, K261V, K261W, K261Y, and K261F.

[0049] Combine the wild-type pyrroline-5-carboxylate reductase and mutants S171C, R227C, R227T, S230F, S230P, S230V, K261A, K261V, K261W, K261Y, and K261F prepared above with lysine dehydrogenase respectively for the production of L-pipecolic acid from L-lysine. Add different concentrations of L-Lys (100, 250, and 500 mM respectively), 5 mg / mL LysDH, 10 mg / mL Ec-P5CR, and 0.5 mM NAD + in a PBS buffer (100 mM, pH 8.0) and react at 37 °C for 8 h to measure the yield of the final L-pipecolic acid. The yield results are shown in Table 2.

[0050] Table 2 L-Lysine yields of pyrroline-5-carboxylate reductase and mutants

[0051]

[0052]

[0053] Select the pure enzyme solutions of pyrroline-5-carboxylate reductase mutants K261W, K261Y, and K261F with higher yields than other mutants (the PCR amplification electrophoresis patterns of the recombinant plasmids are as Figure 1 shown) for SDS-PAGE analysis. The analysis results are shown in Figure 2 . The pure enzyme solutions of pyrroline-5-carboxylate reductase mutants K261W (amino acid sequence as shown in SEQ ID NO.3), K261Y (amino acid sequence as shown in SEQ ID NO.4), and K261F (amino acid sequence as shown in SEQ ID NO.5) all showed a single band at around 32 kDa, with few impurity proteins and good purification effect on the nickel column.

[0054] Example 2: Production of L-pipecolic acid using pyrroline-5-carboxylate reductase and mutants

[0055] From the perspective of production application, set the concentration of L-lysine in the reaction system to 500 mM. The purified wild-type pyrroline-5-carboxylate reductase and mutants K261W, K261Y, and K261F obtained in Example 1 were respectively combined with lysine dehydrogenase for the production of L-pipecolic acid from L-lysine. Add 500 mM L-Lys, 5 mg / mL LysDH, 10 mg / mL Ec-P5CR, and 0.5 mM NAD in the enzyme activity measurement reaction system + React at 37 °C for 8 h in PBS buffer (100 mM, pH 8.0), and measure the yield of the final L-pipecolic acid, which reached up to 83 ± 1.1%, showing a significant improvement compared with the wild-type enzyme.

[0056] Table 3 Results of enzyme activities and L-pipecolic acid yields of pyrroline-5-carboxylate reductase and mutants

[0057] Number Enzyme activity U / mg Yield % WT 1.7±0.6 50±1.0％ K261Y 2.1±0.3 80±2.3％ K261W 3.2±0.4 83±1.1％ K261F 2.2±0.2 79±2.2％

[0058] Obviously, the above examples are only for illustration and are not intended to limit the implementation methods. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. And the obvious changes or modifications derived therefrom are still within the protection scope of the present invention.

Claims

1. A pyrroline-5-carboxylic acid reductase mutant, characterized in that: The pyrroline-5-carboxylic acid reductase mutant is a mutant in which lysine at position 261 of the starting sequence having the amino acid sequence shown in SEQ ID NO.1 is mutated to tryptophan, tyrosine or phenylalanine.

2. A gene encoding the pyrroline-5-carboxylic acid reductase mutant according to claim 1.

3. An expression vector containing the gene according to claim 2.

4. A host cell containing the pyrroline-5-carboxylic acid reductase mutant according to claim 1 or the expression vector according to claim 3.

5. Use of the pyrroline-5-carboxylic acid reductase mutant according to claim 1, the gene according to claim 2, the expression vector according to claim 3 or the host cell according to claim 4 in the production of L-pipecolic acid.

6. A method for producing L-pipecolic acid, characterized in that: Adding the pyrroline-5-carboxylic acid reductase mutant according to claim 1 or an expression system containing the mutant to a reaction system containing a substrate and lysine dehydrogenase for reaction, wherein the substrate is L-lysine.

7. The method according to claim 6, wherein: The concentration of the L-lysine is 100-500 mmol / L.

8. The method according to claim 6, wherein: The concentration of the lysine dehydrogenase is 1-10 mg / mL.

9. The method according to claim 6, characterized in that: The reaction system further contains a coenzyme.

10. The method according to claim 9, wherein: The concentration of the coenzyme is 0.1-1 mmol / L.

Images