Ab-Taq enzyme freeze-drying protective agent as well as preparation method and application thereof

Abstract

The invention relates to the technical field of biology, and particularly discloses an Ab-Taq enzyme freeze-drying protective agent and a preparation method and application thereof.The freeze-drying protective agent is prepared from, by mass, 2%-10% (w / v) of trehalose, 1%-3% (w / v) of polyethylene glycol 20000, 5%-15% (w / v) of mannitol, 0.1%-1% (w / v) of poloxamer 188 and sterilized purified water serving as a solvent. The freeze-drying protective agent disclosed by the invention not only can play a role in protecting and forming the Ab-Taq in a freeze-drying process, but also is simple in added protective agent component, and does not influence the amplification reaction of the Ab-Taq. The freeze-dried product prepared by using the optimized freeze-drying process is smooth in appearance molding and low in hygroscopicity, has no obvious change in amplification performance before and after freeze-drying, supports normal-temperature storage and transportation, does not need cold chain protection, and can avoid adverse effects on reagent performance caused by repeated freezing and thawing of conventional reagents.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and specifically to an Ab-Taq enzyme lyoprotectant, a preparation method thereof, and an application thereof. Background Art

[0002] The PCR technology is widely used, and Taq DNA polymerase exhibits very unique advantages because it can tolerate high temperatures during the PCR reaction. By antibody-modifying the hot-start Taq DNA polymerase to obtain Ab-Taq enzyme, the specificity and sensitivity of the PCR reaction can be significantly improved. However, the chemical nature of Taq DNA polymerase is protein, and it is difficult to maintain its biological activity for a long time in a solution environment, and it is expensive. Therefore, it is necessary to perform cold-chain protection at about -20°C throughout the storage and transportation of Ab-Taq DNA polymerase to ensure the biological activity of the active ingredients of the reagent; while the cold-chain transportation of PCR reagents will greatly increase the cost consumption. By freeze-drying the Ab-Taq DNA polymerase reagent, it is expected to achieve low-cost and efficient storage and transportation in a solid form under non-cold-chain conditions.

[0003] Freeze-drying refers to a new and efficient drying technology in which a substance that is liquid at room temperature is rapidly frozen into a solid state at an extremely low temperature, and then in a vacuum environment, the frozen solid ice in the mixture is directly sublimated into a gaseous state without melting into liquid water, finally removing the water and retaining other active components. The sample after freeze-drying has good stability and does not require cold-chain transportation, greatly reducing the storage and transportation costs. However, since the hydrogen bond between water and protein is crucial for the thermodynamic stability of protein, removing water is the main stress during the drying process. The gradual reduction of water content and the change in the spatial distribution of water molecules may both cause the weakening or loss of the function of the active ingredients of the reagent. Therefore, during the freeze-drying process, a lyoprotectant is added to reduce the damage suffered by the bioactive components during freeze-drying.

[0004] Commonly used protectants for freeze-drying include sugars, polyols, polymers, surfactants, and amino acids, etc. Oligosaccharides of biological origin (especially disaccharides such as trehalose and sucrose, etc.) have a relatively high glass transition temperature and can effectively prevent the plasticizing effect of water on the glassy state. Sugar alcohols are a kind of excipient that is easy to crystallize and aims to maintain a crystalline state during freeze-drying to avoid inactivation of the freeze-dried product due to structural collapse. Usually, an annealing step is added to promote the crystallization of the excipient. And high-molecular polymers can reduce the interaction between protein molecules during freeze-drying, prevent their aggregation and agglutination; increase the viscosity of the solution; and inhibit the decrease of the solution pH value.

[0005] So far, there have been numerous studies on lyoprotectants. For example, the lyoprotectant, LAMP freeze-dried microspheres and their preparation method disclosed in Chinese Patent Publication No. CN116855590A add 4 parts of trehalose, 4 parts of sucrose, 0.4 part of mannitol, 0.4 part of cyclodextrin, 0.1 part of tert-butanol, 3 parts of polyethylene glycol (PEG 40000 - 70000), 3 parts of vinylpyrrolidone (PVP), and 4 parts of water as the lyoprotectant. This formulation can effectively protect the activity of BST3.0 DNA polymerase. However, this freeze-drying formulation is complex, not suitable for Ab-Taq DNA polymerase preparations, and there is no stability data indicating that this formulation can ensure the long-term storage stability of BST3.0 DNA polymerase.

[0006] At present, vacuum freeze-drying technology has greatly increased the possibility of storing and transporting PCR reagents at room temperature. However, the process of preparing freeze-dried products is time-consuming, and the storage stability, reaction performance, and morphology of freeze-dried products vary greatly depending on different lyoprotectants and excipients. Therefore, there is an urgent need to develop a glycerol-free lyoprotectant system that is suitable for low enzyme content, has a simple formulation, has little impact on the performance of the PCR reaction system, and has good freeze-drying effects. For this reason, an Ab-Taq enzyme lyoprotectant, its preparation method, and its application are provided. Summary of the Invention

[0007] The purpose of the present invention is to address the deficiencies of the prior art by providing an Ab-Taq enzyme lyoprotectant, its preparation method, and its application to solve the problems raised in the above background technology.

[0008] To achieve the above object, the present invention provides the following technical solution: An Ab-Taq enzyme lyoprotectant, wherein the lyoprotectant is composed of the following components in terms of mass-volume fraction: trehalose is 2% - 10% (w / v), polyethylene glycol 20000 is 1% - 3% (w / v), mannitol is 5% - 15% (w / v), poloxamer 188 is 0.1% - 1% (w / v), and the solvent is sterilized purified water.

[0009] As a preferred technical solution of the present invention, the lyoprotectant is composed of the following components in terms of mass-volume fraction: 3.5% (w / v) of trehalose, 1.25% (w / v) of polyethylene glycol 20000, 10% (w / v) of mannitol, 0.4% (w / v) of poloxamer 188, and the solvent is sterilized purified water.

[0010] A preparation method of the Ab-Taq enzyme lyoprotectant as described above, the specific steps are as follows: Dissolve trehalose, polyethylene glycol 20000, mannitol, and poloxamer 188 in sterilized purified water according to the components respectively, then mix them evenly, and filter and sterilize to obtain the lyoprotectant solution.

[0011] An Ab-Taq enzyme lyophilized powder, the Ab-Taq lyophilized powder contains a lyoprotectant and also includes an Ab-Taq premix, and the volume ratio of the Ab-Taq premix to the lyoprotectant is 1:10 to 20.

[0012] As a preferred technical solution of the present invention, the components of the Ab-Taq premix include KCl, (NH4)2SO4, MgSO4, Tris-HCl, BSA, KOH, dNTP, and Ab-Taq DNA polymerase.

[0013] A preparation method of the Ab-Taq enzyme lyophilized powder as described above, the specific steps are as follows:

[0014] Step 1: Mix the Ab-Taq premix with the lyoprotectant solution, vortex and centrifuge to obtain a sample;

[0015] Step 2: Pre-freezing stage: Set the shelf temperature to -40°C to -50°C. When the shelf temperature is stable at -40°C to -50°C, put in the sample and keep it for 2 to 3 hours;

[0016] Step 3: Annealing stage: Evacuate to 15 to 20 Pa, set the shelf temperature to -20°C, and keep it for 1 to 2 hours;

[0017] Step 4: Primary drying stage: Keep the vacuum at 6 to 10 Pa, lower the shelf temperature to -40°C to -45°C, and keep it for 10 to 13 hours; then raise the shelf temperature to -20°C to -25°C again and keep it for 1 to 2 hours;

[0018] Step 5: Secondary drying stage: Keep the vacuum at 3 to 5 Pa, raise the shelf temperature to 0°C and keep it for 1 to 2 hours; then raise the shelf temperature to 10°C again and keep it for 1 to 2 hours; finally raise the shelf temperature to 20°C to 30°C and keep it for 6 to 8 hours;

[0019] Step 6: Increase the pressure to atmospheric pressure to obtain a glycerol-free Ab-Taq enzyme lyophilized powder.

[0020] Compared with the prior art, the beneficial effects of the present invention are:

[0021] The lyoprotectant provided by the present invention not only acts as a protectant and excipient for the Ab-Taq reagent, but also the Ct value and fluorescence signal value are basically the same before and after lyophilization. Its composition is simple and does not affect the PCR amplification reaction. The preferred freeze-drying procedure greatly improves the properties of the lyophilized product, avoids the loss of activity caused by repeated freezing and thawing of Ab-Taq, ensures the stability of the lyophilized product, and at the same time makes the obtained lyophilized product have a beautiful form. Moreover, the lyophilized product does not contain glycerol, can be stably stored at room temperature, and can be rapidly redissolved when in use.

[0022] It also has the following advantages:

[0023] (1) The freeze-drying time is short, which solves the strict conditions for transportation and storage, and greatly reduces the transportation and storage costs; the components of the protective agent used are simple, which greatly saves the production cost in industrial production;

[0024] (2) After adding the reconstitution solution, it can be quickly and completely reconstituted;

[0025] (3) The storage temperature of the Ab-Taq DNA polymerase preparation is increased, enabling it to be transported without a cold chain;

[0026] (4) The shelf life of the Ab-Taq DNA polymerase preparation product is extended;

[0027] (5) While maintaining the original structure and form of the enzyme, the enzyme activity in the product is retained to the greatest extent. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 : It is the appearance diagram of the Ab-Taq reagent of the present invention after freeze-drying;

[0029] Figure 2 : It is the performance comparison of the Ab-Taq reagent of the present invention before and after freeze-drying;

[0030] Figure 3 : It is the stability of the Ab-Taq reagent of the present invention after freeze-drying when stored at 37 °C for 3 months;

[0031] Figure 4 : It is the water content of the Ab-Taq reagent of the present invention after freeze-drying;

[0032] Figure 5 : It is the internal structure of the Ab-Taq reagent of the present invention after freeze-drying. DETAILED DESCRIPTION OF THE INVENTION

[0033] The following describes in detail the preferred embodiments of the present invention with reference to the accompanying drawings, so that the advantages and features of the present invention can be more easily understood by those skilled in the art, thereby making a clearer and more definite definition of the protection scope of the present invention.

[0034] Example 1: Preparation method of freeze-dried powder;

[0035] The prepared mixed solution of Ab-Taq and the combined protective agent was dispensed into 0.2 mL PCR eight-well tubes at 25 μL / tube. The PCR eight-well tubes were placed in a metal tube rack and then placed in a freeze-drying tray. The freeze-drying program was set as follows:

[0036] (1) Mix the Ab-Taq and the combined protective agent solution, and vortex and centrifuge to obtain the liquid sample before freeze-drying;

[0037] (2) Pre-freezing stage: Set the temperature of the shelf to -50 °C. After the shelf temperature stabilizes at this temperature, place the sample and maintain for 3 h;

[0038] (3) Annealing stage: Evacuate to 15 Pa, set the temperature of the shelf to -20 °C, and maintain for 1 h;

[0039] (4) Primary drying stage: Maintain the vacuum at 6 Pa, lower the temperature of the shelf to -40 °C, and maintain for 12 h; Then raise the temperature of the shelf to -20 °C again and maintain for 1 h;

[0040] Raise the temperature of the shelf to -20 °C and maintain for 1 h;

[0041] (5) Secondary drying stage: Maintain the vacuum at 3 Pa, raise the temperature of the shelf to 0 °C and maintain for 1 h; Then raise the temperature of the shelf to 10 °C again and maintain for 1 h; Finally, raise the temperature of the shelf to 25 °C and maintain for 6 h.

[0042] (6) Increase the pressure to atmospheric pressure to obtain the glycerol-free Ab-Taq lyophilized powder.

[0043] Example 2: Prepare the lyophilization protective solution;

[0044] 1. Weigh and prepare each component of the lyophilization protective agent, and finally make up to 100 mL with sterilized purified water, filter with a sterile filter membrane to obtain 2× lyophilization protective agent. When in use, add the corresponding amount of 2× lyophilization protective agent according to the volume of the prepared PCR reaction solution, so that the concentration of the lyophilization protective agent in the final system is 1×.

[0045] 2. Prepare the lyophilization system according to Table 1.

[0046] Table 1: Lyophilization system

[0047] Add components Add volume 2×Lyoprotectant 12.5 μL Ab-Taq Premix (containing 0.5 U Ab-Taq) 1 μL Sterilized purified water 11.5 μL Total system 25 μL

[0048] Example 3: Verification of qPCR enzyme performance

[0049] The primer-probe sequences involved in the performance verification are as follows in Table 2:

[0050] Table 2: Primer-probe sequences involved in the performance verification

[0051] FQ-PP2-F1 CGTCGCACGCGGATGTAG FQ-PP2-R1 CGCCCTTGCTTGTTCACACA FQ-PP2-P1 6-FAM-ACCTCCGCCTCCGATAACGGCTTGCAC-BHQ-1

[0052] Reconstitute the obtained lyophilized product and perform qPCR experiments to verify its amplification performance. The specific steps are as follows: The reaction mixture system involved in the performance verification is prepared as follows:

[0053] Table 3: Preparation table of the reaction mixture system

[0054] Add components Added amount Tomato genome 100 / 10 / 1 / 0.1 ng Ab-Taq Premix (containing 0.5 U Ab-Taq) 1 μL FQ-PP2-P1 (100 μM) Final concentration 0.25 μM FQ-PP2-F1 (100 μM) Final concentration 0.2 μM FQ-PP2-R1 (100 μM) Final concentration 0.2 μM Sterilized purified water Make up to 50 μL

[0055] Specific examples of activity verification:

[0056] (1) Prepare the reaction mixture according to the performance verification system in Table 3: Mix the corresponding number of reaction template DNA, primers, probes and sterilized purified water in a PCR tube.

[0057] (2) Add 25 μL of the reaction solution to the freeze-dried PCR tube for reconstitution. Use the sample before freeze-drying as a positive control and perform amplification in a fluorescence quantitative PCR instrument.

[0058] (3) Set the PCR program as follows: Pre-denaturation at 95 °C for 5 min, 1 cycle; Denaturation at 95 °C for 15 s, Annealing and extension at 60 °C for 30 s, 40 cycles, and collect FAM fluorescence signal at 60 °C.

[0059] Example 4: Screening of lyoprotectant components and preparation of freeze-dried enzyme powder. The specific steps are as follows:

[0060] Use sucrose, trehalose, maltose, lactose, mannitol, sorbitol, arginine, glycine, histidine, dextran (Dex), polyvinylpyrrolidone (PVP), polyethylene glycol (PEG), Tween 80 and poloxamer 188 as lyoprotectants respectively, and prepare the protectant solution according to the steps of Example 2. Mix 1 μL of 0.5 U / μL Ab-Taq premix with 10% sucrose, 10% trehalose, 10% maltose, 10% lactose, 10% mannitol, 10% sorbitol, 10% arginine, 10% glycine, 10% histidine, 10% BSA, 10% Tween 80, 10% PEG, 10% PVP, 10% PEG, 10% Tween 80 and 10% poloxamer 188 respectively, and make up the water to prepare a 25 μL / tube freeze-drying premix. Prepare the freeze-dried enzyme powder according to the steps of Example 1, and measure the enzyme activity of the freeze-dried enzyme powder according to Example 3. Use the freshly prepared Ab-Taq premix without freeze-drying and without adding lyoprotectant as a positive control; the Ab-Taq premix that is freeze-dried but without adding lyoprotectant as a negative control.

[0061] The appearance and activity of freeze-dried Ab-Taq containing various protectants are shown in the following table:

[0062] Table 4: Appearance and activity of freeze-dried Ab-Taq containing various protectants

[0063]

[0064] According to Table 4, select trehalose and PEG as stabilizers and mannitol as a filler to perform freeze-drying protection on Ab-Taq.

[0065] Example 5: Screening of the proportion of lyoprotectant components and preparation of freeze-dried enzyme powder

[0066] Screen the ratios of trehalose, mannitol, PEG, and poloxamer 188.

[0067] Table 5: Composition ratios of lyoprotectant combinations

[0068] Trehalose Mannitol PEG Poloxamer 188 Formulation 1 1％ 1％ 0 0 Formulation 2 1％ 10％ 0 0 Formulation 3 1％ 20％ 0 0 Formulation 4 10％ 10％ 0 0 Formulation 5 20％ 10％ 0 0 Formulation 6 5％ 10％ 1％ 0 Formulation 7 5％ 10％ 2.5％ 0 Formulation 8 5％ 10％ 5％ 0 Formulation 9 5％ 10％ 2.5％ 0.1％ Formulation 10 5％ 10％ 2.5％ 1％ Formulation 11 5％ 10％ 2.5％ 3％

[0069] According to the 8 optional lyoprotectant formulations in Table 5 above, perform lyophilization and activity detection according to Examples 1 to 3, and the detection results are shown in Table 6 below.

[0070] Table 6: Lyophilization and activity detection for Examples 1 to 3

[0071]

[0072]

[0073] In this example, comparative experiments with 9 different lyoprotectant formulations tested the effects of each component in the lyoprotectant and the suitable concentrations. For Formulation 1, the lyophilized cake was not completely lyophilized due to the low content of the protectant, and the mannitol concentration was insufficient to form dense pores, resulting in a hollow interior of the cake. For Formulations 2 and 3, the excessive proportion of mannitol led to too much crystalline substance in the cake, making it prone to cracking and a decrease in activity. For Formulations 4 and 5, by comparing the appearance and activity of the cake with different trehalose concentrations, it was found that when the trehalose concentration was too high, the cake was prone to shrinkage and the water removal was incomplete. For Formulation 8, the addition of excessive polyethylene glycol led to too high a viscosity of the Ab-Taq reaction system, which hindered the molecular thermal motion in the reaction system during the freezing process. For Formulations 6 to 10, there was a slight shrinkage phenomenon. The results of Formulations 9 - 11 showed that an appropriate amount of poloxamer 188 could reduce or eliminate the adsorption of proteins at the phase interface, thereby improving the stability of proteins, but excessive amounts might cause a decrease or inactivation of protein activity and lead to shrinkage of the lyophilized product cake. Mannitol is not only a filler but also promotes crystallization during lyophilization, which is beneficial for water removal. Therefore, it can be considered to reduce the content of trehalose and PEG, making the proportion of mannitol larger, which helps with water removal. Then, adding a low content of poloxamer 188 can avoid the cake from absorbing water and shrinking, ensuring the stable storage of the lyophilized powder.

[0074] In this example, it can be determined that the preferred lyoprotectant is composed of 2% - 10% (w / v) trehalose, 1% - 3% (w / v) polyethylene glycol 20000, 5% - 15% (w / v) mannitol, and 0.1% - 1 (w / v) poloxamer 188 by mass - volume fraction, and the solvent is sterilized purified water.

[0075] Example 6: Preparation of lyoprotectant and lyophilized enzyme powder;

[0076] The purpose of this example is to test the lyoprotectant formulation selected from the results of Example 5.

[0077] Prepare the protectant solution according to the steps of Example 2. The components in the 2× lyoprotectant are as follows: 7% (w / v) trehalose, 2.5% (w / v) polyethylene glycol 20000, 20% (w / v) mannitol, 0.8% (w / v) poloxamer 188, and the solvent is sterilized purified water. Specifically, the preparation method of the 2× lyoprotectant is as follows: accurately weigh 7 g of trehalose, 2.5 g of polyethylene glycol 20000, 20 g of mannitol, and 0.8 g of poloxamer 188. Then, add 80 mL of sterilized purified water and stir to dissolve them fully. Then, make up the volume to 100 mL. Finally, perform sterile filtration to obtain it.

[0078] Mix 1 μL of 0.5 U / μL Ab-Taq premix with the above-prepared 2× lyoprotectant solution, make up the volume to 25 μL, vortex and centrifuge to obtain the freeze-drying premix. Prepare the freeze-dried enzyme powder according to the steps of Example 1, and measure the enzyme activity of the freeze-dried enzyme powder according to Example 3. Use the freshly prepared Ab-Taq premix that is not freeze-dried and does not contain a lyoprotectant as the positive control. The appearance of the freeze-dried Ab-Taq preparation after drying is as Figure 1 shown. The amplification effect is as Figure 2 shown. There is no significant difference in the Ct value and the fluorescence signal value at the plateau phase before and after freeze-drying, indicating that the lyoprotectant provided by the present invention has good protection effect.

[0079] Example 7: Detection of the storage stability of the freeze-dried Ab-Taq powder;

[0080] Detect the storage stability of the freeze-dried Ab-Taq powder prepared in Example 6 at 4°C, 55% RH and 37°C, 55% RH respectively. Use the freshly prepared Ab-Taq premix that is not freeze-dried and does not contain a lyoprotectant as the positive control; the freeze-dried Ab-Taq premix without a lyoprotectant as the negative control.

[0081] After freeze-drying, conduct morphological and performance evaluations on the obtained freeze-dried products. The specific evaluation indicators are as follows:

[0082] (1) Appearance of the freeze-dried product: Whether the morphological appearance is qualified;

[0083] (2) Water content of the freeze-dried sample: Whether it is lower than 3%;

[0084] (3) Skeletal structure of the freeze-dried sample: Whether it is stable;

[0085] (4) Amplification performance of the freeze-dried product: Whether the amplification performance of the reagent before and after freeze-drying remains unchanged;

[0086] (5) Stability of the lyophilized product: Whether the amplification performance remains unchanged after 3 months of storage at 37°C.

[0087] As Figure 1 shown, the lyophilized product has a smooth surface, a plump and full morphology, uniform size, and good appearance;

[0088] The obtained lyophilized product was packed in a sealed bag and stored in a stability test chamber at 4°C, 55% RH and 37°C, 55% RH for 3 months. After 3 months, the amplification performance was detected by the above method to evaluate the stability of the lyophilized product stored at 4°C and 37°C; the obtained lyophilized product was placed in a stability test chamber at 4°C, 55% RH for 12 months. After 12 months, the amplification performance was detected by the above method to evaluate the stability of the lyophilized product stored at 4°C. The results are as Figure 3 shown. There is no significant difference in the amplification performance of the lyophilized product stored at 37°C for 3 months compared to that stored at 4°C for 3 months. In addition, the amplification efficiency of the lyophilized product also did not change significantly after being placed at 4°C, 55% RH for 12 months.

[0089] The excellent stability of the lyophilized product lies in the control of the water content during the lyophilization process and the excellent framework structure provided by the protective agent.

[0090] The role of water content in the lyophilized sample is reflected in many aspects such as lyophilization efficiency, sample stability, reconstitution performance, component protection, appearance and morphology maintenance. Reasonable control of water content is a key factor to ensure the stable preservation of lyophilized products. Therefore, in actual operation, it is very necessary to monitor and manage the water content of enzyme lyophilized preparations.

[0091] The role of a stable framework structure in the lyophilized sample is multi-faceted. It can effectively protect the activity of the sample, reduce damage, improve the reconstitution effect, extend the storage period, and improve the uniformity and efficiency of the lyophilization process. By using appropriate protective materials (such as stabilizers, framework enhancers, etc.) during the lyophilization process, the quality and performance of the lyophilized product can be optimized.

[0092] The lyophilization process and lyophilization protective agent provided by the present invention enable the water content of the Ab-Taq lyophilized preparation to be only 1.59%, as Figure 4 shown. During the lyophilization process, trehalose, mannitol, PEG20000 and poloxamer 188 interacted to construct a particularly stable framework structure for Ab-Taq, as Figure 5 shown, which can protect the enzyme conformation and reduce the loss of enzyme activity.

[0093] Comparative Example 1: Lyoprotectant, LAMP lyophilized microspheres and their preparation method. Part of the protectant is the same as that in Example 6. The enzyme used is not the same enzyme as those in Examples 1-7, and the content is different. The enzyme used is BST3.0 DNA polymerase (0.3 U / μL in 2.5 μL).

[0094] Comparative Example 2: Lyoprotectant, LAMP lyophilized microspheres and their preparation method. The freeze-drying method is the same, but the procedure is different from that in Example 1. The steps are as follows: Take 12.5 μL of the LAMP premix solution added with the lyoprotectant and 2.5 μL of the LAMP primer mixture solution added with the lyoprotectant, mix them and add them into a PCR octuplet tube, and transfer them to a pre-cooled freeze-dryer after mixing, and perform freeze-drying according to the freeze-drying procedure; The freeze-drying procedure is: Pre-freeze at -45°C for 120 minutes; Perform freeze-sublimation at -45°C for 120 minutes, -35°C for 300 minutes, and -25°C for 360 minutes in sequence; Perform analytical sublimation at 25°C for 60 minutes and 30°C for 120 minutes in sequence.

[0095] Comparative Example 3: Lyoprotectant, LAMP lyophilized microspheres and their preparation method. In the protectant combination used, some of the protectant types are the same as those in Example 4, and the dosage form prepared is different from those in Examples 1, 3 and 4. It is characterized by including one part of LAMP premix lyophilized microspheres and one part of primer lyophilized microspheres.

[0096] Comparative Example 4: Lyoprotectant, LAMP lyophilized microspheres and their preparation method. In the protectant combination used, the components are complex. Some of the protectant types are the same as those in Example 6, but the ratio is different. The protectant formulation contains 4 parts of trehalose, 0.4 parts of mannitol, 3 parts of polyethylene glycol (PEG 40000-70000), and 4 parts of water.

[0097] Comparative Example 5: Lyoprotectant, LAMP lyophilized microspheres and their preparation method. In the protectant combination used, some of the protectant types are the same as those in Example 4, but the molecular weight of its PEG is 40000-70000, which is different from those in Examples 6 and 7.

[0098] Comparative Example 6: Lyoprotectant, LAMP lyophilized microspheres and their preparation method. Some of the protectant types in the protectant formulation are the same as those in Example 6, but there is no stability experiment, and the storage stability of the lyophilized microspheres cannot be known.

[0099] The above examples only represent the implementation modes of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention.

Claims

1. A freeze-drying protective agent for Ab-Taq enzyme, characterized in that: The lyoprotectant consists of the following components in terms of mass / volume ratio: trehalose 2%-10% (w / v), polyethylene glycol 20000 1%-3% (w / v), mannitol 5%-15% (w / v), poloxamer 188 0.1%-1% (w / v), and the solvent is sterilized purified water.

2. The Ab-Taq enzyme lyophilization protectant according to claim 1, characterized in that: The lyoprotectant consists of the following components in terms of mass / volume ratio: trehalose 3.5% (w / v), polyethylene glycol 20000 1.25% (w / v), mannitol 10% (w / v), poloxamer 188 0.4% (w / v), and the solvent is sterilized purified water.

3. A preparation method of the Ab-Taq enzyme lyophilization protectant according to any one of claims 1-2, characterized in that: The specific steps are as follows: Dissolve trehalose, polyethylene glycol 20000, mannitol, and poloxamer 188 in sterilized purified water according to the components respectively, then mix them evenly and filter to remove bacteria to obtain the lyoprotectant solution.

4. An Ab-Taq enzyme freeze-dried powder, characterized in that: The Ab-Taq lyophilized powder contains the lyoprotectant described in Claim 1 or 2, and also includes an Ab-Taq premix. The volume ratio of the Ab-Taq premix to the lyoprotectant is 1:10-20.

5. The Ab-Taq enzyme freeze-dried powder according to claim 4, characterized in that: The components of the Ab-Taq premix include KCl, (NH4)2SO4, MgSO4, Tris-HCl, BSA, KOH, dNTP, and Ab-Taq DNA polymerase.

6. A preparation method of the Ab-Taq enzyme freeze-dried powder according to any one of claims 4-5, characterized in that: The specific steps are as follows: Step 1: Mix the Ab-Taq premix with the lyoprotectant solution, vortex and centrifuge to obtain a sample. Step 2: Pre-freezing stage: Set the shelf temperature to -40°C to -50°C. When the shelf temperature is stable at -40°C to -50°C, put in the sample and keep it for 2-3 h. Step 3: Annealing stage: Evacuate to 15-20 Pa, set the shelf temperature to -20°C, and keep it for 1-2 h. Step 4: Primary drying stage: Keep the vacuum at 6-10 Pa, lower the shelf temperature to -40°C to -45°C, and keep it for 10-13 h; then raise the shelf temperature to -20°C to -25°C again and keep it for 1-2 h. Step 5: Secondary drying stage: Keep the vacuum at 3-5 Pa, raise the shelf temperature to 0°C and keep it for 1-2 h; then raise the shelf temperature to 10°C again and keep it for 1-2 h; finally, raise the shelf temperature to 20°C to 30°C and keep it for 6-8 h. Step 6: Increase the pressure to atmospheric pressure to obtain the glycerol-free Ab-Taq enzyme lyophilized powder.

Images