High-temperature-resistant xylanase mutant

By transforming the amino acid sequence of Penicillium xylanase, especially the mutation of Lys119 to Met, the high temperature tolerance and enzyme activity of xylanase are significantly improved, the problem of insufficient stability of xylanase under high temperature conditions is solved, and its application in the papermaking industry has been expanded.

CN120290529APending Publication Date: 2025-07-11WEIFANG KANGDIEN BIOTECH LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510696628.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-28
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

The existing xylanases are insufficient in stability and activity under high temperature conditions, making it difficult to meet the needs of the pulp bleaching process in the paper industry.

Method used

By protein engineering of xylanase derived from Penicillium pseudo-vitamin, especially mutating Lys at position 119 of the amino acid sequence into Met, a high-temperature resistant xylanase mutant was obtained and recombinantly expressed in Pichia yeast to improve its enzyme activity and stability under high temperature environment.

Benefits of technology

提高了木聚糖酶在80℃和85℃条件下的酶活残留率,显著增强了其在工业领域的应用潜力。

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The invention relates to the technical field of genetic engineering and protein engineering modification, in particular to a high-temperature-resistant xylanase mutant. On the basis of wild-type xylanase H1, the mutant containing a K119M mutation site is provided, the heat resistance of the mutant is remarkably improved, and wide application of the mutant in the industrial field is promoted.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical fields of genetic engineering and protein engineering modification, and particularly relates to a thermotolerant xylanase mutant. Background Art

[0002] Xylan is the second most abundant renewable resource in nature after cellulose. It consists of β-1,4-linked D-xylose residues, and its side chains are modified by different groups. Due to its complex structure, the complete degradation of xylan requires the synergistic action of multiple enzymes. Among them, endo-β-1,4-xylanase is the key enzyme that randomly hydrolyzes the β-1,4-xylosidic bonds of xylan to generate xylooligosaccharides.

[0003] Enzymes are the catalytic cornerstones of metabolism and are also a hot topic in global research, not only in the biological world but also among researchers in other scientific fields. Enzymes play a core role in many manufacturing processes. Many bacteria, actinomycetes, fungi, and yeasts can produce xylanase. Bacteria generally produce two types of xylanases, namely high-molecular-weight acidic xylanase and low-molecular-weight basic xylanase. Fungi mostly produce low-molecular-weight basic xylanase, and the secretion level of xylanase by filamentous fungi generally exceeds that of yeast and bacteria by a large margin. Given the many advantages of enzyme production by filamentous fungi, especially for industrial application, more research has been conducted on enzyme production by filamentous fungi, especially on the Trichoderma and Aspergillus genera in filamentous fungi. Based on hydrophobic cluster analysis and amino acid sequence similarity analysis, xylanases are mainly divided into glycoside hydrolase (GH) families 10 and 11. Due to their ability to degrade xylan, xylanases have potential applications in biotechnology.

[0004] One major application of xylanase is in the paper industry. During the papermaking process, this enzyme can reduce the usage of toxic chlorine-containing chemicals and improve the brightness of the pulp. For example, pretreatment with Cartazyme HS-10 can reduce chlorine consumption in the C stage by 31% and reduce the total organic chlorine content in the effluent of the extraction stage by 30%. In the CEH sequence, the brightness is increased by 4.9 points. GH family 11 xylanases, due to their small molecular mass (about 20 kDa) and lack of cellulase activity, can easily penetrate the cellulose fiber network without damaging the fibers. Therefore, they are more suitable for use in the pulp bleaching process than GH family 10 xylanases. Since the pulp bleaching process is usually carried out in a high-temperature (60 - 80°C) and high-pH (8 - 10) environment, the xylanases used for this application need to have thermophilicity, thermal stability, alkaliphilicity, and alkali resistance. Although many xylanases have been cloned and characterized, few xylanases have been found to maintain stable activity under high-temperature conditions. Therefore, it is very necessary to engineer natural enzymes to achieve high activity and stability under high-temperature and pH conditions. Summary of the Invention

[0005] The object of the present invention is to provide a thermotolerant xylanase mutant. The present invention has carried out protein engineering modification on the xylanase derived from Paecilomyces sp. ( Paecilomyces. sp ), and obtained a mutant protein, which significantly improves its tolerance to high temperature and is beneficial to its wide application in the industrial field.

[0006] The present invention relates to an alkaline xylanase mutant, which is obtained by mutating the 119th amino acid of the xylanase with the amino acid sequence of SEQ ID NO:1 from Lys to Met.

[0007] The present invention also relates to a DNA molecule encoding the above xylanase mutant.

[0008] The present invention also relates to a recombinant expression plasmid containing the above DNA molecule.

[0009] The present invention also relates to a host cell containing the above recombinant expression plasmid.

[0010] After transferring the above plasmid into the host cell, the tolerance of the recombinantly expressed xylanase mutant to high temperature is significantly improved.

[0011] In some embodiments of the present invention, the host cell is Pichia pastoris ( Pichia pastoris ).

[0012] Compared with the wild-type xylanase H1, after the K119M single-point mutant provided by the present invention is treated at 80 °C and 85 °C for 30 min, the residual enzyme activity rates are respectively as high as 61.48% and 53.06%, far higher than that of the wild-type, and the heat resistance is significantly enhanced, which is beneficial to its wide application in the industrial field. Detailed implementation manners

[0013] The present invention discloses a thermotolerant alkaline xylanase mutant, its preparation method and application, a DNA molecule encoding the xylanase mutant, a vector, and a host cell. Those skilled in the art can draw on the content of this article and appropriately improve the process parameters to achieve it. The methods and applications of the present invention have been described through preferred embodiments. Relevant personnel can obviously make changes or appropriate modifications and combinations to the methods and applications described in this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0014] The present invention uses conventional techniques and methods in the fields of genetic engineering and molecular biology, such as the methods described in MOLECΜLAR CLONING: A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT PROTOCOLSIN MOLECΜLAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can, based on the technical solutions described in the present invention, adopt other conventional methods, experimental protocols, and reagents in the art, without being limited to the specific embodiments of the present invention. For example, the following experimental materials and reagents can be selected for the present invention: Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vector pPIC9k, Amp, and G418 were purchased from Invitrogen.

[0015] Enzymes and kits: PCR enzymes and ligases were purchased from Takara, restriction endonucleases were purchased from Fermentas, plasmid extraction kits and gel purification and recovery kits were purchased from Omega, and the GeneMorph II Random Mutagenesis Kit was purchased from Beijing Bomes Biotechnology Co., Ltd.

[0016] Medium formulations: BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol; BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 0.5% methanol; LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0; LB-AMP plate: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0.

[0017] The method for measuring the enzyme activity of xylanase in the examples of the present invention is as follows: (1) Definition of the enzyme activity unit of xylanase Under the conditions of a temperature of 50°C and a pH of 8.0, the amount of enzyme required to release 1 μmol of reducing sugar from a xylan solution with a concentration of 5 mg / mL per minute is defined as one enzyme activity unit, denoted by U.

[0018] (2) Method for determining xylanase activity Pipette 10.0 mL of xylan solution and equilibrate it at 50 °C for 20 min.

[0019] Pipette 10.0 mL of appropriately diluted enzyme solution and equilibrate it at 50 °C for 5 min.

[0020] Determination of blank sample: Pipette 2.00 mL of appropriately diluted enzyme solution (which has been equilibrated at 50 °C) into a graduated test tube, then add 5 mL of DNS reagent and shake magnetically for 3 s. Then add 2.0 mL of xylan solution, equilibrate at 50 °C for 30 min, and heat in a boiling water bath for 5 min. Cool to room temperature with tap water, make up the volume to 25 mL with water, and shake magnetically for 3 s - 5 s. Use the standard blank sample as the blank control and measure the absorbance A at 540 nm B .

[0021] Determination of sample: Pipette 2.00 mL of appropriately diluted enzyme solution (which has been equilibrated at 50 °C) into a graduated test tube, then add 2.0 mL of xylan solution (which has been equilibrated at 50 °C), shake magnetically for 3 s, and incubate precisely at 50 °C for 30 min. Add 5.0 mL of DNS reagent, shake magnetically for 3 s to terminate the enzymatic reaction. Heat in a boiling water bath for 5 min, cool to room temperature with tap water, make up the volume to 25 mL with water, and shake magnetically for 3 s. Use the standard blank sample as the blank control and measure the absorbance A at 540 nm E .

[0022] Formula (1): X D =[(A E - A B ) × K + C0] × 1000 / (M × t).

[0023] In the formula: X D — Activity of xylanase in the sample dilution, U / mL; A E — Absorbance of the enzyme reaction solution; A B — Absorbance of the enzyme blank sample; K — Slope of the standard curve; C0 — Intercept of the standard curve; M — Molar mass of xylose M(C5XYN 110 O5) = 150.2 g / mol; t — Enzymatic reaction time, min; 1000 — Conversion factor, 1 mmol = 1000 μmol; X D The value should be between 0.04 - 0.10 U / mL. If it is not within this range, the dilution factor of the enzyme solution should be reselected and then the analysis and determination should be carried out again.

[0024] Formula (2): X = X D ·D f .

[0025] In the formula: X — The activity of xylanase in the sample, U / mL; D f — The dilution factor of the sample.

[0026] The calculated value of the enzyme activity is retained to three significant figures.

[0027] The following further elaborates the present invention in combination with specific embodiments.

[0028] Example 1 Construction of recombinant plasmid The xylanase gene derived from Paecilomyces. sp Paecilomyces sp. was optimized according to the codon preference of Pichia pastoris, and 6 bases GAATTC (EcoR I restriction site) were added before its start codon ATG, and GCGGCCGC (Not I restriction site) was added after its stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Biotechnology Co., Ltd. The xylanase was named H1, its amino acid sequence was SEQ ID NO: 1, and the coding nucleotide sequence was SEQ ID NO: 2.

[0029] The xylanase gene was digested with restriction endonucleases EcoR I and Not I (Fermentas); at the same time, the plasmid pPIC9K was digested with restriction endonucleases EcoR I and Not I. The digested products were purified using a gel purification kit, and the above two digested products were ligated with T4 DNA ligase (Fermentas). The ligation product was transformed into DH5α Escherichia coli (Invitrogen), and selection was carried out with ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen).

[0030] The plasmid was purified from the Escherichia coli clone with correct sequencing results using a plasmid miniprep kit (Omega) to obtain 1 recombinant plasmid, which was named pPIC9K-H1.

[0031] Example 2 Screening of thermotolerant xylanase mutants To further improve the heat resistance of xylanase H1, its protein structure was analyzed. This protein is a xylanase of the GH11 family, with a β-jelly roll structure. Both the protein surface and the active center of the protein are exposed to the external environment. Therefore, changes in the external environment, especially high-temperature environments, can directly affect the stability of the enzyme's surface structure and the stability of the enzyme's active center. To improve the tolerance of this enzyme in high-temperature environments, it is necessary to increase the overall rigidity of the protein and stabilize the overall structure of the enzyme. Without destroying the secondary structure and active center of the enzyme protein, the gene was further mutated.

[0032] 1.1 Design PCR primers H1-F1 and H1-R1: H1-F1: GGC GAATTC ATGATGATTGGTATCACTTCTTTTGC (as shown in SEQ ID NO: 3, the underlined part is the recognition site of restriction enzyme EcoRI); H1-R1: ATA GCGGCCGC TTAACCGACGTCTGCAACGGTAATTC (as shown in SEQ ID NO: 4, the underlined part is the recognition site of restriction enzyme NotI).

[0033] Using the H1 gene (SEQ ID NO: 2) as a template, PCR amplification was performed using the above primers with the GeneMorph II Random Mutagenesis PCR Kit (Bimaisi). The PCR products were recovered by gel electrophoresis, digested with EcoRI and NotI, and then ligated to the pET21a vector digested with the same enzymes. The ligation products were transformed into Escherichia coli BL21(DE3), and spread on LB-Amp plates. The plates were incubated upside down at 37 °C. After the transformants appeared, they were individually picked with toothpicks into 96-well plates. 150 μL of LB-Amp medium containing 0.1 mM IPTG was added to each well, and the plates were incubated at 37 °C and 220 rpm for about 6 h. The supernatant was discarded by centrifugation, and the bacteria were resuspended in buffer. The cells were lysed by repeated freezing and thawing to obtain an Escherichia coli cell lysate containing xylanase.

[0034] Two aliquots of the lysate were taken and treated as follows: The first lysate was diluted with a buffer at pH 8.0, and the second lysate was diluted with a buffer at pH 8.0 and then treated at 75 °C for 5 min. Then, 30 μL of the above-treated lysate was taken into two new 96-well plates. 30 μL of the substrate prepared with the corresponding buffer was added to both 96-well plates. After reacting at 50 °C for 30 min, the reducing sugars generated were determined by the DNS method, and the residual enzyme activity rate of the mutants was calculated.

[0035] The experimental results show that different mutants have different activities maintained after heat treatment. Some mutations have no effect on the thermotolerance of xylanase, and some mutations even make its thermotolerance or enzyme activity worse; in addition, there are also some mutations that can improve the thermotolerance of xylanase, but the mutations lead to significant changes in its enzymatic properties, which do not meet the requirements. Finally, the applicant screened a mutation site, K119M, that can significantly improve the thermotolerance of xylanase H1 without affecting its enzyme activity and original enzymatic properties.

[0036] Based on the wild-type xylanase H1, the present invention provides a mutant containing the single-point mutation K119M.

[0037] Example 3 Expression of Xylanase in Pichia pastoris 3.1 Construction of Expression Plasmid According to the codon preference of Pichia pastoris, the gene sequences of alkaline xylanase H1 and its mutants were optimized respectively, synthesized by Shanghai Jierui Biotechnology Co., Ltd., and two restriction enzyme sites, EcoRI and NotI, were added to the 5' and 3' ends of the synthesized sequences respectively.

[0038] According to the method described in Example 1, the synthesized gene sequences of xylanase H1 and its mutants were digested with EcoRI and NotI double enzymes respectively, and then ligated overnight at 16°C with the pPIC-9K vector digested with the same enzymes, and transformed into Escherichia coli DH5α, spread on the LB-Amp plate, and cultured inverted at 37°C. After the transformants appeared, colony PCR (reaction system: template, the picked monoclonal, 0.5 μL of rTaq DNA polymerase, 2.0 μL of 10× Buffer, 2.0 μL of dNTPs (2.5 mM), 0.5 μL of 5'AOX primer (10 mM), 0.5 μL of 3'AOX primer, 14.5 μL of ddH2O, reaction program: pre-denaturation at 95°C for 5 min, 30 cycles: 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min, 72°C for 10 min). The positive clones were verified, and the correct recombinant expression plasmids were obtained after sequencing verification.

[0039] 3.2 Construction of Pichia pastoris Engineering Strains 3.2.1 Preparation of Yeast Competent Cells The Pichia pastoris GS115 strain was activated on a YPD plate. After culturing at 30 °C for 48 h, the activated GS115 monoclonal was inoculated into 6 mL of YPD liquid medium. It was cultured at 30 °C and 220 rpm for about 12 h, and then the bacterial liquid was transferred to a triangular flask containing 30 mL of YPD liquid medium and cultured at 30 °C and 220 rpm for about 5 h. After detecting its cell density with an ultraviolet spectrophotometer, when the OD600 value was in the range of 1.1–1.3, 4 mL of cells were collected into a sterilized EP tube by centrifugation at 4 °C and 9000 rpm for 2 min. The supernatant was gently discarded, and after drying the residual supernatant with a sterilized filter paper, the cells were resuspended with 1 mL of pre-cooled sterilized water. After centrifugation at 4 °C and 9000 rpm for 2 min, the supernatant was gently discarded. After repeating the washing once with 1 mL of sterilized water, centrifugation was carried out at 4 °C and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were resuspended with 1 mL of pre-cooled sorbitol (1 mol / L); after centrifugation at 4 °C and 9000 rpm for 2 min, the supernatant was gently discarded, and the cells were gently resuspended with 100 - 150 μL of pre-cooled sorbitol (1 mol / L).

[0040] 3.2.2 Transformation and screening The recombinant expression plasmids constructed in 3.1 were linearized with Sac I respectively. After purification and recovery of the linearized fragments, they were transformed into Pichia pastoris GS115 by electroporation respectively. Pichia pastoris recombinant strains were screened on MD plates, and then multi-copy transformants were screened on YPD plates containing different concentrations of geneticin (0.5 mg / mL - 8 mg / mL).

[0041] The obtained transformants were transferred to BMGY medium respectively and cultured with shaking at 30 °C and 250 rpm for 1 d; then transferred to BMMY medium and cultured with shaking at 30 °C and 250 rpm; 0.5% methanol was added every day to induce expression for 4 d; the cells were removed by centrifugation at 9000 rpm for 10 min, and the fermentation supernatants containing xylanase H1 and xylanase mutants were obtained respectively.

[0042] 3.3 Heat resistance analysis The fermentation supernatant of the above Pichia pastoris recombinant strain was diluted to 200 U / mL with 0.1 M disodium hydrogen phosphate - 0.05 M citric acid, and then diluted 10 times with a buffer preheated for 10 min and mixed evenly. It was treated at 80 °C and 85 °C for 30 min respectively. Samples were taken at the end and cooled to room temperature, and then the xylanase activity was measured. Taking the enzyme activity of the untreated sample as 100%, the enzyme activity residual rate was calculated. The specific results are shown in Table 1.

[0043] Enzyme activity residual rate (%) = enzyme activity of the treated sample / enzyme activity of the untreated sample × 100%.

[0044] Table 1 Analysis of enzyme activity residual rate of xylanase after heat treatment Xylanase Treated at 80°C for 30 min Treated at 85°C for 30 min Wild-type H1 40.22% 25.04% K119M single-point mutant 61.48% 53.06% As can be seen from the results in Table 1, compared with the wild-type xylanase H1, the single-point mutant containing the K119M mutation site provided by the present invention has the residual enzyme activity rates increased by 21.26% and 28.02% respectively after being treated at 80 °C and 85 °C for 30 min, and its heat resistance is significantly improved, achieving an unexpected technical effect.

[0045] In summary, the heat resistance of the alkaline xylanase mutant provided by the present invention is significantly improved, which is beneficial to its wide promotion and application in the industrial field.

Claims

1. A xylanase mutant, characterized in that, The mutant is obtained by mutating the 119th amino acid of the xylanase with the amino acid sequence of SEQ ID NO:1 from Lys to Met.

2. A DNA molecule encoding the xylanase mutant according to claim 1.

3. A recombinant expression plasmid containing the DNA molecule according to claim 2.

4. A host cell, characterized in that, The host cell described above contains the recombinant expression plasmid according to claim 3.

5. The host cell according to claim 4, wherein, The host cell described above is Pichia pastoris ( Pichia pastoris ).